ID: 1158959704

View in Genome Browser
Species Human (GRCh38)
Location 18:62579421-62579443
Sequence CGCCCTTGACGCAGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158959700_1158959704 -2 Left 1158959700 18:62579400-62579422 CCTGTGTGTGTTGCTCCACGCCG No data
Right 1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158959704 Original CRISPR CGCCCTTGACGCAGTCCTGG TGG Intronic