ID: 1158952789

View in Genome Browser
Species Human (GRCh38)
Location 18:62510898-62510920
Sequence GATCTCAGTGGTAAACAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158952781_1158952789 27 Left 1158952781 18:62510848-62510870 CCAGAGCTTGAAAAAAACCTATG No data
Right 1158952789 18:62510898-62510920 GATCTCAGTGGTAAACAATCAGG No data
1158952785_1158952789 3 Left 1158952785 18:62510872-62510894 CCAGGAGCACTGTCAAAAACAAT No data
Right 1158952789 18:62510898-62510920 GATCTCAGTGGTAAACAATCAGG No data
1158952783_1158952789 10 Left 1158952783 18:62510865-62510887 CCTATGCCCAGGAGCACTGTCAA No data
Right 1158952789 18:62510898-62510920 GATCTCAGTGGTAAACAATCAGG No data
1158952784_1158952789 4 Left 1158952784 18:62510871-62510893 CCCAGGAGCACTGTCAAAAACAA No data
Right 1158952789 18:62510898-62510920 GATCTCAGTGGTAAACAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158952789 Original CRISPR GATCTCAGTGGTAAACAATC AGG Intergenic
No off target data available for this crispr