ID: 1158959704

View in Genome Browser
Species Human (GRCh38)
Location 18:62579421-62579443
Sequence CGCCCTTGACGCAGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158959700_1158959704 -2 Left 1158959700 18:62579400-62579422 CCTGTGTGTGTTGCTCCACGCCG 0: 1
1: 0
2: 5
3: 131
4: 1970
Right 1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158959704 Original CRISPR CGCCCTTGACGCAGTCCTGG TGG Intronic
900242448 1:1623524-1623546 CGCCCTCGCCGCCGTCCTGCTGG - Exonic
900561616 1:3309861-3309883 CCCCCTTGAGGGAGTCCTTGAGG + Intronic
902583403 1:17423465-17423487 CGCACCTGCAGCAGTCCTGGAGG - Intronic
904271780 1:29354908-29354930 CCCGCCTGACCCAGTCCTGGTGG + Intergenic
915633537 1:157170919-157170941 CGCCCTGGACTCTGGCCTGGTGG + Intergenic
915671253 1:157490748-157490770 CGCCCTGGACTCTGGCCTGGTGG - Intergenic
1065241387 10:23708606-23708628 AGGCCTTGAGGCAGTCCTTGCGG + Intronic
1074599509 10:114899613-114899635 CACCCTTGAACCAATCCTGGTGG + Intronic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1083224073 11:61273667-61273689 TGCCCCTGACTCAGTCCTGAAGG - Intronic
1084916686 11:72434105-72434127 CGCCCTGGCCGCAGCGCTGGTGG - Exonic
1085448149 11:76614988-76615010 AGCCCTTGACGCAGTCCCCTTGG + Intergenic
1089462206 11:118659890-118659912 CGCCCTGAACACAGTCCTGTGGG - Exonic
1089466736 11:118690525-118690547 CGCCCTGAACACAGTCCTGTGGG - Intergenic
1091599356 12:1908599-1908621 TGTCCGTGACGCAGTCCTGGGGG - Intronic
1092282386 12:7108205-7108227 CTCCCTGGCCACAGTCCTGGCGG + Intronic
1113448442 13:110388213-110388235 CTCGCTTGCCGCCGTCCTGGAGG - Intronic
1113786463 13:113004443-113004465 CCCCCATGGCGCAGTGCTGGGGG + Intronic
1115474440 14:33800179-33800201 CGGCCTGGACGCGGGCCTGGTGG + Exonic
1119640121 14:76308602-76308624 CCCCCTTGAAGCTGGCCTGGGGG - Intergenic
1121456594 14:94042575-94042597 GGCCCTTGGAGCAGCCCTGGAGG + Intronic
1124200278 15:27673479-27673501 CACCCTTGACTCTCTCCTGGGGG + Intergenic
1126574300 15:50182436-50182458 CGCCATCTACACAGTCCTGGCGG + Exonic
1131071851 15:89471088-89471110 CTCCCTTCTCGCAGTCCTGCTGG + Intergenic
1132870929 16:2115470-2115492 AGCCATTGGCGCAGGCCTGGGGG + Exonic
1134521599 16:14921413-14921435 AGCCATTGGCGCAGGCCTGGGGG - Intronic
1134709270 16:16320064-16320086 AGCCATTGGCGCAGGCCTGGGGG - Intergenic
1134950335 16:18348581-18348603 AGCCATTGGCGCAGGCCTGGGGG + Intergenic
1143459742 17:7094599-7094621 CTCCCTTGACCCAGCCCTTGAGG - Intergenic
1151188843 17:72383076-72383098 CATCCTTGACCCACTCCTGGGGG - Intergenic
1152424273 17:80210496-80210518 CGCCCCCGACGGCGTCCTGGAGG - Exonic
1156462613 18:37329862-37329884 TGCCCATGACGCTGACCTGGGGG + Intronic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160540660 18:79618393-79618415 CGCTCATCACGCACTCCTGGGGG + Intergenic
1161206884 19:3046274-3046296 TGCCCTTCAGGCAGTCTTGGGGG - Intronic
1162769487 19:12940534-12940556 CGGGCTTGTCCCAGTCCTGGGGG - Exonic
1165907677 19:39203703-39203725 CTCCCTAGAACCAGTCCTGGAGG - Intronic
1166974759 19:46599452-46599474 CTCCCTTGAGGCACTCCTGATGG + Intronic
925925219 2:8665283-8665305 CGCTCTTCACGCAGGCCTGGTGG - Intergenic
926207737 2:10846001-10846023 CACCCTTGTCCCAGCCCTGGGGG + Intergenic
928211673 2:29328371-29328393 CTCCCTGGGCACAGTCCTGGTGG + Exonic
936900314 2:117474504-117474526 CTCCCGTGAGGCAGGCCTGGTGG - Intergenic
948454940 2:238100560-238100582 AGAACTTGACGCAGTCCAGGTGG - Exonic
1169025978 20:2371932-2371954 CTCCCTAGATGCAATCCTGGAGG - Intergenic
1169674879 20:8142231-8142253 CAGCCTTGAGGCAGACCTGGAGG + Intronic
1180230788 21:46425727-46425749 CGCCCTTCACAGAGTCCTGGCGG + Intronic
1184788271 22:46682516-46682538 CGCCCTCGTCGCAGTCCCGAGGG - Intergenic
1185266264 22:49905967-49905989 GGGCCTTGAGACAGTCCTGGGGG - Intronic
957792031 3:84953720-84953742 CGCCATTGACTCTGGCCTGGGGG + Intergenic
973845998 4:54913982-54914004 TGCCCTTGAAGGCGTCCTGGTGG + Intergenic
979710446 4:123772953-123772975 CACCCTTGGCGTAATCCTGGAGG + Intergenic
982337578 4:154257592-154257614 CTCTGTTGATGCAGTCCTGGGGG - Intronic
985580742 5:694008-694030 CGCCCTTCACGCAGGAGTGGAGG + Intergenic
985595364 5:785340-785362 CGCCCTTCACGCAGGAGTGGAGG + Intergenic
985857503 5:2441729-2441751 CACCCTTGGCGCAGTGTTGGAGG - Intergenic
985927558 5:3029695-3029717 CGCCTTTGACGCCCACCTGGTGG - Intergenic
986195347 5:5532909-5532931 CGGCCTTGATGCCGTCCTTGGGG - Intergenic
990981060 5:61602785-61602807 CACTCTTAAAGCAGTCCTGGTGG + Intergenic
993809290 5:92455942-92455964 CACTCTTGAAACAGTCCTGGTGG + Intergenic
997607046 5:135182687-135182709 CCCCCTTGAGCCAGGCCTGGGGG - Intronic
1006510487 6:34518665-34518687 CACCTTTGACTCAGTCCAGGAGG + Intronic
1008662437 6:53681963-53681985 AGCCCTGGGCCCAGTCCTGGAGG + Intergenic
1017771495 6:157648312-157648334 TGCCCTGGACACAGTCATGGTGG - Intronic
1030907700 7:115206844-115206866 GACCCTTGACCCAGCCCTGGAGG + Intergenic
1032787318 7:135211295-135211317 CGCCCCGGAGGCAGTGCTGGGGG + Intronic
1049656675 8:143802167-143802189 TGTCCTTGAGGGAGTCCTGGTGG - Intronic
1057224147 9:93278490-93278512 GGCGCTTGCCTCAGTCCTGGAGG + Intronic
1062461927 9:136665863-136665885 CGCCCTCGACCCAGCCCGGGCGG - Intronic