ID: 1158954129

View in Genome Browser
Species Human (GRCh38)
Location 18:62523492-62523514
Sequence GCCCGGCCGCGCGTCCGCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 510
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 485}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158954129 Original CRISPR GCCCGGCCGCGCGTCCGCCT CGG (reversed) Exonic