ID: 1158960265

View in Genome Browser
Species Human (GRCh38)
Location 18:62582351-62582373
Sequence CAATTCTCATTTTACATCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 708
Summary {0: 1, 1: 0, 2: 3, 3: 49, 4: 655}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158960265_1158960268 1 Left 1158960265 18:62582351-62582373 CCCTAGATGTAAAATGAGAATTG 0: 1
1: 0
2: 3
3: 49
4: 655
Right 1158960268 18:62582375-62582397 TCTTTTAAATTATGGTTCAGTGG 0: 1
1: 0
2: 0
3: 30
4: 383
1158960265_1158960270 6 Left 1158960265 18:62582351-62582373 CCCTAGATGTAAAATGAGAATTG 0: 1
1: 0
2: 3
3: 49
4: 655
Right 1158960270 18:62582380-62582402 TAAATTATGGTTCAGTGGCCGGG 0: 1
1: 0
2: 0
3: 16
4: 181
1158960265_1158960267 -7 Left 1158960265 18:62582351-62582373 CCCTAGATGTAAAATGAGAATTG 0: 1
1: 0
2: 3
3: 49
4: 655
Right 1158960267 18:62582367-62582389 AGAATTGCTCTTTTAAATTATGG 0: 1
1: 0
2: 2
3: 40
4: 414
1158960265_1158960269 5 Left 1158960265 18:62582351-62582373 CCCTAGATGTAAAATGAGAATTG 0: 1
1: 0
2: 3
3: 49
4: 655
Right 1158960269 18:62582379-62582401 TTAAATTATGGTTCAGTGGCCGG 0: 1
1: 0
2: 0
3: 12
4: 195
1158960265_1158960271 14 Left 1158960265 18:62582351-62582373 CCCTAGATGTAAAATGAGAATTG 0: 1
1: 0
2: 3
3: 49
4: 655
Right 1158960271 18:62582388-62582410 GGTTCAGTGGCCGGGCACAGTGG 0: 1
1: 1
2: 27
3: 277
4: 2011

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158960265 Original CRISPR CAATTCTCATTTTACATCTA GGG (reversed) Intronic
902531854 1:17095815-17095837 CAATTCCCATTTCACAGCTCAGG - Intronic
902717129 1:18280603-18280625 CTATCCTCATTTTACAGGTAAGG + Intronic
904141074 1:28353543-28353565 TATTTCTCATTTTACAGGTAAGG - Intergenic
904214971 1:28912124-28912146 ACATCCTCATTTTACATATAAGG - Intronic
904885536 1:33735464-33735486 AATTTCTGATTTTACACCTAAGG + Intronic
905233179 1:36528336-36528358 CCATTCTCAATTTACAGGTAAGG + Intergenic
905306762 1:37024943-37024965 TTATTCTCATTTTACAGGTAAGG + Intronic
905312064 1:37056299-37056321 CAGTTCTCATTTCCCATCCAGGG - Intergenic
905320722 1:37114982-37115004 CCATTCCCATTTTATAGCTATGG - Intergenic
905580322 1:39079320-39079342 TTATTCTCATTTTACAAATAAGG - Intergenic
905918489 1:41702482-41702504 CAGTTCCCATTTTACATACAGGG - Intronic
906011116 1:42527439-42527461 TTATTCTCATTTTACAGGTAAGG - Intronic
906653399 1:47530568-47530590 CTATTCTCATTTTACAAAGACGG + Intergenic
907426933 1:54385767-54385789 CAATCCCCATTTTACAGATAAGG + Intronic
907515840 1:54992874-54992896 CAATTCCCATTTTACAGATGAGG - Intergenic
907573190 1:55502984-55503006 AGATTCCCATTTTACATATAAGG + Intergenic
907616195 1:55929498-55929520 TTATTCTCATTTTACATATGAGG + Intergenic
907630446 1:56076283-56076305 CTATTCTCATTTTACAGATGAGG + Intergenic
907708650 1:56855241-56855263 TTATTCTCATTTTACAGCTAGGG - Intronic
907734459 1:57098325-57098347 TAATTCTAATTTTACAAATAAGG + Intronic
907810432 1:57864405-57864427 TCATTCTCATTTTATAGCTAAGG + Intronic
907855426 1:58298999-58299021 AAATTCTGATTTTATGTCTAAGG + Intronic
908011998 1:59787454-59787476 CAATTCTCATCTTACATGGATGG + Intergenic
908110463 1:60892057-60892079 CATTTCACATCTTACATCCAAGG - Intronic
908166832 1:61467292-61467314 TTATTCCCATTTTACATATAGGG + Intergenic
908166899 1:61467863-61467885 TTATTCCCATTTTACATATAGGG - Intergenic
909019466 1:70414796-70414818 TTATTCTCCTTTTACATATATGG - Intronic
909058282 1:70848110-70848132 CAAGTCACATTTTACATGGATGG + Intergenic
909476619 1:76088125-76088147 TAATCCTCATTTTACAGGTAAGG + Intronic
909705131 1:78572696-78572718 CAACTGTCATTTTACAGGTAAGG + Intergenic
909710368 1:78642748-78642770 CAATTTACATTTTATTTCTATGG + Exonic
909717488 1:78727053-78727075 TAAGTCTCATTTTACAGATAGGG - Intergenic
910298575 1:85679373-85679395 AAAGACTTATTTTACATCTAGGG - Intronic
910508393 1:87976670-87976692 CTATTCTCATTTTACAAATGAGG - Intergenic
910584398 1:88863223-88863245 TTATTCTCATTTTACAGATAAGG + Intronic
911393614 1:97277346-97277368 CAACTCTCATTTTAGATTCAAGG - Intronic
911500432 1:98679170-98679192 CAAGTCTCATCTTACATGGATGG + Intronic
911681476 1:100721009-100721031 AAATGATCATTTTACAGCTAAGG - Intronic
911790729 1:102012623-102012645 TAATTCTTATTTTACATTTGAGG + Intergenic
912196669 1:107405320-107405342 CAATTCCCATTTTACAGCAGAGG + Intronic
912780154 1:112538915-112538937 TTATTCTCATTTTACAACTAAGG + Intronic
912834119 1:112980384-112980406 CAATTTCCATTTTATATCCAGGG - Intergenic
913240239 1:116823935-116823957 CATCTCTCATTGTAGATCTAGGG - Intergenic
913337073 1:117718177-117718199 CAAGTCACATCTTACATGTATGG - Intergenic
915437389 1:155918851-155918873 CTGTGCCCATTTTACATCTAAGG + Intronic
915587743 1:156853332-156853354 CAATGATCATTTTACAGCTGAGG + Intronic
916088377 1:161287786-161287808 CAATTCTCATCTTATGTCCATGG - Intergenic
916446075 1:164873041-164873063 TAATCCTCATTTTATATTTATGG + Intronic
916829933 1:168480668-168480690 GAAATGTGATTTTACATCTATGG - Intergenic
916844460 1:168634938-168634960 TAATTCTCATTTTGCAAGTAAGG + Intergenic
918969803 1:191398737-191398759 CAAGTCACATTTTACATGGATGG - Intergenic
919065884 1:192692686-192692708 CAAGTCACATTTTACATGGATGG + Intergenic
919455178 1:197812698-197812720 TAATTCTCATTTTAAGTCTGGGG - Intergenic
920037355 1:203075002-203075024 TTATTCTCATTTTACAGATAAGG + Intronic
920349136 1:205326130-205326152 CAAATCTCCTTTTACAGATAAGG - Intergenic
921115158 1:212083183-212083205 CAAGTCACATTTTACATGGATGG + Intronic
921343715 1:214159948-214159970 CAATGTTCATCTTACATATATGG + Intergenic
922310267 1:224382035-224382057 TAATTCTCATTTTACAAATGAGG - Intergenic
922314110 1:224426410-224426432 CAAATCTCATCTTAAATATACGG + Intronic
922442579 1:225668274-225668296 CAATTTTTATTACACATCTAGGG - Intergenic
922468479 1:225861216-225861238 CGATTCCCATTTTACAGATAAGG + Intronic
923345847 1:233051830-233051852 CAATTTTCATTTTAGATTTGGGG - Intronic
923934068 1:238741443-238741465 AAAATCTCATTTTAAATATAAGG + Intergenic
924000734 1:239549028-239549050 CAAGTCACATTTTACATGGATGG + Intronic
924219884 1:241863221-241863243 CCATTCTCATTTTACAGATGAGG + Intronic
924588906 1:245384585-245384607 CCATTCTCATTTTAAAGATAAGG + Intronic
924885852 1:248215790-248215812 GAGTTCATATTTTACATCTATGG + Intergenic
1063078223 10:2738220-2738242 CAATTCTCAATTTCCAACCATGG + Intergenic
1063647845 10:7903638-7903660 TAATTCTAATTTTTCATATATGG - Intronic
1063778668 10:9294829-9294851 TCATTCTCATTTTACAGGTAAGG + Intergenic
1063881877 10:10539981-10540003 CAATTCTCCCTTTACCTCGATGG - Intergenic
1064644483 10:17447085-17447107 CAATTCTTATTTTTCATACATGG - Intronic
1065671797 10:28127526-28127548 CAAATCACATTTTACATGGATGG + Intronic
1066587718 10:36955866-36955888 CAATTCTTATTTTACAGGTAAGG + Intergenic
1067264237 10:44723395-44723417 CACATTTCATTTTACATCTTAGG + Intergenic
1067961663 10:50859753-50859775 CCATTCCCATTTTGCATCTTAGG + Intronic
1067965282 10:50905653-50905675 CTATTCTTATTTTACAGATAGGG - Intergenic
1068098778 10:52525610-52525632 TTATTCTCATTTTTCATCTGAGG - Intergenic
1068103373 10:52583150-52583172 CAATTCGCATTTTTCTTCTGTGG - Intergenic
1068844288 10:61654374-61654396 CAATTCTCATCTTTTGTCTAAGG + Intergenic
1068937920 10:62654384-62654406 GAATTCTCATTCTAAATTTATGG + Intronic
1069330695 10:67289262-67289284 CTCTTCTCTTTTTACATCTAAGG - Intronic
1070530259 10:77330856-77330878 CTATTTTCATTTTACATGTGAGG - Intronic
1071100717 10:82034529-82034551 TTATTCTCATTTTAGATATAAGG - Intronic
1071264425 10:83952016-83952038 CTATTCCCATTTTACAGCTGAGG + Intergenic
1071977038 10:90965367-90965389 CAATTGTCATTTTACAGATCAGG - Intergenic
1072478546 10:95786971-95786993 TAATCCTCATTTTACAGCTGAGG + Intronic
1072814730 10:98494665-98494687 TATTTCTCTTTTTACATCAATGG + Intronic
1073408131 10:103316477-103316499 CAATTCTGATTTTACAGATAGGG + Intronic
1074343773 10:112660447-112660469 AGAGTCTCATTTTACATTTAAGG + Intronic
1074414567 10:113255999-113256021 CAATTCTCATTGAACATTTTTGG - Intergenic
1074512484 10:114128593-114128615 TAATTCCCATTTTACAGATAAGG - Intronic
1074945349 10:118275946-118275968 CTATTCCCATTTTACAGGTAAGG - Intergenic
1075866537 10:125726495-125726517 CATGTCACAATTTACATCTATGG - Intronic
1075878789 10:125831322-125831344 CACTTTTCATCTTACAGCTAAGG - Intronic
1077347339 11:2069194-2069216 CCATTCTCATTATCCATCTACGG + Intergenic
1077842352 11:5989264-5989286 CATTTCTCATTTTTTAGCTAAGG + Intergenic
1078256173 11:9661015-9661037 GCATTCTCATTTTACATATGAGG + Intergenic
1078596723 11:12693488-12693510 TAAATCTATTTTTACATCTAGGG + Intronic
1079713375 11:23714570-23714592 AGATTTTCATTTTACAACTAAGG - Intergenic
1079713927 11:23720356-23720378 TAATTCTCATTTTACATATAGGG - Intergenic
1079720905 11:23812818-23812840 CATTTCCCATTTAGCATCTAGGG + Intergenic
1079866690 11:25744706-25744728 CTATCCTCATTTTACATATGAGG + Intergenic
1079868681 11:25767680-25767702 CAATTCTCATTGTTCATGTGAGG - Intergenic
1080496574 11:32826736-32826758 TAATTCTCATTTTACAAAGAGGG - Intergenic
1080539050 11:33249365-33249387 CTATTCTCATTTTACAAGTGAGG - Intergenic
1081394427 11:42568834-42568856 CAATCCTCATTTTACAGATAAGG + Intergenic
1081727270 11:45339313-45339335 AAATCCTCATTTTACAGGTAGGG + Intergenic
1082071903 11:47946095-47946117 CAGTTCTCAATATACATATAGGG - Intergenic
1082650430 11:55784601-55784623 CTATTCTCATTTTACTGCTAAGG + Intergenic
1086447890 11:86887338-86887360 CATTTCCCATTTCACATCTTGGG - Intronic
1086546257 11:87971034-87971056 AAAGGCTCATTTTACATCTAGGG + Intergenic
1086558843 11:88144024-88144046 CAATTTTCATTCTTCATGTAGGG + Intronic
1086754282 11:90539620-90539642 CAACTTTCATTTTAGATCCAAGG + Intergenic
1086978804 11:93170496-93170518 CTATTCCCATTTTACAAATAAGG + Intronic
1087872939 11:103321032-103321054 AAATTCCCATTGTACATCTTTGG - Exonic
1088022507 11:105136722-105136744 CAAGTCACATTTTACATGGAGGG + Intergenic
1088192199 11:107238617-107238639 CAAGTCACATTTTACATGGATGG - Intergenic
1088313099 11:108480787-108480809 CAACTCCCACTTTACATATATGG + Intronic
1088443992 11:109902970-109902992 CAAATCCCATTTTACATGGATGG + Intergenic
1088650259 11:111951779-111951801 CAAGTCACATTTTACATGGATGG - Intronic
1089045419 11:115498096-115498118 AAATTCACATTTTAAATCAATGG + Intronic
1089457863 11:118635654-118635676 TAATTCTCATTTTACAGACAAGG - Intronic
1089637438 11:119824410-119824432 CCATTCTCATTTTACAGATGAGG + Intergenic
1089763662 11:120747502-120747524 CACTCCTGACTTTACATCTAGGG - Intronic
1090168045 11:124571999-124572021 CTATTCTCATTTCACAGATATGG + Intergenic
1090512397 11:127389517-127389539 CCACTCTCATTTTACAGCTTGGG + Intergenic
1091631535 12:2164416-2164438 CAACTCTCATTTTACAGATATGG - Intronic
1091672794 12:2465037-2465059 CAATTCCCATTTTACATAGGAGG - Intronic
1092456495 12:8648404-8648426 TAATTCTCATTTTACAGAAAGGG - Intronic
1092482666 12:8874376-8874398 TAATTTTCATTTTACTTCTAAGG + Intronic
1092585434 12:9896474-9896496 CAATTCTTAATTTACATGCACGG - Intergenic
1093352976 12:18127226-18127248 CAAGTCACATTTTACATGGATGG - Intronic
1093354062 12:18141285-18141307 CTGTTCTCATTTTACTTCTTTGG - Intronic
1094647418 12:32339189-32339211 CAACTCTCATTTGCCATCTTTGG - Intronic
1095335725 12:41023282-41023304 CAATTCTCATTTGAAATGTCAGG - Intronic
1095800224 12:46264544-46264566 AAAATCTTATTTTAAATCTAGGG + Intronic
1097389181 12:58988497-58988519 CAAGTCACATTTTACATGGATGG - Intergenic
1098093032 12:66924345-66924367 CAAATTTCATTTAAAATCTAGGG + Intergenic
1098103529 12:67044286-67044308 CAATTCGCATATTAAATTTAGGG - Intergenic
1098428044 12:70388714-70388736 TAATTCTCATTTTACAGGTGAGG - Intronic
1098760226 12:74414798-74414820 AAATTCCCATTCTACATGTAGGG + Intergenic
1099022117 12:77419272-77419294 ATACTCTCATTTTACATATAAGG + Intergenic
1099317109 12:81097880-81097902 TAATCCTCATTTTACATATGAGG - Intronic
1099674412 12:85739925-85739947 TACTTCTCATTTTTCATCAAGGG - Intergenic
1099844872 12:88017336-88017358 CAAGTCACATCTTACATGTATGG - Intronic
1100184334 12:92122841-92122863 CAATTCTCTTTATACATATATGG - Intronic
1100228959 12:92587899-92587921 TAATTCTCATTTTCCATTTTGGG - Intergenic
1100972853 12:100089998-100090020 CAAGTCCCATTTTACATGGATGG - Intronic
1101038464 12:100729499-100729521 TTATTCTCATTTTACATATGAGG + Intronic
1101084358 12:101220571-101220593 GAATTCTAATTTTAAATCTTTGG + Intergenic
1101186911 12:102289883-102289905 CAAGTCACATTTTACATGGATGG - Intergenic
1101330450 12:103753604-103753626 CTATTCCCATTTTACAGATAGGG + Intronic
1101420609 12:104547758-104547780 CTATTCTCATTTTATAGCTATGG - Intronic
1101576816 12:106005014-106005036 CAAGTCACATTTTACATGGATGG - Intergenic
1101727527 12:107400564-107400586 CAATTCCCATTGTACAGGTAAGG - Intronic
1101936936 12:109065875-109065897 TTATTTTCTTTTTACATCTATGG + Intronic
1102020769 12:109680748-109680770 AAATTCCTATTTTACATATAAGG + Intergenic
1102872290 12:116423472-116423494 CACTCCTCATTTTACAGATATGG - Intergenic
1103242825 12:119429178-119429200 TTATTCTCATTTTACAGATAGGG - Intronic
1103266269 12:119633208-119633230 CAATTCTCATTTTATAGTTAGGG - Intronic
1103845622 12:123900275-123900297 CCAGTCTAGTTTTACATCTAGGG - Intronic
1104278228 12:127350591-127350613 CAAGTCACATTTTACATGGATGG + Intergenic
1106291025 13:28362260-28362282 TTATTCTCATTTTACAGGTAAGG - Intronic
1106404945 13:29465293-29465315 CAATCCTCATTTTATAGATAAGG + Intronic
1107142126 13:37011170-37011192 CAACACTCATTTTACATATGGGG + Intronic
1107366474 13:39683940-39683962 TTATCCTCATTTTACAGCTAAGG - Intronic
1107592995 13:41928162-41928184 CAATTCTCAATTTTCAACAAAGG + Intronic
1108061711 13:46539779-46539801 TCATCCTCATTTTACATATAAGG + Intergenic
1108209215 13:48121439-48121461 CTAATCTCATTTTACAGATAAGG + Intergenic
1108261858 13:48666224-48666246 CAATTCTCTCTTGACCTCTAAGG + Intronic
1108609534 13:52070574-52070596 CAAGTCACATTTTACATGGATGG - Intronic
1108739515 13:53320937-53320959 TTATCCTCATTTTACAACTAAGG + Intergenic
1108763675 13:53600936-53600958 TTATTCTCATTTGACAGCTATGG + Intergenic
1108862106 13:54873655-54873677 AAATTTCCATTTTACATCTCTGG - Intergenic
1109357021 13:61244561-61244583 CAATTTTTATTTTAGATATAGGG + Intergenic
1109614036 13:64807849-64807871 CAAGTCACATCTTACATCGATGG - Intergenic
1109614303 13:64809854-64809876 CAAGTCACATCTTACATCAATGG - Intergenic
1110394449 13:75013080-75013102 CACTTCTCATTTTAAATATTAGG - Intergenic
1110453421 13:75662958-75662980 AAATTGTCATTTTACATATGAGG + Intronic
1111150588 13:84249237-84249259 TTATTCTTATTTTACCTCTAAGG + Intergenic
1111327284 13:86715669-86715691 CCATTCTCTTTTGACATGTAAGG - Intergenic
1111457102 13:88498967-88498989 AAATTCTAATTTTACATGTTGGG + Intergenic
1111568035 13:90042296-90042318 CAAATCACATCTTACATGTATGG - Intergenic
1112123421 13:96438375-96438397 AAATTCTTATTTTACAGATAAGG + Intronic
1112265910 13:97923218-97923240 TAATCCTTATTTTACATATAAGG + Intergenic
1112486288 13:99822934-99822956 CAATCCTCATCTTACATAGAAGG - Intronic
1112928719 13:104709561-104709583 AAATTCTCATTTTACAGAGAAGG - Intergenic
1113259334 13:108544304-108544326 CACTTCTCATCTCATATCTAAGG - Intergenic
1114228929 14:20762923-20762945 TACTTGTAATTTTACATCTATGG - Intergenic
1115730445 14:36263027-36263049 TAATTCCCATTTTACAGATAGGG - Intergenic
1115736039 14:36331026-36331048 TTATTCTCATTTTACAGATAAGG - Intergenic
1115882892 14:37939926-37939948 CCATTCTCATTTTACATTGTAGG - Intronic
1116304572 14:43234189-43234211 CAATTTTTATTTTAGATTTAGGG + Intergenic
1116451679 14:45073868-45073890 CAATTCTAATTTTACATATAGGG - Exonic
1116552150 14:46254600-46254622 CAAGTCACATTTTACATGGATGG + Intergenic
1116597647 14:46871717-46871739 TTATTCTCATTTTACAGATAAGG + Intronic
1116699203 14:48217028-48217050 CAAGTCTCATTTTAAAATTAGGG + Intergenic
1116972678 14:51082992-51083014 CTATTCTCATTTTACAGATGAGG - Intronic
1117653010 14:57926056-57926078 CCACTCTCATTTTACACATACGG - Intronic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117886956 14:60374272-60374294 AGATACTCATTTTAGATCTATGG + Intergenic
1118139183 14:63061162-63061184 CAAGTCACATTTTACATGGATGG - Intronic
1118519133 14:66561519-66561541 CAGATTTCATTTTACATATAAGG + Intronic
1118675633 14:68181637-68181659 TCATTCTCCTTTTACATCTGAGG - Intronic
1118846320 14:69550242-69550264 CAATTCTCATTTTAAAGATGAGG + Intergenic
1118870354 14:69736239-69736261 CAAGTCTCATCTTACATGGATGG + Intronic
1119624797 14:76163736-76163758 CCATCCACATTTTACATGTAGGG + Intronic
1120324598 14:83008674-83008696 CAAGTCACATTTTACATGGATGG - Intergenic
1120409698 14:84137542-84137564 CACTTCTAATTTTACACATATGG + Intergenic
1120992760 14:90392663-90392685 CACTTCTCATTTTGCCTCTGAGG - Intergenic
1121723749 14:96130926-96130948 CAGTTCTCATTTTACAGATGAGG + Intergenic
1122620058 14:103051197-103051219 CACTTCTGATTTTAGATTTAAGG + Intronic
1123132136 14:105996277-105996299 CAATTCTTATTGTATATCTTAGG + Intergenic
1125110129 15:36022897-36022919 CAACTCTCATTTTAGGTGTAAGG - Intergenic
1125184823 15:36918351-36918373 TTATTCTCATTTTACATTTGAGG - Intronic
1125255411 15:37757929-37757951 AAATGCTCATTTCACATCAATGG - Intergenic
1125865825 15:43047785-43047807 ATATTCTCCTTTTACATGTAAGG - Intronic
1126095877 15:45089737-45089759 CAATCCCCATTTTACAGATAAGG - Intergenic
1126328048 15:47503488-47503510 CCAGTCCCATTTTACAGCTATGG - Intronic
1126582090 15:50251409-50251431 CTATTCTCATTTTACAGATAAGG + Intronic
1126656451 15:50982913-50982935 CTATTCTCATTTTACAAATGAGG - Intronic
1126853959 15:52819219-52819241 CATTTCGCATTTTACATTTGAGG + Intergenic
1128491067 15:68145030-68145052 CTATTCTCAATATACACCTAAGG - Intronic
1128556976 15:68638409-68638431 TTATTCTCATTTTACAGTTAAGG + Intronic
1128870458 15:71151526-71151548 CAATTCCCATTTTACAGATGAGG + Intronic
1129134676 15:73536879-73536901 CAATTTTCATTTTAGATTCAGGG + Intronic
1129622933 15:77165800-77165822 TAATTCTCATTTTACAGATGAGG + Intronic
1130518314 15:84643300-84643322 CTATCCTCATTTTACAGATAAGG + Exonic
1130609246 15:85345676-85345698 AAACTCTCATTTAACATCTGTGG + Intergenic
1131234851 15:90687066-90687088 CCATTGTCATATTCCATCTAAGG + Intergenic
1131768057 15:95701695-95701717 CAAGTCACATCTTACATGTATGG + Intergenic
1131914702 15:97252063-97252085 CAATTCACATCTTACATGGATGG - Intergenic
1131933948 15:97480285-97480307 CAATTCTTATTTTAGGTTTAGGG - Intergenic
1132266006 15:100471320-100471342 GAATTCTCATGTTACAGCTGGGG + Intronic
1133463919 16:6011517-6011539 CTATTCCCATTTTACAGATAAGG - Intergenic
1133493843 16:6297514-6297536 CTATTCTCATTTTACAGATCAGG - Intronic
1133542438 16:6769251-6769273 CAAGTCTCATCTTACATCGATGG - Intronic
1134201041 16:12199078-12199100 CAACCCTCATTTTACAGATAAGG - Intronic
1134381174 16:13727714-13727736 TAATTCTCATTTTGCATATGAGG + Intergenic
1134816922 16:17213460-17213482 CTATTCCCATTTTACAGATAAGG + Intronic
1135726624 16:24859034-24859056 CAATACCCATTTTACAGATAAGG + Intronic
1135856995 16:26020925-26020947 CCATCCCCATTTTACATATATGG - Intronic
1138139328 16:54554110-54554132 TAAATCTCATTATACATCTTAGG + Intergenic
1138576378 16:57909897-57909919 CCATTCCCATTTTACAGCTGAGG - Intronic
1139301271 16:65947394-65947416 CTATATTCATTTTACATATAGGG - Intergenic
1140649079 16:77066896-77066918 CTATTCCCATTTTACAAATAAGG + Intergenic
1140732248 16:77867108-77867130 CATTCCTCATTTTACAGATAAGG + Intronic
1141186943 16:81794606-81794628 CTATTCTCATTTTATAGATAAGG - Intronic
1143392375 17:6567297-6567319 CCATTCCCATTTTACAGATAAGG + Intergenic
1143942990 17:10562271-10562293 CAATTCTGACCTTACATATAGGG - Intergenic
1146002985 17:29142413-29142435 TAATCCTCATTTTACAGATAAGG - Intronic
1146187987 17:30737968-30737990 AAAGTCTCATTTTATATCTTTGG + Intergenic
1146332853 17:31942299-31942321 AAAGTCTCATTTTATATCTTTGG + Intronic
1146849531 17:36210393-36210415 CTAATCTCATTTTACAGATAAGG - Intronic
1148256375 17:46136214-46136236 GAATTCTCATTTTAAAATTAAGG - Intronic
1149419920 17:56500108-56500130 TTATTCTCATTTTACATACATGG - Intronic
1151500851 17:74487786-74487808 CAAGTCACATCTTACATCAATGG + Intergenic
1151774829 17:76193179-76193201 TAAATCTCATTTTACAGATAAGG - Intronic
1153096327 18:1409302-1409324 AAATTCTCATTTTTCAATTATGG - Intergenic
1153223040 18:2878662-2878684 CAATGCTCATTTTCCTTCTTTGG + Intronic
1153436462 18:5073095-5073117 GAATTCTCATTTTACGTGTGAGG + Intergenic
1155566333 18:27138746-27138768 CTATCCTCATTTTACAGATAAGG + Intronic
1155599227 18:27525021-27525043 CAAGTCACATTTTACATGGATGG + Intergenic
1155773169 18:29725659-29725681 CAAGTCCCATTTTACATGGATGG + Intergenic
1155843275 18:30672610-30672632 CAAGTCACATTTTACATGGATGG + Intergenic
1156133871 18:34012009-34012031 CATTTCACATTTTATATCTCAGG - Intronic
1156583655 18:38408599-38408621 CAAGTCACATTTTACATGGATGG - Intergenic
1158904631 18:62000345-62000367 CAAGTCACATTTTACATGGATGG - Intergenic
1158960265 18:62582351-62582373 CAATTCTCATTTTACATCTAGGG - Intronic
1159139189 18:64371903-64371925 AAATTGTCATTTTCCATCTATGG + Intergenic
1159650523 18:70972159-70972181 CAAGTCTCATCTTACATGGATGG + Intergenic
1159677522 18:71304311-71304333 AAATTCTCATTTTCCAGATAAGG - Intergenic
1159678797 18:71320947-71320969 CAATTCTCATAATAAATCCAGGG - Intergenic
1159975304 18:74704034-74704056 ATATTCTCATCTTACATGTAAGG + Intronic
1161608918 19:5230010-5230032 TCATTCTCATTTTACATTTGGGG + Intronic
1162481714 19:10930804-10930826 CAATTCTCATTCAACACCTTTGG - Intronic
1163303015 19:16459602-16459624 CTATTCTCATTTTACAGATGGGG - Intronic
1164447195 19:28328037-28328059 CAATTTTCATTTTAGATTCAGGG + Intergenic
1164582688 19:29444412-29444434 CAATTTTCATTTTAGATGCAAGG + Intergenic
1166702341 19:44889354-44889376 CAATTCTTATTTTGTATCTTTGG - Intergenic
1167106338 19:47431983-47432005 CAATTCACATCTTGCACCTAGGG + Intronic
925295678 2:2775009-2775031 CCATCCTCATTTTACAGCTGAGG + Intergenic
926538826 2:14149521-14149543 CAATTCCCATTTTACAGAGAAGG + Intergenic
926938724 2:18113414-18113436 CAATTCTCATTAAACATCCAGGG + Intronic
927798180 2:26070569-26070591 CTATTATCATTTTACAGGTAAGG + Intronic
928939312 2:36711535-36711557 CAATTCCCATTTTAAAGATAAGG - Intronic
929729279 2:44470212-44470234 CAATTCTGTTTTTAAAACTATGG + Intronic
929859997 2:45668724-45668746 CTATTCCCATTTTACAGCTGAGG - Intronic
930457360 2:51622401-51622423 CAATTCACATCTTACATGGATGG + Intergenic
931075920 2:58711295-58711317 TTATTCTCATTTTGCATCTGAGG - Intergenic
931167653 2:59765481-59765503 CAATTCTACTTTTAAATTTAAGG - Intergenic
931711913 2:64995289-64995311 CTAGTCTCATTTTACAGATAAGG - Intronic
931740864 2:65242562-65242584 GAATTCTCTTTTTCTATCTATGG - Intronic
932935801 2:76099526-76099548 CAAGTCACATTTTACATGGATGG + Intergenic
933199198 2:79429333-79429355 CTATTCTCATTTTACAGATGAGG - Intronic
933251106 2:80029408-80029430 CAATTATAAATTTACATCTCTGG + Intronic
934114588 2:88774881-88774903 CAACTCTCATTTTATCTTTATGG - Intergenic
934632045 2:95936973-95936995 CAACTCTCATTTTATCTTTACGG + Intronic
934801458 2:97166248-97166270 CAACTCTCATTTTATCTTTACGG - Intronic
935138660 2:100331823-100331845 AACCTCTCATTTTGCATCTAAGG + Intergenic
935621053 2:105129922-105129944 CTAATCTCAATTCACATCTATGG - Intergenic
936147416 2:109989694-109989716 CAATTCTCTTCTTAGATATAGGG + Intergenic
936197276 2:110381747-110381769 CAATTCTCTTCTTAGATATAGGG - Intergenic
936423347 2:112390483-112390505 TTATCCTCATTTTACATATAAGG + Intronic
936972448 2:118188175-118188197 CTATTCCCATTTTACAGATAAGG - Intergenic
937313198 2:120914802-120914824 CTATCCTCATTTTACAGATAAGG + Intronic
937709776 2:124966590-124966612 CACTTCTCATTTGTGATCTAAGG - Intergenic
938228655 2:129639050-129639072 TACTTCCCATTTTACATATAAGG - Intergenic
938228904 2:129640876-129640898 TACTTCCCATTTTACATGTAAGG + Intergenic
939157919 2:138546591-138546613 CAATTCTTATTTTACAAATGAGG - Intronic
939358292 2:141133485-141133507 CTATTCTCATTTTACAGAAATGG - Intronic
939423522 2:142004340-142004362 CAATGGTCATTTTACACCTCAGG - Intronic
939465659 2:142552327-142552349 CACTTCTCCTTTTACTTCCAAGG + Intergenic
939531591 2:143369920-143369942 CAATTCAGGATTTACATCTACGG - Intronic
939577971 2:143918651-143918673 CAATTCACATCTTACATGGATGG - Intergenic
939694803 2:145311335-145311357 CAAATCACATCTTACATGTATGG + Intergenic
939997061 2:148929864-148929886 CAATTCAAATTTTCCATCTTAGG + Intronic
940044661 2:149396752-149396774 GAATTCCCATTTTACAGTTAAGG - Intronic
940110064 2:150142820-150142842 CTATTTCCATTTTACATATAAGG + Intergenic
940450497 2:153829394-153829416 CAAGTCTCATCTTACATAGATGG + Intergenic
940686450 2:156857029-156857051 CAAGTCACATTTTACATGAATGG + Intergenic
942011394 2:171766039-171766061 AAATTCTCATTGTTCATCTCTGG + Intergenic
942368892 2:175259336-175259358 CCATTCCCATTTTACAGGTAAGG + Intergenic
943513795 2:188859312-188859334 TAATTTTCATCTTAGATCTATGG - Intergenic
943566370 2:189521704-189521726 TCATTCTCATTTCACATCTGGGG + Intergenic
943938401 2:193957360-193957382 CAGCTTTTATTTTACATCTAAGG + Intergenic
944641573 2:201731766-201731788 CACTTCTCATGTTATATCAATGG - Intronic
945006949 2:205418744-205418766 AAATTTTCATTTAAAATCTAAGG + Intronic
945226269 2:207533948-207533970 GTATTCTAATTTTACATATAAGG - Intronic
945436572 2:209825292-209825314 CAATTCTCATGATTCATCTCAGG + Intronic
945510132 2:210691108-210691130 CAAGTATCATCTTTCATCTAAGG - Intergenic
945595975 2:211793372-211793394 TAATTATCATTTTAATTCTAAGG - Intronic
945606468 2:211939324-211939346 TTATTATAATTTTACATCTAAGG - Intronic
946587949 2:221211393-221211415 AGATTCTCATTAAACATCTATGG + Intergenic
1170177706 20:13490809-13490831 CATTCCCCATTTTACAGCTATGG - Intronic
1170443742 20:16404003-16404025 CTATTCCCATTTTACATGTGGGG - Intronic
1170731451 20:18979281-18979303 CACATCTCATTTGCCATCTAAGG + Intergenic
1170859211 20:20087142-20087164 CAATTTTTATTTTAGATTTAGGG + Intronic
1171190169 20:23153204-23153226 CAATTGACATTTTTCATCTATGG - Intergenic
1172493620 20:35361751-35361773 TTATTCTCATTTTACATATGAGG - Intronic
1173039217 20:39445195-39445217 CAACTTTCATTTTAGATCCAAGG + Intergenic
1173882542 20:46427313-46427335 CATATCTCATTTTAAATCAAAGG + Intronic
1174185649 20:48704109-48704131 CAATTCTCATTTTACAGATGAGG + Intronic
1174196417 20:48775758-48775780 CAAGTCACATTTTACATGGATGG - Intronic
1174676792 20:52365668-52365690 CAATCCTCATTTCACAGCTATGG + Intergenic
1176889221 21:14294078-14294100 CCATTCTGTTTTTACATTTAAGG - Intergenic
1177554408 21:22671296-22671318 CAAGTCACATCTTACATGTATGG - Intergenic
1179295553 21:40059110-40059132 CAATAGTCATTGTACATTTAAGG - Intronic
1179403355 21:41104773-41104795 CAAGTCGCATTTTACATGGATGG - Intergenic
1181733631 22:24865524-24865546 CTTTTCTCATTTCACAGCTAGGG + Intronic
1181782465 22:25202920-25202942 CAACTCTCATTTTACAGATGCGG - Intronic
1183223600 22:36533493-36533515 CAAGTCACATTTTACATGGATGG + Intergenic
1183382656 22:37498182-37498204 TAATTCTTATTTTACATCCTGGG + Intronic
1183546731 22:38458109-38458131 TAGTTCTCATTTTACATATGAGG - Intergenic
1184286080 22:43472416-43472438 CTTTTCTCATTTTACAGGTAAGG + Intronic
1184956596 22:47891081-47891103 CAATTTTCATTTTTCATATGAGG - Intergenic
949502817 3:4698115-4698137 CAAAACTCATTTTAAATCTGTGG - Intronic
949773100 3:7600335-7600357 AAATTCTCATTTTAGATCCCAGG + Intronic
950863066 3:16167558-16167580 CAATTCTACTTTTTCTTCTAAGG - Intergenic
950983818 3:17338559-17338581 AAATTCTCATTTCACTACTAAGG + Intronic
951349512 3:21588791-21588813 CAAGCCTTATTTTACAGCTATGG + Intronic
951521342 3:23613467-23613489 CAATAATTATTTTACATTTAGGG - Intergenic
951603848 3:24409542-24409564 TAATTCTCCTTGTACAGCTAAGG - Intronic
951644643 3:24875481-24875503 CAATTCTCATAATAAACCTATGG - Intergenic
952107465 3:30086921-30086943 GAATTCACATTTTACATGTAGGG - Intergenic
952174256 3:30844248-30844270 CAGGTATCATTTTACCTCTAAGG + Exonic
952246709 3:31601861-31601883 CTATTCTCATTTTACAGGTGAGG + Intronic
952619831 3:35324354-35324376 AAATTCTTATTTTAGATTTAAGG - Intergenic
953591018 3:44254106-44254128 GTATTCTCATTTTACAGATATGG + Intronic
953623144 3:44549732-44549754 CAATTCTCATCATACAAATAGGG + Intergenic
955624575 3:60904060-60904082 CATTTCTCATTTTCCAGCTTTGG + Intronic
956103180 3:65789520-65789542 CAATTCCCATTTTACACTTGAGG + Intronic
956206611 3:66761554-66761576 CCCTTCTCATTTTACATATGAGG - Intergenic
956482274 3:69685146-69685168 CCATTCCCATTTTACAGATATGG - Intergenic
957243080 3:77684240-77684262 AAATTCTTATTTTACATTGATGG - Intergenic
958652711 3:96958387-96958409 TTATTCACATTTTACATATAAGG - Intronic
959556923 3:107730443-107730465 CAATTCTCAGTCTAGATCCAGGG + Intronic
959760726 3:109960676-109960698 AAATTCCTATTTTACATCTGAGG - Intergenic
959810975 3:110618881-110618903 CCACTCTTATTTTACATATAGGG + Intergenic
960289540 3:115866898-115866920 TAATTCTCAATTAACACCTAAGG + Intronic
960486649 3:118260238-118260260 CAAGTCTCATCTTACATTGATGG - Intergenic
960560790 3:119081669-119081691 CAACTCTCATTTTATAAGTAAGG - Intronic
960848392 3:122026194-122026216 CAATTCTCATTATGCCTCTCCGG - Intergenic
961463815 3:127069576-127069598 TAATTCTCATTTTTGACCTATGG - Intergenic
961558294 3:127711610-127711632 GAATTCTCAGTGTACATCAAGGG + Intronic
962183685 3:133235560-133235582 CACATCCCATTTTACATCTAGGG - Intronic
962195991 3:133364108-133364130 TAATTCTCATTTTACTTGTGAGG + Intronic
962713456 3:138107113-138107135 TTATTCTCATTTTACAAATAAGG + Intronic
963205327 3:142628453-142628475 TTATTCTCATTTTACATATTAGG + Intronic
963377551 3:144488283-144488305 CAAGTCTCATTTTTCATTGATGG + Intergenic
963579309 3:147104328-147104350 CAAGTCACATTTTACATGGATGG - Intergenic
963776025 3:149441540-149441562 TATTTCTCATTTTACAGATAAGG - Intergenic
963819603 3:149874412-149874434 TAATTCTTATTTTACAGATAAGG - Intronic
963837949 3:150075826-150075848 CTATTCTCATTTTACAGTTGAGG + Intergenic
964072399 3:152650721-152650743 TAAATGTCATTTTACATGTAAGG + Intergenic
964225561 3:154396187-154396209 CAATTCTCATTTTACAAGACAGG + Intronic
965344197 3:167527231-167527253 CAATTCCCATTTTACAGATAAGG - Intronic
965812399 3:172605002-172605024 GTATTTTCATTTTACATGTATGG + Intergenic
965864936 3:173194877-173194899 CAATTCGCATCTTACATGAATGG - Intergenic
966285889 3:178294797-178294819 AACTTCTTATTTTACAGCTAAGG + Intergenic
966450087 3:180049178-180049200 TAATTCTGATTTTCCATCTGTGG - Intergenic
966991594 3:185236938-185236960 CAATTCCCATTTTACAGGTAAGG + Intronic
967045031 3:185728451-185728473 CCATTGTCATTTTACCTTTATGG - Intronic
967672526 3:192255117-192255139 TAATTCACATTTTACAGATAAGG - Intronic
967833279 3:193940567-193940589 CAATTCTTATTTTACTACTGGGG - Intergenic
968590141 4:1454340-1454362 CTATTCCCATTTTACAAATAAGG + Intergenic
969853243 4:9978690-9978712 CAACTCACATTTTACATTTGTGG - Intronic
970078005 4:12246983-12247005 CTATTCTTATTTTACAGCTGAGG + Intergenic
970344157 4:15136955-15136977 CAAGTCTCATCTTACATGGATGG + Intergenic
971037710 4:22713009-22713031 TCATTCTCATTTTACATATGAGG + Intergenic
971385165 4:26135467-26135489 CAATCCTCGTTTTACAGCTGAGG + Intergenic
971387991 4:26159229-26159251 GTGTTCTCATTTTACATCTGAGG + Intergenic
971548088 4:27912955-27912977 TACTTCTCATTTTACACATAAGG + Intergenic
971614657 4:28772588-28772610 CAATTCTTATTTTACCTCTTTGG + Intergenic
971920401 4:32932237-32932259 CAATTCTCATTTTCCTTCCTTGG - Intergenic
972241945 4:37203164-37203186 CAAGTCTCATCTTACATGGATGG + Intergenic
973079951 4:45978716-45978738 CAATTGTACTTTTTCATCTAAGG - Intergenic
974215692 4:58842936-58842958 CAAGTCTCATCTTACATGGATGG - Intergenic
974549461 4:63351749-63351771 CGATTCTCATTTTAAAAATAAGG + Intergenic
974642290 4:64646671-64646693 CAAGTCACATCTTACATGTATGG + Intergenic
975215189 4:71745155-71745177 AAATTTTCATTTTACATGAAAGG + Intronic
975533485 4:75424850-75424872 CAAGTCACATTTTACATGGATGG + Intergenic
975781542 4:77845862-77845884 CTATTCTCATTTTACAGATGAGG - Intergenic
976051256 4:81013378-81013400 CAAGTCTCATTTTACATGGATGG - Intergenic
976221116 4:82757487-82757509 CTATTCGCATTTTACAGCTGAGG + Intronic
976346386 4:84007207-84007229 CAATTCTCAATGTGCATTTATGG + Intergenic
976354140 4:84096229-84096251 CAATTCAGGTTATACATCTATGG - Intergenic
976358321 4:84147103-84147125 CCAATCTCATTTTACAGCTGTGG + Intergenic
976672789 4:87673041-87673063 CAAGTCACATTTTACATGAATGG + Intergenic
976780281 4:88750752-88750774 CGTTTCTCATTTTACAGCTAAGG + Intronic
976965176 4:91030234-91030256 CAATTTACATTTTTCATCTTTGG - Intronic
977020223 4:91749133-91749155 CAATTCTAATATTACTTCTGTGG - Intergenic
977578934 4:98703842-98703864 CAAGTCTCATTTTACATGGATGG - Intergenic
977797375 4:101182898-101182920 CAAGTCACATTTTACATGGATGG - Intronic
977860271 4:101949464-101949486 GTATTCTCATTTTACATTTGAGG - Intronic
977861571 4:101967259-101967281 CAATTCTCATTTTATAGATGAGG + Intronic
978211008 4:106134874-106134896 TCATTCTCATTTTACAGCTTAGG - Intronic
978499330 4:109392405-109392427 CAAGTCACATCTTACATATATGG + Intergenic
978589553 4:110309993-110310015 ATATTCTCATTTTTCATTTAAGG - Intergenic
978861215 4:113451484-113451506 TTATTCTCATTTTACAAATATGG + Intronic
978915813 4:114125056-114125078 CAAGTCACATCTTACATGTATGG + Intergenic
979342528 4:119543540-119543562 CTATTCTCATTTTACAGATGAGG + Intronic
979353217 4:119670423-119670445 CCATTCTCATTTTACAGACAAGG - Intergenic
979868962 4:125792387-125792409 CCAATCTTATTCTACATCTAAGG - Intergenic
980449483 4:132951131-132951153 CATTTCTCATTTTACTTATTTGG - Intergenic
980727703 4:136786776-136786798 CAATTCTCATTTATCATGGAAGG + Intergenic
980762351 4:137252507-137252529 TTAAGCTCATTTTACATCTAAGG - Intergenic
980984649 4:139683832-139683854 CAAGTCACATTTTACATGGATGG + Intronic
981315149 4:143334610-143334632 CAATTCCCATTTCACATATCGGG + Intergenic
981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG + Intronic
981471260 4:145138105-145138127 CAATTCTCCTTTTTCATCAGAGG + Exonic
981807015 4:148728383-148728405 CAACTTTTATTTTACATTTAAGG - Intergenic
982060775 4:151602162-151602184 CTATCCTCATTGTACAGCTATGG - Intronic
984515220 4:180730613-180730635 CAATTCACATCTTACATGGATGG - Intergenic
985145737 4:186892763-186892785 TAATCCTCATTTTACAGATAAGG + Intergenic
986221955 5:5776125-5776147 CAAGTCCCATTTTACATGGATGG - Intergenic
986615867 5:9617024-9617046 CAATACTCATTTTATATTTCTGG + Intergenic
986862572 5:11944505-11944527 CATTTTTCATTTTACTTCTCAGG - Intergenic
987260514 5:16197456-16197478 CAAGTCACATTTTACATGGATGG + Intergenic
987367155 5:17159000-17159022 TAATTCTCATTTCACAGCTAAGG + Intronic
987371305 5:17195763-17195785 CAAGGCACATTTTACACCTAGGG + Intronic
987488607 5:18550389-18550411 CTATTTTAATTTTCCATCTATGG + Intergenic
988067536 5:26240708-26240730 CAAGTCACATTTTACATGAAGGG + Intergenic
988452944 5:31361583-31361605 CAATTCCCATTGTACAGCTATGG + Intergenic
988650097 5:33139621-33139643 ATATTCTCATTTTACATCCATGG - Intergenic
988861639 5:35287032-35287054 TTATTCTCATTTTACATATGAGG + Intergenic
989542804 5:42637309-42637331 CAACTCTTATTTTAGATTTAGGG + Intronic
989758197 5:44981824-44981846 CAAATTTCATTTTAGATTTAGGG - Intergenic
990121397 5:52457796-52457818 AAATGATCATTTTACTTCTAAGG + Intergenic
990939072 5:61182539-61182561 CAACTTTGATTTTACACCTATGG - Intergenic
991116599 5:62962607-62962629 CAAGTCTCATCTTACATGGATGG + Intergenic
991170585 5:63620367-63620389 TAATTCTCATTTTACAAATAAGG - Intergenic
991288439 5:65007149-65007171 CTAATGGCATTTTACATCTAAGG + Intronic
991381548 5:66033422-66033444 CAGTTCTCCTTCTACTTCTATGG - Intronic
991619232 5:68528327-68528349 TAATTCTCATTTTTCATGTGAGG + Intergenic
991627440 5:68618575-68618597 CACTGCTTATTCTACATCTAGGG + Intergenic
991981869 5:72240498-72240520 TAATACTCATTTTAAATCTAAGG + Intronic
992412342 5:76518340-76518362 CAAGTCACATTTTACATGGATGG + Intronic
992602547 5:78417645-78417667 TTATTCTCATTTTACAGATATGG + Intronic
992774297 5:80076400-80076422 CTATTCTCATTTTACAGATGAGG + Intronic
992920540 5:81512341-81512363 TAATACATATTTTACATCTAGGG + Intronic
992924590 5:81568365-81568387 CAAGTCTCATCTTACATGGATGG - Intronic
993118922 5:83751293-83751315 CAATTTTCATTTTACAGATGAGG - Intergenic
993293678 5:86108099-86108121 CAAGTCTCATCTTACATGGATGG - Intergenic
994104648 5:95933373-95933395 CCATTCTCCTATTACATGTATGG - Intronic
994488892 5:100416656-100416678 CAATAAACATTTTACATCTGTGG - Intergenic
994707323 5:103222717-103222739 CTGTTCTCATTTTACAGCTGAGG - Intergenic
994900296 5:105761829-105761851 CAAGTCACGTTTTACATGTATGG + Intergenic
995037296 5:107549402-107549424 CTATCCTCATTTTACAGGTAAGG + Intronic
995307262 5:110667689-110667711 CCATTCTCATTTTACAGGTGAGG - Intronic
996172832 5:120316043-120316065 CAAGTCACATTTTACATGGATGG + Intergenic
996684122 5:126261587-126261609 CAATGCTTTTTCTACATCTATGG - Intergenic
996689382 5:126322109-126322131 CAAATCTCATTTTCAATATATGG + Intergenic
996794090 5:127325357-127325379 CAATACTCATTAAAGATCTAAGG - Intronic
997190454 5:131929536-131929558 CAATTTTTATTTTAGATATAGGG + Intronic
997890854 5:137675528-137675550 GAATTCCCATTTTAAATTTAAGG + Intronic
997896179 5:137719677-137719699 CATTTCTCTCTTTACATTTAAGG + Intronic
998354310 5:141521916-141521938 CAACTCTCATTTTATACCTGAGG + Intronic
998380352 5:141720238-141720260 TTATTCCCATTTTACATATATGG - Intergenic
998395199 5:141813773-141813795 CTATTATCATTTTACAGATAAGG + Intergenic
998810060 5:145957568-145957590 CTATTCCCATTTTACAGATAAGG + Intronic
999419005 5:151424789-151424811 CAATTCCCATTTTACAAGTGAGG + Intergenic
999630864 5:153569846-153569868 TCATTCTCATTTTACAACTGGGG + Intronic
999748082 5:154607367-154607389 CAATTCTCATTCTGCAGCTTTGG + Intergenic
1000175015 5:158743523-158743545 CAACCTTCATTTTACTTCTATGG - Intronic
1000186700 5:158865396-158865418 TAGTTCTCATTTTACAGATAAGG - Intronic
1000523498 5:162327215-162327237 CATTTTGCATTTTACATTTAGGG - Intergenic
1000542022 5:162551773-162551795 CAATTCTCCTTTTATATCTAGGG - Intergenic
1000639296 5:163682569-163682591 CAAGTCCCATTTTACATGGAAGG - Intergenic
1000793664 5:165638003-165638025 TTATTCTCATTTTACAGTTAAGG + Intergenic
1000991451 5:167915992-167916014 AAATCCTCATTTTACAGATAAGG - Intronic
1001004612 5:168039138-168039160 CAGTGCTCATTGCACATCTACGG + Intronic
1001254434 5:170172497-170172519 CAATTCCCATTTTACAGATGAGG - Intergenic
1001408024 5:171489478-171489500 CAGATGTCATTTTACCTCTACGG - Intergenic
1001439222 5:171726077-171726099 CACTTCTCATCTTACTTCTTTGG - Intergenic
1001725724 5:173897373-173897395 CTATTCTCAATTCAAATCTATGG - Intronic
1002385419 5:178862182-178862204 CAATTCTTGTTTTACATGTGAGG + Intronic
1004196114 6:13506833-13506855 CAATTCTCATTTTTCAGATAAGG - Intergenic
1004757060 6:18621804-18621826 CCATCCTCATTTTACTTCTTTGG + Intergenic
1004780855 6:18906974-18906996 CAATTCTGACTTGACATTTAAGG - Intergenic
1005304038 6:24496500-24496522 CATTTCTCATTTTACCGCTCTGG + Intronic
1005434616 6:25795150-25795172 AAATTCTCATTTTAGATATTAGG - Intronic
1006976477 6:38107010-38107032 AAATTCTTATTTTAAACCTAAGG - Intronic
1007531463 6:42546735-42546757 GAATTCTCTTTTTACAGTTAGGG + Intergenic
1008267058 6:49440500-49440522 CAATTTTTATTTTACATTCAGGG + Intronic
1008306384 6:49906582-49906604 CATTTCTCCTTTTAGATTTAGGG - Intergenic
1008460879 6:51769500-51769522 CATTTCTCATTTTATATATTGGG + Intronic
1008565001 6:52758908-52758930 TTATTCTCATTTTACATTTGAGG + Intronic
1008569322 6:52800225-52800247 TTATTCTCATTTTACATTTGAGG + Intronic
1008573994 6:52841752-52841774 CTATTCTCATTTTACAGTTGAGG + Intronic
1008928578 6:56913299-56913321 CAATGCCCATTTTACAGATAAGG + Intronic
1009348345 6:62645305-62645327 CAAGTCTCATCTTACATGGATGG - Intergenic
1009798899 6:68507438-68507460 CTCTTCTCATTTTTCTTCTAGGG - Intergenic
1009848189 6:69161058-69161080 CTATTCCCACTTTACAACTAAGG - Intronic
1012153251 6:95782398-95782420 AAATGATCATTTTACTTCTATGG + Intergenic
1012302395 6:97605736-97605758 TATTTCTCATTTTACATCCTTGG + Intergenic
1012336654 6:98067918-98067940 TAATTCTGATTTTTCATCTGTGG + Intergenic
1013147503 6:107408912-107408934 CATATCTCATTTTGGATCTAAGG + Intronic
1013404074 6:109826975-109826997 TTATCCTCATTTTACAGCTATGG - Intergenic
1013630076 6:111978042-111978064 ATTTTCTCATTTTACAACTATGG - Intergenic
1014257405 6:119175502-119175524 CAACTCTCATTTTAAATATGAGG - Intergenic
1014461081 6:121696362-121696384 AAACTCTCATTTTACAAATAAGG - Intergenic
1014684078 6:124473238-124473260 CAATGCTCATTGTAAGTCTAGGG + Intronic
1015125879 6:129753880-129753902 TGAATCTCCTTTTACATCTAAGG - Intergenic
1015714309 6:136175131-136175153 AAATATTCATTTCACATCTATGG + Intronic
1015759877 6:136647339-136647361 TTATTCTCATTTTACATACATGG + Intronic
1016604463 6:145904021-145904043 CAGTATTCATTTTATATCTATGG + Intronic
1016607124 6:145942722-145942744 AAATTCTTATTTTACAGCTGAGG + Intronic
1017462844 6:154667475-154667497 CAATCCTCATTTTATATATGAGG - Intergenic
1017580603 6:155860229-155860251 CAAGTCACATCTTACATATATGG - Intergenic
1018573614 6:165235707-165235729 CAAGTCACATTTTACATGGATGG - Intergenic
1018622893 6:165748977-165748999 TTATCCTCATTTTACATATAAGG - Intronic
1018960475 6:168443894-168443916 GTATTCTCATTTTACAGATAAGG - Intronic
1019854253 7:3588110-3588132 CCATTCTCGTTTTACAGGTAAGG + Intronic
1020378256 7:7512738-7512760 CAATTCTCATTTTCAAGATAAGG + Intronic
1020885778 7:13817432-13817454 CAAGTCACATTTTACATGGATGG - Intergenic
1021036219 7:15802363-15802385 AAATTCTAATTTTGCATCTGTGG - Intergenic
1022174733 7:27862217-27862239 CAACTTTTATTTTAGATCTAGGG + Intronic
1022248886 7:28587296-28587318 CAATGCTGATTTTACATAAAAGG - Intronic
1023457527 7:40357597-40357619 CATTCCTCTGTTTACATCTATGG - Intronic
1023749064 7:43352637-43352659 TCATTCTTATTTTACATCTAAGG - Intronic
1023821715 7:43984312-43984334 CCATCCTCATTTTACAGATAGGG + Intergenic
1024179559 7:46877308-46877330 CAAGTCACATCTTACATGTATGG - Intergenic
1025873639 7:65459336-65459358 CCATTCTCAATTTACAGTTAAGG + Intergenic
1026953331 7:74361695-74361717 CCATTCTCATTTTACACATCAGG + Intronic
1027546733 7:79536317-79536339 CAGTAATCATTTTACCTCTATGG - Intergenic
1027964019 7:84982270-84982292 CAATTCTTATTTTACAAGTGAGG - Intergenic
1028007754 7:85597984-85598006 CAATTTTCATATTACATTAAAGG + Intergenic
1028073003 7:86475704-86475726 TTATGCCCATTTTACATCTAAGG - Intergenic
1028139142 7:87253747-87253769 CAAATCACATTTTACATGGATGG + Intergenic
1028160298 7:87476687-87476709 TTATCCTCATTTTACATATAAGG - Intronic
1028278048 7:88882991-88883013 CAATTTTCATTTTAGATTCAGGG - Intronic
1028348498 7:89813978-89814000 CAAGTCACATTTTACATGGATGG + Intergenic
1028352438 7:89865198-89865220 CAATTCGCATTTTACTTCTTGGG + Intergenic
1028466433 7:91157678-91157700 CACTTCTCATCATACATCTGTGG - Intronic
1028550935 7:92064506-92064528 TTATTCTCAGTTTACATATAAGG + Intronic
1028950143 7:96625233-96625255 CAATTCACACTTTATATTTAGGG + Intronic
1029749977 7:102537731-102537753 CCATCCTCATTTTACAGATAGGG + Intergenic
1029767927 7:102636837-102636859 CCATCCTCATTTTACAGATAGGG + Intronic
1029800184 7:102938735-102938757 CAATTCTCATTGAAGTTCTAAGG + Intronic
1029890816 7:103928573-103928595 CAATTATAATTTTTCATCCATGG - Intronic
1031363477 7:120875124-120875146 TAATTCTCAATTTTCATCGAGGG - Intergenic
1031867597 7:127055318-127055340 TAATTCTCATTTGACCTCTTTGG - Intronic
1032509592 7:132461796-132461818 CAAGTCTCCATTTACATTTAAGG + Intronic
1032930690 7:136665748-136665770 CCATTCCCATTATACATCTCTGG + Intergenic
1033013557 7:137647892-137647914 TCATTCTCATTTTACAGATAAGG + Intronic
1033129849 7:138736364-138736386 TTATTCTCATTTTACAGATAAGG + Intronic
1033417941 7:141180816-141180838 CATTTCTCATTTCACAGATAAGG - Intronic
1033465897 7:141589214-141589236 ATATTCTCATTTTACATATTAGG - Intronic
1033539297 7:142341543-142341565 CTATTCTCATTTTACAGATGAGG + Intergenic
1034302183 7:150026012-150026034 TTATTCTCATTTTACAAATATGG - Intergenic
1034803872 7:154071307-154071329 TTATTCTCATTTTACAAATATGG + Intronic
1035836710 8:2762304-2762326 CAATGCACATTTTACATGTTAGG + Intergenic
1036115814 8:5959803-5959825 TAACTCTCATTTTACAAATAAGG - Intergenic
1036399839 8:8398263-8398285 ACATTCTCATTTTCCATCTCAGG + Intergenic
1036530588 8:9582643-9582665 GTATTCTCATTTTACATGTAAGG - Intronic
1036638348 8:10566515-10566537 ACATCCCCATTTTACATCTAAGG - Intergenic
1036910065 8:12751008-12751030 CTATTCTCATTTTTCAGATAAGG + Intronic
1037234491 8:16702157-16702179 TAATTCTCTTTTTAAATGTATGG + Intergenic
1038268762 8:26058281-26058303 CAATTCTCTTTCTATGTCTAAGG + Intergenic
1038460057 8:27708696-27708718 CAATTTTTATTTTACATTCAGGG + Intergenic
1038941575 8:32311485-32311507 CAGTTCTCATTCTTCCTCTAGGG - Intronic
1040872238 8:52112323-52112345 CAAGTCTTATTTTTCATCTTGGG + Exonic
1041673262 8:60514269-60514291 CAATATGCATTTGACATCTATGG + Intergenic
1042749573 8:72143396-72143418 CAATTCATATCTTACATCCATGG - Intergenic
1043264231 8:78242859-78242881 TGATTCTCATTTTCCATCTTGGG - Intergenic
1043362355 8:79489557-79489579 AAATTGACATTTTACATTTATGG - Intergenic
1044009134 8:86970461-86970483 CAATTTTTATTTTAGATTTAGGG + Intronic
1044036650 8:87312083-87312105 CAACTCTCATTTTAGATTCAGGG - Intronic
1044067545 8:87717443-87717465 CATTTCTCATTTTACAGATGAGG + Intergenic
1044562841 8:93630096-93630118 TTAGTCTCATTTTACATCCAGGG - Intergenic
1045722924 8:105134872-105134894 GAACTTTCATTTTACATTTACGG - Intronic
1045859803 8:106803300-106803322 CAATCCTCACTTCACATCTTAGG + Intergenic
1046548176 8:115678066-115678088 CTATCCTCATTTTACAGATAAGG + Intronic
1046618236 8:116500633-116500655 CAAATCACATTTTACATGGATGG + Intergenic
1046672999 8:117078399-117078421 CTGTTCTCATTTTACATAAAAGG + Intronic
1046953717 8:120042342-120042364 GAATTTTCATTTAACATCTATGG - Intronic
1047158731 8:122352311-122352333 CAAGTCACATTTTACATAGATGG - Intergenic
1047427583 8:124760614-124760636 TTATTCTCATTTTACAGATAAGG + Intergenic
1047550179 8:125862909-125862931 CAATTCTCACTTTGCACCCATGG + Intergenic
1047657959 8:126999290-126999312 TTATTCTCATTTTACTTATACGG + Intergenic
1047871670 8:129089793-129089815 CTATTCTCATTTTACAGGGATGG + Intergenic
1048076675 8:131079170-131079192 TAATCCTCATTTTACACATAGGG - Intergenic
1048104935 8:131397512-131397534 CAAATCTCTTTTTTCATGTAAGG - Intergenic
1048137868 8:131763775-131763797 CAAGTCACATTTTACATGGATGG + Intergenic
1048313838 8:133347653-133347675 CAAGTCACATTTTACATGGATGG - Intergenic
1048427978 8:134340313-134340335 TTATTCTCATTTTACAGCTGAGG - Intergenic
1048768172 8:137867056-137867078 CAACTCTCATCTTACATGGATGG - Intergenic
1048992521 8:139769524-139769546 CATTTCACATTTTCAATCTATGG + Intronic
1049263756 8:141653937-141653959 CGATTCTCATTTTACAGATGAGG + Intergenic
1050184567 9:2959464-2959486 CTATTCCTATTTTACATATATGG - Intergenic
1050264178 9:3872509-3872531 CAACTCCCATTTTACATGGATGG + Intronic
1052080133 9:24194860-24194882 AAATTCTCATTCTACATATATGG - Intergenic
1052210301 9:25895175-25895197 CAAGTCACATTTTACATGGATGG + Intergenic
1052574197 9:30270529-30270551 TAATTCTCCTTTAACATGTAAGG + Intergenic
1052727095 9:32242146-32242168 CAATTTTTATTTTAGATATAGGG - Intergenic
1053020813 9:34692659-34692681 CCATTCCCATTTTACAAATAAGG - Intergenic
1054851808 9:69854243-69854265 CAATTCTCACTTTACACATAAGG - Intronic
1055405925 9:75973798-75973820 CAACTCTCATTTTAGTGCTAAGG + Intronic
1055585657 9:77756812-77756834 CCCTTCTCATTTTACAGATAAGG - Intronic
1055797469 9:79990640-79990662 CAGCTTTCATTTTACAACTATGG - Intergenic
1056336114 9:85571005-85571027 CCATTCTGATTCTACACCTAAGG - Intronic
1057098070 9:92330482-92330504 CAATTCTCATTTGCTATCTAGGG - Intronic
1057739315 9:97697880-97697902 GTCTTCTCATTTTAAATCTAAGG - Intergenic
1058007399 9:99932044-99932066 GAATTCTCATTTTCCCCCTACGG + Intronic
1058099010 9:100897683-100897705 AAAGTCCCATTTTACATCCAAGG + Intergenic
1058102454 9:100932318-100932340 TCATTCTCATTTTACACATAAGG + Intergenic
1058825430 9:108772095-108772117 CTATTCTCATTTTACAGATAGGG + Intergenic
1058827940 9:108791797-108791819 CAAGTCACATTTTACATGGATGG - Intergenic
1058877849 9:109259645-109259667 CAATTCCCATTTTACAAATCAGG - Intronic
1058957244 9:109960458-109960480 TGATTGTCATTTTTCATCTATGG - Intronic
1059129515 9:111731362-111731384 CAACTCTCACTTTAAATCAAAGG - Intronic
1059210301 9:112508393-112508415 AAATTCTCATTCTATTTCTAAGG + Intronic
1059620410 9:115998478-115998500 CCATTCTCATTTTACACAGAAGG - Intergenic
1060158292 9:121335858-121335880 TTATTCTCATTTTTCAGCTAAGG - Intergenic
1060785624 9:126449854-126449876 CACTTCCCATTTTACAAATAAGG + Intronic
1061369341 9:130189263-130189285 CTATTCCCATTTTACAGCTAAGG + Intronic
1062434972 9:136542984-136543006 CAGTGCCCATTTTACATCTGAGG + Intronic
1187121901 X:16417317-16417339 CCATTCTCATTTTACAGGTGAGG + Intergenic
1188018102 X:25127070-25127092 CAATTTTTATTTTAGATCCAGGG - Intergenic
1188028565 X:25237535-25237557 TTATTCTCATTTTACATTTGAGG + Intergenic
1188702152 X:33278185-33278207 CAACTTTTATTTTACATCCAGGG + Intronic
1188753952 X:33937129-33937151 CAAGTCACATTTTACATGGATGG + Intergenic
1189082339 X:37988039-37988061 GAATTCTCTTTTTCCATATAAGG - Intronic
1189129148 X:38480305-38480327 TGATTCTGGTTTTACATCTATGG - Intronic
1189198357 X:39170404-39170426 CTATCCTCATTTTACATGCAAGG + Intergenic
1189446933 X:41088242-41088264 CAGTTCTCATGTTTTATCTATGG + Intronic
1191773824 X:64790721-64790743 CATTTCTCACTTTAAATCAAAGG + Intergenic
1191975651 X:66868314-66868336 AAATTTTCATTTTACATATGGGG + Intergenic
1192289061 X:69772494-69772516 CAATTTTCATTTTAGATTCAGGG + Intronic
1192495568 X:71614784-71614806 CAATTCCCTTTTGCCATCTAAGG + Intergenic
1193460651 X:81787519-81787541 CAAGTCTCATTTTACATAAATGG + Intergenic
1193485099 X:82077904-82077926 CAATTCACATCTTACATGGATGG + Intergenic
1193503253 X:82306988-82307010 CAATTCTCATTTTCAATATGAGG + Intergenic
1193542325 X:82787660-82787682 CAAGTCACATCTTACATGTATGG - Intergenic
1193976648 X:88128411-88128433 CAAATCTCTTTTAACATCAAGGG - Intergenic
1194020706 X:88688801-88688823 CATTTCTCATTTTACATATCTGG - Intergenic
1194078288 X:89425505-89425527 AAAGACTCATTTTAAATCTAAGG - Intergenic
1194082705 X:89487909-89487931 TTATTCTCATTTTACAAATAAGG + Intergenic
1194439680 X:93916569-93916591 CAACTATTATTTTAGATCTAGGG - Intergenic
1194467188 X:94247151-94247173 CAAGTCACATCTTACATGTATGG - Intergenic
1194697710 X:97075806-97075828 TTATTCTCATTTTACAAATAAGG + Intronic
1195374384 X:104212469-104212491 TTTTTCTCATTTTACATATAAGG + Intergenic
1195383715 X:104294186-104294208 TCATCCTCATTTTACAGCTAAGG + Intergenic
1195909352 X:109874285-109874307 TAATTCTCTTTGTACTTCTATGG - Intergenic
1196950787 X:120874688-120874710 CAATTCTCTAATGACATCTATGG - Intronic
1197041292 X:121939114-121939136 CAATTCACATCTTACATGGATGG - Intergenic
1197083379 X:122445309-122445331 TTATTCTCATTTTAAATGTAAGG + Intergenic
1197358690 X:125470122-125470144 AAATTATGATTTTTCATCTATGG + Intergenic
1198019502 X:132644380-132644402 AAATTCCCATTTTGCAGCTAAGG + Intronic
1198102399 X:133433249-133433271 TTATTCTCATTTTACAACTGAGG - Intergenic
1198153337 X:133932914-133932936 TAATTCACATTTTAAATATAAGG - Intronic
1198579370 X:138046874-138046896 TTATTCTCATTTTACAGATAAGG - Intergenic
1198625660 X:138570195-138570217 GCATTCTCATTTTACATCTGAGG + Intergenic
1198655198 X:138906226-138906248 TTATTTTCATTTTACATTTAAGG - Intronic
1198768614 X:140104592-140104614 CTATCCTCATTTTACATATTCGG - Intergenic
1199409541 X:147504827-147504849 CAAGTCACATTTTACATGGATGG - Intergenic
1200036195 X:153333020-153333042 CAACTTTCATTTTAGATTTAGGG - Intergenic
1200310065 X:155069406-155069428 TAATTCTCATTTTACACCTCAGG - Intronic
1200430931 Y:3081038-3081060 AAAGACTCATTTTAAATCTAAGG - Intergenic
1200435354 Y:3143783-3143805 TTATTCTCATTTTACAAATAAGG + Intergenic
1200677278 Y:6164418-6164440 CAATTCTTATTTTAAGTTTAGGG - Intergenic
1201257631 Y:12124603-12124625 AAAGTCTCATTTTACCTATACGG + Intergenic
1201402951 Y:13622566-13622588 CACGTCTCATTTTACATTGATGG + Intergenic
1202033741 Y:20608663-20608685 CAATTCTCTTTTGGCATATAAGG + Intergenic
1202380379 Y:24271813-24271835 AAACTCTCATTTAACATCTGTGG + Intergenic
1202490404 Y:25398312-25398334 AAACTCTCATTTAACATCTGTGG - Intergenic