ID: 1158948906

View in Genome Browser
Species Human (GRCh38)
Location 18:62474125-62474147
Sequence TAGCATAGTCCTAGTAGTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158948906_1158948908 7 Left 1158948906 18:62474125-62474147 CCGCCACTACTAGGACTATGCTA No data
Right 1158948908 18:62474155-62474177 CTTAAAGCCAGCACAGCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158948906 Original CRISPR TAGCATAGTCCTAGTAGTGG CGG (reversed) Intergenic
No off target data available for this crispr