ID: 1158954163

View in Genome Browser
Species Human (GRCh38)
Location 18:62523605-62523627
Sequence CCGAGTCCCCGGGGCGGCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 331}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158954163_1158954184 22 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954184 18:62523650-62523672 GCGGCGGGGGCGGGTATGCCGGG 0: 1
1: 0
2: 0
3: 17
4: 322
1158954163_1158954178 7 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954178 18:62523635-62523657 GTTGCTGGTGGAGCGGCGGCGGG 0: 1
1: 0
2: 2
3: 39
4: 247
1158954163_1158954173 0 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954173 18:62523628-62523650 GCCGCCTGTTGCTGGTGGAGCGG 0: 1
1: 0
2: 0
3: 16
4: 238
1158954163_1158954186 28 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954186 18:62523656-62523678 GGGGCGGGTATGCCGGGCGGCGG 0: 1
1: 0
2: 1
3: 17
4: 295
1158954163_1158954172 -5 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954172 18:62523623-62523645 CTCGGGCCGCCTGTTGCTGGTGG 0: 1
1: 0
2: 1
3: 5
4: 104
1158954163_1158954182 13 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954182 18:62523641-62523663 GGTGGAGCGGCGGCGGGGGCGGG 0: 1
1: 0
2: 14
3: 236
4: 1599
1158954163_1158954179 8 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954179 18:62523636-62523658 TTGCTGGTGGAGCGGCGGCGGGG 0: 1
1: 0
2: 0
3: 15
4: 168
1158954163_1158954183 21 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954183 18:62523649-62523671 GGCGGCGGGGGCGGGTATGCCGG 0: 1
1: 0
2: 1
3: 55
4: 520
1158954163_1158954171 -8 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954171 18:62523620-62523642 GGACTCGGGCCGCCTGTTGCTGG 0: 1
1: 0
2: 0
3: 6
4: 59
1158954163_1158954181 12 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954181 18:62523640-62523662 TGGTGGAGCGGCGGCGGGGGCGG 0: 1
1: 1
2: 17
3: 134
4: 1161
1158954163_1158954175 3 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954175 18:62523631-62523653 GCCTGTTGCTGGTGGAGCGGCGG 0: 1
1: 0
2: 2
3: 21
4: 303
1158954163_1158954185 25 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954185 18:62523653-62523675 GCGGGGGCGGGTATGCCGGGCGG 0: 1
1: 0
2: 1
3: 15
4: 240
1158954163_1158954177 6 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954177 18:62523634-62523656 TGTTGCTGGTGGAGCGGCGGCGG 0: 1
1: 0
2: 0
3: 30
4: 248
1158954163_1158954180 9 Left 1158954163 18:62523605-62523627 CCGCCGCCGCCCCGGGGACTCGG 0: 1
1: 0
2: 3
3: 29
4: 331
Right 1158954180 18:62523637-62523659 TGCTGGTGGAGCGGCGGCGGGGG 0: 1
1: 0
2: 8
3: 65
4: 508

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158954163 Original CRISPR CCGAGTCCCCGGGGCGGCGG CGG (reversed) Exonic
900087855 1:907044-907066 CCGGGCTCCCGGGACGGCGGTGG - Intergenic
900290716 1:1922497-1922519 CCCAGTCCCAGGGGAGGAGGTGG - Intronic
900384887 1:2405997-2406019 CCGAGTCCCAGTGGGGGCTGGGG + Intronic
901302517 1:8209957-8209979 CCGCGTGCCCTGGGTGGCGGAGG + Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
901489284 1:9588655-9588677 CCGGGTGGGCGGGGCGGCGGCGG - Intergenic
902385450 1:16073290-16073312 CCGCGTCCCCAGGGGTGCGGCGG + Intronic
902480364 1:16708211-16708233 CGGAGCCCCCCGGGCGGCAGCGG - Intergenic
903069053 1:20717742-20717764 GGGAGTCCCCGGCGGGGCGGGGG - Exonic
903398412 1:23020015-23020037 CCAAGACCCGGCGGCGGCGGGGG - Intronic
903435185 1:23344092-23344114 CCGAGGCCCCGGGGTGGGGGTGG - Intronic
903455688 1:23484834-23484856 ACACATCCCCGGGGCGGCGGGGG - Intergenic
904128495 1:28259402-28259424 CTGTTTCCCCGGGGAGGCGGGGG - Intergenic
904701768 1:32362161-32362183 CTGAGTGCCAGGGGCGGCAGGGG - Exonic
905626222 1:39491933-39491955 CCCGGGCCCAGGGGCGGCGGCGG + Exonic
905779033 1:40691783-40691805 CAGAGGCCCAGGCGCGGCGGAGG - Exonic
905803795 1:40861949-40861971 CCGGGTTGGCGGGGCGGCGGCGG + Exonic
905889527 1:41510704-41510726 CGGCGTCCCTGGGGCGGCCGGGG + Exonic
906960914 1:50419091-50419113 CCCAGGCCCCCCGGCGGCGGCGG + Exonic
908534636 1:65066702-65066724 CGGAGTCCCCGCGGCGGCGGCGG - Intergenic
908796225 1:67833364-67833386 CCGAGTCCCGGCGGCGACGGCGG - Exonic
911144669 1:94541355-94541377 CCGAGTCCGTCGGGCGCCGGCGG - Intronic
913979633 1:143497649-143497671 CCCTGGCGCCGGGGCGGCGGGGG - Intergenic
914263569 1:146019431-146019453 GCGGGGCCCCGGGGCGGGGGAGG + Exonic
915463336 1:156082214-156082236 CCCAGCCCCCGGGGTGGGGGTGG + Intergenic
918056136 1:181023197-181023219 CGGAGCCCTCGGGGCGGTGGAGG + Intergenic
920640997 1:207752013-207752035 TCGAGTCACCAGGGCGGCTGGGG - Intergenic
921190084 1:212700469-212700491 CAGAGTCCCTGGGGCGCCCGTGG - Intergenic
922539486 1:226408124-226408146 CCGCGTCCACGGGGCGGGGCCGG + Intergenic
922648828 1:227318843-227318865 CCGGGGCCACGGCGCGGCGGTGG - Intergenic
922718354 1:227888194-227888216 CCGGGTCCCCAAGGCGGTGGGGG + Intergenic
923107831 1:230868245-230868267 CCGAGACCCCGGGGACTCGGAGG - Exonic
1064274202 10:13891779-13891801 CCGAGGGCCCGCGGCGGGGGCGG - Intronic
1064981868 10:21173838-21173860 GCGGTTCCCGGGGGCGGCGGCGG + Intronic
1067694287 10:48523977-48523999 GCGAGTCCCCGAGGCGGGGCTGG + Intronic
1069698438 10:70404646-70404668 CAGCGTCCCCGGGGCTTCGGTGG - Intronic
1070800838 10:79243565-79243587 CCGCGCCCCGGCGGCGGCGGCGG - Intronic
1071695289 10:87863509-87863531 CCGGGCTCCCGGCGCGGCGGCGG + Exonic
1072520688 10:96227380-96227402 CCGAGTGCCCAGGTCTGCGGGGG + Intronic
1076355112 10:129846977-129846999 CTGAGCCCCCAGGGCGGCTGGGG - Intronic
1076402023 10:130190769-130190791 CCGGGTCCCCGGGGACGAGGGGG - Intergenic
1076501292 10:130938216-130938238 CTGAGGCACTGGGGCGGCGGAGG - Intergenic
1076935317 10:133565001-133565023 CCGACGCCCCGGGGAGCCGGGGG - Intronic
1076947932 10:133664788-133664810 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076948922 10:133668098-133668120 CCAGGTCGCCGGGGCGGCGTGGG + Exonic
1076949906 10:133671397-133671419 CCAGGTCGCCGGGGCGGCGTGGG + Intronic
1076950890 10:133674696-133674718 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076951880 10:133678006-133678028 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076952869 10:133681316-133681338 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076953853 10:133684615-133684637 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076954837 10:133740967-133740989 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076955826 10:133744277-133744299 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076956816 10:133747587-133747609 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076957803 10:133750896-133750918 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076958788 10:133754195-133754217 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076959777 10:133757505-133757527 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076960761 10:133760804-133760826 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
1076977906 11:189482-189504 GCGCGTCCCCTGGGGGGCGGGGG + Intronic
1077008369 11:369533-369555 CCGCGCTCCTGGGGCGGCGGCGG - Intergenic
1078345092 11:10540971-10540993 CCGAGGCCCGGGGAGGGCGGCGG + Intronic
1078771801 11:14358721-14358743 CCGGGGCGCCGGAGCGGCGGCGG - Intronic
1081636881 11:44727325-44727347 CCAGGTCCCCGGGGGCGCGGCGG - Intronic
1083289169 11:61680364-61680386 CAGCGTCCCCCGGGGGGCGGAGG + Intergenic
1083457164 11:62786925-62786947 GAGAGCCCCCGGGGCAGCGGCGG + Exonic
1083713202 11:64561150-64561172 CCGAGTGCCCTGGGCTGCGGTGG - Intronic
1084524214 11:69685926-69685948 CCGAGTCCCCGGCCCCGCGCGGG + Intergenic
1084888120 11:72223828-72223850 CCGGCTCCCCGGGGCGGCGCGGG + Intronic
1085396625 11:76209949-76209971 ACGGGTCCCAGGGGCGGCGGGGG - Intronic
1085561265 11:77474203-77474225 CCCCCTCCCCGGCGCGGCGGCGG + Intronic
1087138110 11:94740504-94740526 CCGAGGGCGCGCGGCGGCGGCGG - Intronic
1089500738 11:118929877-118929899 GAGAGTCCCTGAGGCGGCGGTGG - Intronic
1089729461 11:120511527-120511549 CCCAGGCGCGGGGGCGGCGGGGG - Intergenic
1091286730 11:134412196-134412218 CAGAGTCCCCGAGGTGGCGGCGG + Intergenic
1093547649 12:20368124-20368146 CCCACACCCCGGGGCTGCGGTGG + Intergenic
1093931135 12:24956094-24956116 CCAGCTCCCCGGGGCGGGGGCGG - Intergenic
1094465958 12:30754526-30754548 CTGCGTACCCGGGGCGGCTGTGG - Intronic
1094470280 12:30796239-30796261 CTGCGGCCGCGGGGCGGCGGGGG - Intergenic
1095971683 12:47905730-47905752 CCGATGCCACGGGGCGGGGGGGG - Intronic
1098897838 12:76084028-76084050 ACGAGTCCCCGAGGCGGGGAGGG - Intronic
1102136890 12:110583037-110583059 CCGCCTCCTCGGGGGGGCGGCGG - Exonic
1102520681 12:113476062-113476084 CCGGGTCTGCGCGGCGGCGGCGG + Intergenic
1103074264 12:117969302-117969324 CCTGCTCCCGGGGGCGGCGGGGG + Intergenic
1103407705 12:120687363-120687385 CCGGGTCCCCGGATCGCCGGCGG - Exonic
1103534765 12:121626832-121626854 CCCCGTCCCCGCTGCGGCGGCGG - Exonic
1103595461 12:122022292-122022314 CCAAGTCCCGGGGCCCGCGGCGG - Intronic
1104444778 12:128824087-128824109 CCTAGTGCCCGGGGCGGGGCCGG - Intergenic
1104566661 12:129891076-129891098 CCGAGTCACCGGGGAAGAGGAGG - Intronic
1104985283 12:132593208-132593230 CCGGGTTGCCAGGGCGGCGGTGG - Intergenic
1105389148 13:19959025-19959047 CCGAGGCCCCGACGCGGCAGCGG - Intronic
1105425692 13:20292696-20292718 CCCACTCCCCGTGGCGGGGGGGG + Intergenic
1105956440 13:25287444-25287466 CCGAGTCCCCCGGGAGGCCGCGG - Exonic
1106330313 13:28733559-28733581 CCCAGTCCCTGGGGAGGCTGAGG - Intergenic
1108340743 13:49496219-49496241 CCTAGACGCCGGGGCGGCGCTGG + Intronic
1112088209 13:96053535-96053557 CGGAGCCGCCGGGGCGGCGCCGG + Intergenic
1112091874 13:96091076-96091098 GGGGGCCCCCGGGGCGGCGGGGG - Exonic
1113541820 13:111115281-111115303 CCGAGGCCGGGGGGCGGCGGCGG + Exonic
1116905089 14:50396635-50396657 CCGGCTCCCCGCGGAGGCGGCGG + Intronic
1117119523 14:52552936-52552958 CCGAGACCCCCGGGGGGTGGGGG + Intergenic
1117251863 14:53946870-53946892 CCCAGGCCCGGCGGCGGCGGGGG - Intergenic
1118351005 14:64972377-64972399 CCCTCTCTCCGGGGCGGCGGCGG - Intronic
1123039351 14:105484057-105484079 CCTAGACCCGGGGGTGGCGGGGG - Intergenic
1202862090 14_GL000225v1_random:89549-89571 CCAGGTCGCCGGGGCGGCGTGGG - Intergenic
1124014314 15:25863043-25863065 CCGGGCCTCCGGGACGGCGGAGG - Exonic
1124966696 15:34437321-34437343 CCGGGTCCCCGCGGCGCCGCGGG + Intronic
1125536200 15:40442015-40442037 CCGAGTCCGAGGTGTGGCGGGGG + Intronic
1125607840 15:40952430-40952452 CCGAGTCCACAGGCCGCCGGGGG - Intergenic
1128028654 15:64460790-64460812 CCGGGGCCCCGGGCGGGCGGAGG + Intronic
1129333178 15:74838170-74838192 CGGAGCCCCCGGGCCGGAGGCGG - Exonic
1129540859 15:76346302-76346324 CCAATTCCCCGCAGCGGCGGCGG - Intergenic
1129670814 15:77606790-77606812 CCCATTCCCAGGGGCGGGGGCGG - Intergenic
1132378395 15:101348140-101348162 GCGGGACCCCGGGGGGGCGGGGG - Intronic
1132410993 15:101578181-101578203 CCGAGTCCCAGGGGCAGAAGCGG + Intergenic
1132585786 16:705338-705360 CCGAGGCCCAGCGGCCGCGGGGG + Intronic
1132641874 16:981775-981797 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1132837234 16:1960069-1960091 AGGGGTGCCCGGGGCGGCGGGGG - Intronic
1132915280 16:2340577-2340599 CCTGGGCGCCGGGGCGGCGGCGG + Exonic
1135040605 16:19114438-19114460 CCGGGCGCCCGGGGCGGCGGTGG - Exonic
1135437209 16:22437108-22437130 CCACGTCGCCGGGGCCGCGGAGG - Intronic
1136458292 16:30394958-30394980 CCGAGGGCCCGGGGTGGGGGTGG - Intronic
1136910591 16:34141547-34141569 CCGGGTCCCCAGGGCGGCGTGGG - Intergenic
1137636507 16:49991591-49991613 CCCAGTCCCAGGGGCAGTGGAGG - Intergenic
1138686820 16:58733703-58733725 CCGAGTCGGTGGGCCGGCGGCGG - Intronic
1142136282 16:88453352-88453374 CCGAGCGGCCGCGGCGGCGGCGG + Exonic
1142248965 16:88982533-88982555 CTGACTCCAGGGGGCGGCGGTGG - Intergenic
1142302774 16:89268398-89268420 CTGAGCCCCAGGGGCGGAGGAGG - Exonic
1142431079 16:90027743-90027765 CCCAGTCCCCGGGTGGGCGTGGG + Intronic
1142465328 17:133947-133969 GCGCGTCCCCTGGGGGGCGGGGG + Intergenic
1142670544 17:1485752-1485774 CCGGGTCCCGGGCTCGGCGGCGG + Intronic
1142876132 17:2853160-2853182 CCGACTCTGCGGGGAGGCGGGGG + Intronic
1143053281 17:4143893-4143915 CCGGGTCCCCTGGGCCGCCGCGG - Exonic
1143063357 17:4222215-4222237 CGGGGTCCGCGGGGCGGCGGGGG - Intronic
1143371661 17:6444335-6444357 TCGGATCCCCGGGGCGGTGGCGG + Intergenic
1144109803 17:12020896-12020918 CCGAGCCCGAGCGGCGGCGGCGG + Exonic
1144828975 17:18121339-18121361 CAGAGCCCCAGGGGCGGCGAGGG - Exonic
1145089800 17:19977538-19977560 CCGGGCCTCAGGGGCGGCGGTGG - Intronic
1146229484 17:31095280-31095302 CCGCGGCCGGGGGGCGGCGGAGG - Exonic
1147015516 17:37489212-37489234 CCGAGTCCCCGAGGCAGGGCAGG - Intergenic
1147719829 17:42532215-42532237 CTCAGTCACCTGGGCGGCGGCGG - Intergenic
1148021806 17:44558226-44558248 CCGGGTGGCCCGGGCGGCGGCGG + Exonic
1148110960 17:45144465-45144487 CCGCGTCCCCGACGGGGCGGCGG - Intergenic
1148206469 17:45783344-45783366 CCGAGCCCTCTGGGCAGCGGTGG - Intergenic
1151758778 17:76089150-76089172 CAGAGCCCCCGGGGCGGGGCGGG + Intronic
1152087992 17:78231965-78231987 CAGGGCCCCGGGGGCGGCGGGGG - Exonic
1152245452 17:79182768-79182790 CCGGGCCTCCGGGGAGGCGGGGG - Intronic
1152468054 17:80476706-80476728 CCGGGCCCGCGGCGCGGCGGGGG + Intronic
1152544006 17:80991854-80991876 CGGTGGCCGCGGGGCGGCGGTGG + Exonic
1152683928 17:81684362-81684384 CCGAATGCCCGGGCCCGCGGAGG - Intronic
1152729124 17:81961259-81961281 CCGAGCCCGGGCGGCGGCGGCGG - Exonic
1152908503 17:82983740-82983762 CAGGGGCCCCGGGGCGGAGGAGG + Intronic
1153457567 18:5296406-5296428 CCGCGTCCCCGGCGCTGCGCCGG - Intronic
1153515254 18:5895675-5895697 CCGATTCCTCGGGGAGGAGGAGG + Intronic
1155368968 18:25078149-25078171 CCGAGACTCTGGGGCGGCTGGGG + Intronic
1155928958 18:31685620-31685642 CGGGGTCCCCGGGCGGGCGGGGG - Intronic
1157580602 18:48771814-48771836 CAGATTCCCCGCGGCGGCTGGGG - Intronic
1158954163 18:62523605-62523627 CCGAGTCCCCGGGGCGGCGGCGG - Exonic
1159021236 18:63144878-63144900 CACAGTGCCCAGGGCGGCGGGGG - Intronic
1159947763 18:74456972-74456994 CCAAGTCCCCGGGAAGGCTGGGG + Intronic
1160242396 18:77132906-77132928 CCGAGCTCCCGGGGCGGCGCCGG - Intronic
1160594476 18:79964455-79964477 CCGAGGCCCCGGGACGGCCTGGG - Intergenic
1160776618 19:859537-859559 CCCAGTCCCGGGGAGGGCGGAGG + Intergenic
1160790465 19:920592-920614 CCGAGGGTCCGGGCCGGCGGGGG - Exonic
1160843698 19:1157426-1157448 CCGTGTCACCGGGGCCGCGTGGG - Intronic
1160847085 19:1171425-1171447 CAGAGTCCCCAGGGCAGCGCTGG + Intronic
1160991520 19:1862264-1862286 CGCAGTCCCCGGGGCGGCGAGGG - Intronic
1161153601 19:2721457-2721479 GCGGGTCCCCGGGGCGGGGCGGG - Intronic
1161265188 19:3360409-3360431 CCCAGGCCCTGGAGCGGCGGTGG + Intronic
1161393912 19:4034777-4034799 CCGAGTCCCATGGGCTGCTGAGG - Intronic
1161794114 19:6376524-6376546 CAGAGCCCCCGGGGCGATGGAGG + Intronic
1161973446 19:7596289-7596311 CGGAGGCCCCGGCGCGGCAGGGG - Intronic
1161973903 19:7598327-7598349 GCAGGTCCCCGGGGTGGCGGTGG + Intronic
1162176169 19:8832161-8832183 CCGAGTCCAGGGGGCGACGTGGG - Intronic
1162363112 19:10231253-10231275 CTGCGTCCCCAGGGCGGCCGCGG + Exonic
1162410687 19:10503266-10503288 CCGAGGCCCCCCGACGGCGGAGG - Exonic
1163421421 19:17215654-17215676 CGGAGTCCCAGGGACGGGGGCGG - Intronic
1163438589 19:17310035-17310057 CCTGGGCCCCGGGGCGGGGGAGG + Intronic
1165274279 19:34734390-34734412 ATGAGTCCCGGGGGCGGCGGCGG + Intronic
1165772376 19:38386950-38386972 CAGAGTCCCCGCGGGGGCCGGGG + Exonic
1165949835 19:39468092-39468114 CCGAGTCTCCGGGGTGGGGAAGG - Intronic
1166765742 19:45251490-45251512 TCGCGTCCCCAGGCCGGCGGGGG + Exonic
1167265422 19:48480673-48480695 ACCAGCCCCCGGGGCCGCGGCGG - Intronic
1167499278 19:49836298-49836320 CCCAGGCCCTGGTGCGGCGGAGG - Exonic
1167694019 19:51003452-51003474 CTGAGTCCTCGGGGAGGAGGAGG - Intronic
1168315708 19:55483902-55483924 CCCGGGCCCCGGGGAGGCGGGGG + Exonic
926422945 2:12716869-12716891 GCCAGTCGCGGGGGCGGCGGGGG + Exonic
926914268 2:17878259-17878281 CCCAGCCGCCGGGGCCGCGGGGG + Intronic
927125997 2:20012716-20012738 TCGAGGCCCCGGGGCGGGGCGGG - Intergenic
927215825 2:20667351-20667373 CGGAGCCCAGGGGGCGGCGGCGG + Exonic
927815233 2:26209995-26210017 CTGAGTCCCTGGGGATGCGGGGG + Intronic
927904677 2:26848162-26848184 GCGGGTGCTCGGGGCGGCGGCGG - Exonic
928540280 2:32278086-32278108 CCCAGACCCCGAGGCGGCCGCGG - Exonic
930762304 2:55050020-55050042 AGGGGTCCCCGGGGCGCCGGCGG + Exonic
933233711 2:79840680-79840702 CCCAGTCCCCGGGGAGGCCAAGG + Intronic
934261196 2:91478113-91478135 CCGCGGCACCGGGGCGGCGGCGG - Intergenic
934949412 2:98566177-98566199 CCGGCTCCTCGGGGCTGCGGGGG + Intronic
935592733 2:104856222-104856244 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
935645318 2:105329644-105329666 CCCAGGCCGCGGGGCGGCGCGGG - Exonic
936038180 2:109129123-109129145 CCAGGTCCCCGGGGAGGCCGGGG - Intergenic
937895795 2:126976165-126976187 ACGAGTCCCCAGGGCGGCTGTGG + Intergenic
938796021 2:134718862-134718884 GCGTGGCCCCGGGGCGGCGGCGG + Exonic
940640876 2:156342771-156342793 CCGGGGCCCCGGGGCGGGAGGGG + Intergenic
940901452 2:159130031-159130053 ACCAGTACCGGGGGCGGCGGGGG + Intronic
941112126 2:161427193-161427215 TCGAGGCCGCGGGGCCGCGGGGG + Intronic
942045334 2:172096456-172096478 CGGAGTCTCGGGGCCGGCGGCGG + Intergenic
942446162 2:176080291-176080313 CTGGGTTCCCGGGGTGGCGGTGG - Exonic
944114224 2:196170894-196170916 CCGAGTCCCAGCTGCGGCGTGGG - Intronic
944743613 2:202635162-202635184 CCCAGTCACCGGGGAGGGGGGGG + Intergenic
944811202 2:203328703-203328725 CCGTGTCCCCGAGGCGGCCTCGG - Intronic
945492836 2:210476461-210476483 CCGAGTTGCGAGGGCGGCGGCGG + Exonic
947187365 2:227467201-227467223 CAGAGGCCAGGGGGCGGCGGAGG + Intergenic
948046624 2:234951026-234951048 CCGGGTTCCCGGGGTGGGGGTGG + Intergenic
948869048 2:240789208-240789230 CCGGGACCCCGGGTCGGGGGAGG - Intronic
949022690 2:241750366-241750388 CAGAGACCCCGGGTGGGCGGGGG + Intronic
1169214734 20:3786518-3786540 CCCCCGCCCCGGGGCGGCGGCGG - Exonic
1171482601 20:25465400-25465422 CTGAGTCCCTGGAGCCGCGGGGG - Intronic
1174204478 20:48828493-48828515 CTGACTTCCCGGGGCCGCGGAGG - Intergenic
1174399346 20:50267596-50267618 CCAAGCCCCGGGGGTGGCGGGGG + Intergenic
1174400570 20:50273738-50273760 CAGAGTGCCCGGGGCCGGGGGGG - Intergenic
1175267129 20:57709727-57709749 CCAAGTTCCCGGGGCGCCGCGGG + Exonic
1175715858 20:61253542-61253564 CCGAGGCCGCGGGGCGCTGGGGG + Intronic
1175966088 20:62660910-62660932 CCGCCTCCCCGGGGCTGCGAGGG + Intronic
1176016624 20:62937405-62937427 CGGAGTCCCGGCGGCGGCGCGGG - Intronic
1176087657 20:63305403-63305425 CCGAGTCCCCTGGGTAGGGGTGG - Exonic
1179561597 21:42219244-42219266 CCATGCCCCGGGGGCGGCGGCGG - Exonic
1180064682 21:45406195-45406217 CAGAGGCCCGGGGGAGGCGGCGG + Intronic
1180843849 22:18971073-18971095 CCCAGTCCGCGAGGCGGGGGCGG - Intergenic
1181006532 22:20016353-20016375 CCGAGACCCCGGGCCGGCGGGGG - Intronic
1181277946 22:21698542-21698564 CCTAGTCCCCGGGGCATCGGAGG + Exonic
1181671901 22:24429531-24429553 CAGAGGCCCCGGGGAGGGGGCGG - Intronic
1182124057 22:27803896-27803918 CCTAGGCCCCGGGGCGGGCGGGG - Intergenic
1182420439 22:30246118-30246140 CTGAGGCCCCGGGGTGGCTGCGG + Intronic
1183492056 22:38122061-38122083 CAGAGTCCCATGGGCGGAGGAGG - Intronic
1183601646 22:38843688-38843710 CCGCGTCCCCGGGCCCGCAGCGG - Exonic
1183720194 22:39557908-39557930 CTGAGCCCCCGGGGCGCGGGGGG - Intergenic
1183931402 22:41237988-41238010 CCGCGTCCCCAGGGCAGCGCAGG + Exonic
1183961519 22:41414218-41414240 CCGAGTCCCCCAGGCGGAGCTGG - Intergenic
1184731817 22:46374882-46374904 CCGAGGCCCCGGGCTGGCGGGGG - Intronic
1185037931 22:48489457-48489479 CCGGGGCCCGGGCGCGGCGGCGG + Exonic
1185055198 22:48575669-48575691 CCTAGTCCCGGCCGCGGCGGCGG + Intronic
1185336210 22:50271875-50271897 CCCAGTCCACGGGGAGGCGCAGG - Intergenic
1185343057 22:50300073-50300095 CGGAGTCCCCGGGAGGGCGCGGG - Intronic
954863278 3:53708028-53708050 CAGAGTCCCCGGGCAGGCAGGGG - Intronic
954912693 3:54122392-54122414 CGGACTCCCCGGGGCCGCCGAGG + Intergenic
956468642 3:69542628-69542650 CCCAGCCCCCGGAGAGGCGGCGG - Intergenic
959530732 3:107431540-107431562 CCGAGCCCCGGCGGCGGCGGCGG - Intergenic
960848018 3:122022318-122022340 CGCAGTCCCCCGGGAGGCGGGGG - Intergenic
961389204 3:126542423-126542445 GCGGCTCCCCGGGGCCGCGGCGG - Exonic
961743234 3:129046800-129046822 CCTAGTCCTGGGGGAGGCGGCGG + Intergenic
966362835 3:179148538-179148560 CCCAGCCCCGCGGGCGGCGGCGG - Exonic
966915847 3:184583767-184583789 CTGCGTCCCCGGGGCGGACGCGG + Intronic
967859018 3:194137889-194137911 CCGGGTCCCGGTGGGGGCGGTGG - Exonic
968161638 3:196432021-196432043 CCGGGTCCCCGGGCCGGCGGGGG + Intronic
968437241 4:600121-600143 CCGAGTTCCCAGGGCAGGGGTGG - Intergenic
968659637 4:1793703-1793725 CCGGGAGCCCTGGGCGGCGGCGG + Intronic
969415535 4:7055516-7055538 CCGCGTGCCCGGGGCTGCGCTGG - Exonic
970202882 4:13627490-13627512 CCGGGGCCCGGCGGCGGCGGCGG + Exonic
971257888 4:25030728-25030750 CCGAGCGCGCGGCGCGGCGGTGG - Exonic
972960646 4:44448413-44448435 GCAGGGCCCCGGGGCGGCGGCGG + Exonic
973954410 4:56049043-56049065 CCGAGCGCCCGAGGCGCCGGCGG + Intergenic
978393539 4:108253031-108253053 CCTAGTCCTGGGGGCGGGGGGGG + Intergenic
979205463 4:118033328-118033350 GCGAGTCCCCGAGGCGACGCTGG - Intergenic
981300934 4:143185173-143185195 TCGAGGGCCCGGGGCGGCGGCGG + Exonic
984735001 4:183099813-183099835 CCGGGTCCCCGGAGGGGCGTCGG - Intronic
985445998 4:190021696-190021718 CCAGGTCGCCGGGGCGGCGTGGG - Intergenic
985451386 4:190065589-190065611 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
985452376 4:190068882-190068904 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
985453361 4:190072179-190072201 CCAGGTCGCCGGGGCGGCGTGGG + Exonic
985454351 4:190075472-190075494 CCAGGTCGCCGGGGCGGCGTGGG + Exonic
985455339 4:190078765-190078787 CCAGGTCGCCGGGGCGGCGTGGG + Exonic
985457311 4:190085359-190085381 CCAGGTCGCCGGGGCGGCGTGGG + Intergenic
985458298 4:190088652-190088674 CCAGGTCGCCGGGGCGGCGTGGG + Exonic
985459287 4:190091952-190091974 CCAGGTCGCCGGGGCGGCGTGGG + Exonic
985463539 4:190174721-190174743 CCAGGTCGCCGGGGCGGCGTGGG + Exonic
985716232 5:1463510-1463532 CCGAGTTCCAGGGGCCTCGGGGG - Exonic
990955151 5:61332811-61332833 CCCGGCCCCCGCGGCGGCGGCGG - Exonic
994043617 5:95284656-95284678 CCGGGTCCCCGCGGCGCTGGCGG + Intergenic
994171349 5:96662445-96662467 CCGGGGCCGCGGGGAGGCGGCGG - Exonic
997470493 5:134114664-134114686 CCGAGTGCCGGGGGCGGGGCGGG - Intergenic
997521699 5:134527487-134527509 CCGAGCCCCAGGGGCGGGTGGGG - Intronic
997963339 5:138338593-138338615 GCTGGTCCCCGGGGCGGGGGGGG - Intronic
998583713 5:143404535-143404557 CCGAGTCTGCGAGGCGGCGGCGG + Intronic
1001674331 5:173499654-173499676 CCCAGTCCCCGGGGCCTTGGGGG + Intergenic
1002190136 5:177473603-177473625 CAGAGGCTCCGAGGCGGCGGCGG - Intronic
1002927303 6:1611775-1611797 CTGAGTCACGGCGGCGGCGGCGG + Exonic
1004044694 6:12012456-12012478 CCGCGACCCCCGCGCGGCGGCGG - Exonic
1006180163 6:32149652-32149674 CCTGGGCCCTGGGGCGGCGGGGG + Exonic
1006860839 6:37170671-37170693 CCGCATCCCCGGGCCGGAGGCGG - Intronic
1007631435 6:43275430-43275452 CCCTGGCCCCGGGGCGGGGGCGG + Intronic
1007644454 6:43369511-43369533 CCGGGCCCCCGGGGCGACGCGGG - Intergenic
1012399274 6:98831532-98831554 CCCAGAGCCCGGGGCGGGGGAGG + Intergenic
1015935733 6:138404513-138404535 GCCAGACCCCGGGGCGGCCGAGG + Exonic
1017164155 6:151391545-151391567 CGGTGTCTCCGGCGCGGCGGCGG + Exonic
1017735009 6:157354758-157354780 CCGAGCACCCTGGGCGGCCGAGG - Intergenic
1019303697 7:322391-322413 CTGGGTCTGCGGGGCGGCGGGGG - Intergenic
1020021276 7:4870852-4870874 CCGAGTCCCCAGGGCAGGAGGGG + Intronic
1020274162 7:6615080-6615102 CCTAGACCCCGGGGCTGGGGAGG - Intergenic
1022715265 7:32892289-32892311 CCGAGTAGCCGCGGCGGCCGAGG + Intronic
1023294306 7:38699185-38699207 TCGAGTCCCCGGGGCATGGGTGG + Intergenic
1023773691 7:43583343-43583365 CCGCGGGCCTGGGGCGGCGGCGG - Exonic
1025829805 7:65038755-65038777 CCCAGGCCGCGGGGCGGAGGTGG + Intergenic
1025917060 7:65873755-65873777 CCCAGGCCGCGGGGCGGAGGTGG + Intronic
1026740681 7:72976527-72976549 CCCAGTCCCCGGGGGGGCGCAGG - Intergenic
1026833657 7:73624377-73624399 CCGAGTCTCCGGCGCAGCGCGGG - Exonic
1026909472 7:74083901-74083923 CCGCCTCCCCGGGCCGGCGGCGG + Intronic
1027103051 7:75388544-75388566 CCCAGTCCCCGGGGGGGCGCAGG + Intergenic
1028541874 7:91951448-91951470 CCGAGTAGCTGGGGCTGCGGGGG + Intronic
1028922335 7:96322031-96322053 TCTAGTCCCGGCGGCGGCGGCGG + Exonic
1029420085 7:100467770-100467792 CCCAGGCCCCGGTGGGGCGGGGG + Intronic
1029456181 7:100673707-100673729 CCGGGTCCTGGGCGCGGCGGCGG + Exonic
1029640766 7:101817449-101817471 CGGAGTCCCCGGCGCCGCGGGGG + Intronic
1031134825 7:117873308-117873330 CCGAGTTCCCGGGGCGGGCGCGG - Intronic
1032174483 7:129612105-129612127 CCGAGAGCCCCAGGCGGCGGAGG - Intronic
1034278955 7:149838526-149838548 CTGGGTCCCCGGGGCGGTCGCGG + Exonic
1035153207 7:156892622-156892644 CCGAGGCCGCGGGGCGGGGGCGG + Intronic
1035272761 7:157730185-157730207 CCGAGTGCCCGGGGGGGGGCAGG - Intronic
1036562095 8:9906405-9906427 CAGAGTCCCCTCGGCGGCCGCGG + Intergenic
1036664799 8:10731136-10731158 CTGAGAGCCAGGGGCGGCGGGGG - Intronic
1037491373 8:19399987-19400009 CTGAGTCCCTGGGGCGACTGTGG + Intergenic
1037803876 8:22049056-22049078 CCGAGCCCCCGGAGGGGCCGGGG + Intronic
1037815416 8:22109300-22109322 TCGGGTCCCCCGGGGGGCGGCGG + Exonic
1037884537 8:22589303-22589325 CCGAGTCGCCAGCGCGGCCGAGG - Exonic
1037903775 8:22703511-22703533 CCGCGTTCCAGGGGCGGCGCGGG + Intergenic
1039542359 8:38382393-38382415 GCGAGTCGGCGGGGCGGAGGGGG + Intergenic
1042785096 8:72537387-72537409 CCGAGGCGCAGCGGCGGCGGCGG - Exonic
1043464039 8:80487227-80487249 CCGAGGTCTCGGGGCGGCCGCGG - Exonic
1043502960 8:80874331-80874353 CCGCGGCTCCCGGGCGGCGGCGG - Intronic
1044719851 8:95134299-95134321 CCGTCCCCCCGCGGCGGCGGCGG - Intronic
1044999808 8:97869420-97869442 CCGGGGCCCCGGGGCGCTGGGGG - Intronic
1046770434 8:118111979-118112001 CCGAGGCGCCGGCGCGGCGTTGG + Intergenic
1047615414 8:126558532-126558554 CCGAGTGGGCGGGGCGGGGGCGG - Intergenic
1048214264 8:132480863-132480885 CCGGCGCTCCGGGGCGGCGGCGG + Exonic
1049396412 8:142403092-142403114 CCGAGGCCCAGGTGAGGCGGCGG - Exonic
1049854559 8:144853152-144853174 CCGATTCCCCCGGGCGGGGAGGG - Intronic
1049896128 9:113513-113535 CCGGCTCCGCGGGGCGGCGCGGG + Intergenic
1054835652 9:69672546-69672568 CCGCGAGCCCGCGGCGGCGGCGG + Intergenic
1056992345 9:91423722-91423744 CCGGGCCTCCGGGGCCGCGGCGG + Exonic
1057443435 9:95097976-95097998 CCGAGCCCCCGGGCTGGGGGAGG + Intergenic
1057489150 9:95508375-95508397 CTCCGTCCCCGCGGCGGCGGCGG - Exonic
1057546129 9:96021487-96021509 CCGTGTCCCCCAGGCCGCGGGGG - Intergenic
1057786004 9:98087748-98087770 CCGAGGCCCCGCGGCGCCGAAGG + Exonic
1057922153 9:99105685-99105707 CCGTGCCCAGGGGGCGGCGGCGG - Intronic
1058070770 9:100598741-100598763 CCCAGTCCCCAGGTAGGCGGGGG + Intergenic
1059414798 9:114155977-114155999 CCGAGGCACAGCGGCGGCGGCGG + Exonic
1060832066 9:126723059-126723081 CCGAGTGCCTGGGGCAGCGCTGG - Intergenic
1061298389 9:129689710-129689732 CCGACTCTCCGGGGTGGGGGCGG + Intronic
1061321712 9:129835176-129835198 CCGAGTCGCCCCGGCGGCGACGG + Exonic
1061624861 9:131835655-131835677 CCAAGTCCCCGGGCCGGAGTTGG - Intergenic
1061666155 9:132161999-132162021 CCGCGTCTCCGGGACGGCTGCGG + Exonic
1062230659 9:135479949-135479971 CCACGTCCCGGGGGAGGCGGCGG - Exonic
1062451075 9:136616086-136616108 CCGAGTCACCGGAGGGGCAGGGG - Intergenic
1062488259 9:136791696-136791718 CCGAGTCCCTGGGGTGGCAGAGG - Exonic
1185457755 X:319232-319254 CCGAGCCTCGGCGGCGGCGGCGG + Intergenic
1185890313 X:3816351-3816373 GAGACTCCCCGGGGCTGCGGGGG + Intergenic
1187172917 X:16869749-16869771 CCTCGGCCCCGGGGCGGAGGCGG - Exonic
1187669580 X:21656130-21656152 CCGAGTCCACTGGTCGGCGCCGG + Exonic
1189282422 X:39828146-39828168 ACGAGTCCCTGGGGAGGCTGTGG + Intergenic
1189821473 X:44873339-44873361 CGGAGCCCCCGGGTCGGCAGCGG - Intronic
1192147888 X:68693984-68694006 CCCAATCCCAGGGGCGGGGGTGG - Intronic
1197203041 X:123765250-123765272 CCGAGTGGCGGCGGCGGCGGCGG - Intergenic
1197709337 X:129654644-129654666 CCGGCTCGCCGGGGCCGCGGCGG - Exonic
1198388097 X:136147551-136147573 CCGAGGCCGAGGCGCGGCGGTGG - Exonic
1199335940 X:146619507-146619529 CTGAGCCCCAGGGGCGGAGGAGG - Intergenic
1199679589 X:150215709-150215731 TCAAGGCCCCGGGGCGGGGGCGG - Intergenic
1199695642 X:150341340-150341362 TCAAGGCCCCGGGGCGGGGGCGG + Intergenic
1201178224 Y:11322505-11322527 CCAGGTCACCGGGGCGGCGTGGG + Intergenic