ID: 1158960422

View in Genome Browser
Species Human (GRCh38)
Location 18:62583680-62583702
Sequence CCTCTTGGTGGGGTGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 669
Summary {0: 1, 1: 0, 2: 3, 3: 89, 4: 576}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158960422_1158960435 14 Left 1158960422 18:62583680-62583702 CCCAACCCCACCCCACCAAGAGG 0: 1
1: 0
2: 3
3: 89
4: 576
Right 1158960435 18:62583717-62583739 TTCCAGAGCAGTGAGTTTCGAGG 0: 1
1: 0
2: 2
3: 13
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158960422 Original CRISPR CCTCTTGGTGGGGTGGGGTT GGG (reversed) Intronic
900004757 1:37533-37555 CGGCTTGGTGGGGTGGGGATGGG + Intergenic
900178211 1:1299945-1299967 CCTTTGGGAGGGGTGGGGCTGGG - Intronic
900593457 1:3469873-3469895 CGTCCTGGTGGGGTGGTGCTTGG - Intronic
900659272 1:3774707-3774729 CCTCTAGGAGGGCTGGGGCTTGG - Intronic
900792645 1:4690286-4690308 CCTCTTGGTGGTGGGAGGGTGGG - Intronic
900888998 1:5435710-5435732 TCTCATGGTGGGGAGGGGGTGGG + Intergenic
900906612 1:5563993-5564015 CTTCTTAGTGGGATGGGGTGGGG + Intergenic
901456264 1:9364556-9364578 CCTCGTGATGGGGTGGGACTGGG - Intronic
901735113 1:11307194-11307216 GCCCTTGTTGGGGTGGGGGTAGG + Intergenic
902204200 1:14855406-14855428 TGTGTTGGTGGGGTGGTGTTGGG - Intronic
902316670 1:15625626-15625648 CATCTTGGTGGGGTGGTGGGAGG - Intronic
902552243 1:17225982-17226004 CCTGTTGGTGGGGTGGAGAAAGG + Intronic
902608414 1:17582262-17582284 CCTCTTGGTGGGGAGAGGAAAGG - Intronic
902621165 1:17651881-17651903 ACTGGTGGTGGGGTGGGGTAGGG - Intronic
902730996 1:18368792-18368814 ATTCTTGGTGGGGTGGGGCAAGG - Intronic
902741195 1:18439504-18439526 CCTCAGGGTGGGGTGGGGGGTGG + Intergenic
903052597 1:20612669-20612691 CCTGTTGGTGGGGCGGGGCGGGG + Intronic
903446581 1:23426105-23426127 CCCCTCAGTGGGGTTGGGTTTGG + Intergenic
903461613 1:23524813-23524835 CCTCTGGGTGTGGTGGGGTGAGG - Intronic
903643489 1:24876323-24876345 TCCCTGGGTGGGGTGGGGTGGGG + Intergenic
904495242 1:30882757-30882779 GCTCATGGTGGTGTGGGGCTGGG - Intronic
904599974 1:31667882-31667904 CCTCCTGGGGGTGAGGGGTTTGG - Intronic
904620251 1:31770855-31770877 CCTGTGGATGGGGTGGGGGTAGG + Intergenic
905357025 1:37391762-37391784 CCTCTTGGTGGTTGGGGGGTGGG - Intergenic
906587323 1:46990893-46990915 CCTGTTGGGGGCGGGGGGTTAGG + Intergenic
907414414 1:54304387-54304409 GCTCTTGGGGGGATGGGGGTGGG + Intronic
907690643 1:56661364-56661386 CCCATTGGTGGGGTGGAGGTTGG - Intronic
908825138 1:68125908-68125930 CCTCATGTGGGGGTGGGGTGGGG - Intronic
910777797 1:90893441-90893463 CATCTTGGCTGTGTGGGGTTTGG - Intergenic
910878584 1:91901921-91901943 TCTTTTGGTGGGGTGGGGGAGGG - Intronic
911069441 1:93820868-93820890 ACTCTAGGTTGGGTGGGGGTGGG - Intronic
911852041 1:102832489-102832511 GCTTGTGGTGGGGTGGGGTGAGG + Intergenic
912630868 1:111245766-111245788 CCCCTTGTTTGGCTGGGGTTGGG + Intergenic
912701058 1:111878510-111878532 CCCCCTGGTGGGGTGAGGTCTGG + Intronic
913097356 1:115531642-115531664 CCTCTTGATTTGGTGGGTTTTGG - Intergenic
913216939 1:116628560-116628582 ACTCTTGGTGGGGAATGGTTTGG - Intronic
913368792 1:118072998-118073020 CGGCTTGGTGGAGTGGGGTGGGG + Intronic
913503063 1:119489418-119489440 TCTCTTGTTGGGAAGGGGTTTGG + Intergenic
914194218 1:145436538-145436560 CCTGTTGGAGGGTGGGGGTTGGG + Intergenic
914408365 1:147400376-147400398 ATTCTTGTTGGGGTGGTGTTAGG - Intergenic
914475551 1:148019415-148019437 CCTGTTGGAGGGTGGGGGTTGGG + Intergenic
914504455 1:148276644-148276666 CCTATTGGAGGGTGGGGGTTGGG - Intergenic
914675340 1:149903890-149903912 CCTCTGAGTGGGGAGAGGTTGGG - Exonic
915384489 1:155477509-155477531 CCTCTTGGGGTGGTGGGGGCAGG + Intronic
915901716 1:159851567-159851589 CCTTTTGGTGGGAAGGGGATTGG - Intronic
917450697 1:175145147-175145169 CATGTTGGTGGGGGGTGGTTAGG + Intronic
917734597 1:177908958-177908980 CATTTTGGAAGGGTGGGGTTTGG - Intergenic
917975705 1:180236194-180236216 CCTAGAGGTGGGGTGGGGGTGGG + Intronic
917982791 1:180282281-180282303 CCTGTTGGCTGGGAGGGGTTGGG + Intronic
918189082 1:182154777-182154799 CCTGTTGGTGGGTGGGGGTTAGG + Intergenic
919918557 1:202154112-202154134 CCTGTGTGTGGGGTGGGGGTGGG + Intronic
920032551 1:203045994-203046016 CCTCAGGGTGGGGTGGGGATGGG + Intronic
920080648 1:203370448-203370470 CCTCTTAGTGTGGAGGGGATTGG + Intergenic
920104694 1:203543731-203543753 TGTCATGGTGGGGTGGGGTGTGG - Intergenic
920306838 1:205023862-205023884 CCTCGGGGTGGTGTGGGGGTTGG + Intergenic
920500988 1:206485322-206485344 CTTCTTTGTGGGGTGGGAGTGGG + Intronic
920600555 1:207320508-207320530 CCTGTTGGAGGGTGGGGGTTAGG + Intergenic
921640039 1:217542467-217542489 CCTCTTTTTGGGGTGGGGGAAGG + Intronic
921728912 1:218554858-218554880 CCTGTTGGGGGTGAGGGGTTAGG - Intergenic
921907800 1:220513633-220513655 CCTTTTTTTGGGGTGGGGTGGGG + Intergenic
921925012 1:220704076-220704098 GCTCCTGGTGGGGTGGGCTGAGG - Intergenic
922188390 1:223296054-223296076 TCTCTGTGTGGGGTGGGGTGGGG + Intronic
922222976 1:223622422-223622444 CTTCTTGGTGCTGAGGGGTTTGG + Intronic
923693151 1:236217032-236217054 TCTCTTGGTGGGATGTGGTGGGG - Exonic
924350289 1:243108009-243108031 CCTCCTGGTAGCCTGGGGTTTGG + Intergenic
1063979605 10:11443205-11443227 TTTCTTGGTGGAATGGGGTTTGG - Intergenic
1064635903 10:17366764-17366786 CCTCTCTGTGGGCTGGGATTAGG - Intronic
1064782651 10:18859409-18859431 CCTGTTGGTTGGGTGGCCTTGGG - Intergenic
1065312707 10:24431644-24431666 CCTCTTGGTGAGCTTGGTTTGGG - Intronic
1065730500 10:28705626-28705648 CCTGGTGGCGGGGTGGGGTCTGG + Intergenic
1066978953 10:42393345-42393367 TCTCTGGTTGGGGAGGGGTTTGG + Intergenic
1067270638 10:44788767-44788789 AGTCATGGTGGGGTGGGGGTGGG - Intergenic
1067405096 10:46015348-46015370 TTTTTTGGGGGGGTGGGGTTGGG + Intronic
1067407780 10:46038631-46038653 CCTCTTGGTGTTGTGGTATTGGG - Intronic
1067480954 10:46597419-46597441 GCTCCTGGTGGGGGGGGGTTGGG - Intergenic
1067515080 10:46932655-46932677 GGTCTTGGTGGGGTGGGGTGGGG + Intronic
1067613799 10:47744403-47744425 GCTCCTGGTGGGGGGGGGGTTGG + Intergenic
1067647176 10:48119155-48119177 GGTCTTGGTGGGGTGCGGTGGGG - Intergenic
1067682894 10:48451404-48451426 CCTCCAGCTGGGGTGGGGTGAGG + Intronic
1070295907 10:75161299-75161321 CTTCTTGGAAGGCTGGGGTTGGG - Intronic
1070705002 10:78631170-78631192 ATTCTTGGTGGGGTGGAGTCAGG + Intergenic
1070782261 10:79144513-79144535 CCTGCTTGTGGGGTGGGGTGGGG - Intronic
1071565014 10:86667294-86667316 CCTCTTGGAGGGGTCTGGCTTGG - Intergenic
1071629206 10:87204375-87204397 GCTCCTGGCGGGGTGGGGATTGG + Intergenic
1071981771 10:91010534-91010556 TATCTTTCTGGGGTGGGGTTGGG + Intergenic
1072203777 10:93184123-93184145 CCTCTTAGAGGGTTGGGGGTGGG - Intergenic
1072765294 10:98089978-98090000 ACCCTTGGTGGGGCGGGGCTGGG - Intergenic
1072894078 10:99350793-99350815 CCTATTAGGGGGGTGGGGTTGGG - Intronic
1072916723 10:99541214-99541236 AATCTAGGTGGGGTGGGGTGGGG - Intergenic
1073102563 10:101014314-101014336 TCTCTTGGTGTGGGGGGCTTGGG + Intronic
1073636216 10:105201298-105201320 CCTGTCTGTGGGGTGGGGTGGGG + Intronic
1074699828 10:116083225-116083247 CTACTTGGAGGGGTGGGGTAAGG + Intronic
1074889580 10:117724204-117724226 CCTGTTGGGGGTGTGGGGTCAGG + Intergenic
1075225796 10:120628117-120628139 CCCCTTGGTGGGGTAGGTGTTGG + Intergenic
1075315791 10:121452376-121452398 CCTGTCGGTGGGTGGGGGTTAGG - Intergenic
1075517024 10:123117717-123117739 CACCTTGGTGGGGTGGCGGTGGG - Intergenic
1076338897 10:129729071-129729093 CCACTGGGTGGGGAGGGGTGGGG + Intronic
1077047904 11:554403-554425 CCTCTTGGTGGAGGGGAGTGGGG + Exonic
1077282508 11:1752120-1752142 CCGCTGGGAGGGGAGGGGTTGGG - Intronic
1077390798 11:2299957-2299979 CTCCTTGGTGGGGTAGGGGTGGG + Intronic
1077396197 11:2323826-2323848 CCTGTTGTTGGGTTGGGGGTGGG + Intergenic
1077473306 11:2774929-2774951 CGGCTTGGTGGGGAGGGGTGGGG - Intronic
1077554740 11:3220512-3220534 CCCCATGCTGGGGTGAGGTTAGG + Intergenic
1078392324 11:10946436-10946458 CCTCTTGGGGGTGGTGGGTTAGG - Intergenic
1078452292 11:11449331-11449353 CCTCAATGTGGGGTGGGCTTGGG - Intronic
1078656651 11:13246932-13246954 GCCCTTGGAGGGGTGGGGCTGGG - Intergenic
1080885284 11:36362418-36362440 ACCCTTGGCGGGGTGGGGGTGGG + Intronic
1082910211 11:58363963-58363985 CCTGTTGTGGGGGTGGGGGTAGG + Intergenic
1083164958 11:60878408-60878430 CCTTTTGGGGAGGTGGGGATGGG + Intergenic
1083253524 11:61482841-61482863 CCTCAGGGTGGGGTGGGGCTAGG + Intronic
1083393310 11:62371393-62371415 CTTCTTGGTGTGCTCGGGTTCGG - Intronic
1083659400 11:64245281-64245303 CCTCTTCCTGGGGTGGGGGTGGG + Exonic
1083804415 11:65065728-65065750 CCCATTGGTGGAGGGGGGTTGGG + Intergenic
1084083934 11:66846133-66846155 CCCCTTGGTGGGGAGGGCTGGGG - Exonic
1084162293 11:67356466-67356488 CCTCATGGTGAGGTGGGGGAAGG - Intronic
1084538754 11:69774207-69774229 CCTATTTCTGGGGTGGGGTTGGG + Intronic
1084569435 11:69950577-69950599 CCTCTTGGTGGGATGGGAGTAGG - Intergenic
1084593394 11:70103394-70103416 TCTCTTGGTGGGGTTTGGTCTGG - Intronic
1085064139 11:73476443-73476465 CCTGATGGTGGGGTGGGGGTGGG + Intronic
1085101949 11:73808462-73808484 TCACATGGAGGGGTGGGGTTTGG - Intronic
1085992377 11:81864631-81864653 CCTGTCGGAGGGGTGGGGTTGGG + Intergenic
1088354210 11:108925137-108925159 CAGATTGTTGGGGTGGGGTTTGG + Intronic
1088512670 11:110594473-110594495 CCTCTTTGTGGGGAGGAGATTGG - Intronic
1089173130 11:116529252-116529274 GCTTTTGGTGGGGTGGAGATGGG - Intergenic
1091378169 12:39584-39606 CGGCTTGGTGGGGTGGGGATGGG + Intergenic
1091725804 12:2845748-2845770 GCCTTTGGTGGGGTGGGGTGGGG - Intronic
1091755092 12:3046187-3046209 TCTCTGGGTGGGGGGGGGGTTGG - Intergenic
1091845058 12:3649387-3649409 CCTCTGGGTGGGGTGAGAATGGG - Intronic
1091852013 12:3707090-3707112 CTTCTTGGTGGCCTGGGGTAGGG - Intronic
1092384628 12:8026763-8026785 CCTCTTAATTGGCTGGGGTTCGG - Intergenic
1092658959 12:10718514-10718536 TCCTTTGGTGGGGTGGGGGTGGG - Intronic
1092745217 12:11666729-11666751 ACTCTTGCTGGGGTCTGGTTGGG - Intronic
1092962259 12:13607714-13607736 CATCCTGGGGGGGTGGGGGTGGG + Intronic
1093663902 12:21789706-21789728 CCTGTTGGGGGGTGGGGGTTAGG - Intergenic
1093742692 12:22706403-22706425 TCTAATGGTGGGGTGGGGTGGGG + Intergenic
1095260938 12:40098871-40098893 CCTCTTGGCAGGGTGTGGATTGG - Intronic
1095693820 12:45121148-45121170 TCTCTTGGAGGGGTGGGGCATGG + Intergenic
1095884800 12:47177602-47177624 CCTGGTGGTGGGGTGGGGGGTGG + Intronic
1096111577 12:49031969-49031991 GCTCCTGGTAGGGTGGGGTCTGG + Exonic
1096258061 12:50074749-50074771 GGCCATGGTGGGGTGGGGTTGGG - Intronic
1097173633 12:57130420-57130442 CTAATTGGTGGGGTGGGGGTGGG - Intronic
1097202237 12:57289140-57289162 CCTGTTGGTGGGGTGAGCTTTGG - Intronic
1097880054 12:64678685-64678707 CCTCTTGTGGGGCTGGGGTGGGG + Intronic
1098316054 12:69194396-69194418 CATCTTGGTTTGGTGGGTTTTGG - Intergenic
1098512980 12:71341015-71341037 CCTCTTGGTGGGGTGGGGAGAGG - Intronic
1098857722 12:75671581-75671603 CATTTTGGTGGTGGGGGGTTGGG - Intergenic
1101340706 12:103840458-103840480 CCTTTTGGTGGGGGTGGGTTGGG - Intronic
1101686968 12:107034140-107034162 CATCTTGGTTTGGTGGGTTTTGG - Intronic
1101955603 12:109209369-109209391 CATCCTGGTGGGGTGGGGCTGGG - Intronic
1102114843 12:110394953-110394975 CCTCTTCATGGAGTGGGGGTGGG - Intronic
1102572658 12:113836489-113836511 CCGCTTGGTGGGGAGGGGCTGGG + Intronic
1102595015 12:113985637-113985659 CCACTTGCTGGGGTGGGATTTGG + Intergenic
1104144827 12:126022989-126023011 CCTGTTGGGGGGTGGGGGTTAGG - Intergenic
1104195442 12:126532786-126532808 CTTTTTGGTGGGGGGGGGTTGGG + Intergenic
1104305682 12:127608955-127608977 TTTCTTGGTGGGGAGGAGTTAGG + Intergenic
1104435403 12:128752366-128752388 TCTCTTGGTGGGCTGCGGTGAGG + Intergenic
1104655965 12:130574261-130574283 CCTGTTGGGGGGGTGGCGGTGGG + Intronic
1104878946 12:132055908-132055930 CCTCTTGGGGGCGTGGTTTTGGG + Intronic
1105595250 13:21831660-21831682 TCTTTTGGTGGGGTGAGGTGAGG + Intergenic
1106016933 13:25878530-25878552 CATCTTGGTTTGGTGGGTTTTGG + Intronic
1106473974 13:30081543-30081565 TCTGTATGTGGGGTGGGGTTGGG - Intergenic
1106686904 13:32069861-32069883 CCTCTTGGGGGGTGGGGGTCTGG - Intronic
1106770031 13:32952895-32952917 TTTTTTGGTGGGGTGGGGTGGGG + Intergenic
1107179582 13:37443388-37443410 TCCTTTGGTGGCGTGGGGTTGGG + Intergenic
1107394339 13:39999694-39999716 CTTGCTGGAGGGGTGGGGTTTGG + Intergenic
1107398843 13:40048609-40048631 CCATTTGGGGGGGTGGGGGTGGG + Intergenic
1107701784 13:43055757-43055779 TCTCTTGCTGGGTTTGGGTTTGG + Intronic
1108285943 13:48907935-48907957 ACTCTAGGTGGGGTGGGGGCGGG + Intergenic
1110831880 13:80041264-80041286 CCTCTTTTGGGGGTGGGGGTGGG + Intergenic
1112457453 13:99575525-99575547 CCTTTTGTTGGGTTGGGGTTAGG + Intergenic
1112593162 13:100782941-100782963 TCTCTTGGTGGGGTGTGGTGGGG + Intergenic
1112728756 13:102335479-102335501 TTTCTTGGTGGAATGGGGTTTGG - Intronic
1113651428 13:112036597-112036619 GCGCTGAGTGGGGTGGGGTTGGG - Intergenic
1114262507 14:21048196-21048218 ATTCATGGTGGGGTGGGGGTAGG - Intronic
1114376556 14:22152693-22152715 CCTCTGGTTGGGGAGGAGTTTGG + Intergenic
1115429550 14:33300718-33300740 CCTTTTGTAGGGGAGGGGTTGGG + Intronic
1115775146 14:36706862-36706884 ACTCTGGATGGGGTGGGGATGGG - Intronic
1115967366 14:38906245-38906267 CGTCTTGGAGGGATGGGGTCAGG - Intergenic
1116243703 14:42380427-42380449 CCTGTTGGTGGGTGGGGGTCTGG + Intergenic
1116294902 14:43094575-43094597 ACTGTTGGTGGGTAGGGGTTGGG + Intergenic
1116357564 14:43949324-43949346 CCTCTTGGAGAGGGGGAGTTGGG - Intergenic
1117068462 14:52034012-52034034 CCCAATGGTGGGGTGGGGGTGGG - Intronic
1117958377 14:61140221-61140243 CCTCCTGGTGGGGTTGGGCTGGG - Intergenic
1118379724 14:65207840-65207862 CAACTTGGTGGGTTGGGGCTGGG + Intergenic
1118379775 14:65208165-65208187 CAACTTGGTGGGTTGGGGGTGGG + Intergenic
1118620958 14:67613532-67613554 TTTATTGGTGGGGAGGGGTTGGG - Intergenic
1118994396 14:70822885-70822907 CCCCTTGGTGGGCTGGGCTCAGG + Intergenic
1119212440 14:72842528-72842550 ACCCTTGGTGGGATGGGGTAGGG + Intronic
1119260292 14:73234240-73234262 TCTCTTTGTGTGGTTGGGTTGGG - Intergenic
1119261920 14:73242799-73242821 CTTCTTGGTTGTGTGTGGTTCGG + Intronic
1121242326 14:92439781-92439803 CCCCCTGGCGGGGTGGGGGTGGG - Intronic
1121554763 14:94828105-94828127 CCTCTCGGTGGGTTGGTGGTGGG + Intergenic
1121660054 14:95628044-95628066 CATCTTGGTGGGGAGGGGGTTGG - Intergenic
1121966625 14:98312999-98313021 CCTGTGGGTGGGTGGGGGTTAGG - Intergenic
1122061595 14:99139893-99139915 CTTCCTGGTGGGATGGGGTTGGG - Intergenic
1122082897 14:99278986-99279008 CCTCTTGGTTGGGTGCATTTAGG - Intergenic
1122118226 14:99538067-99538089 CCTCTGGGTGGAGTCGGGTGGGG + Intronic
1122573763 14:102727287-102727309 CCTCTTGGAGGTGGGGGGGTGGG - Exonic
1122583040 14:102783538-102783560 CCCCTTAGTGGGAGGGGGTTTGG + Intronic
1122995566 14:105262030-105262052 GCCCTTGGTGGGTTGGGGCTGGG - Intronic
1123006265 14:105325215-105325237 GCTCGGGGTGGGGTGGGGCTGGG + Intronic
1124345399 15:28918607-28918629 CGTGTGGGTGTGGTGGGGTTGGG + Intronic
1124987394 15:34633990-34634012 CCTGTTGGTGGGTGGGGGATGGG + Intergenic
1126016451 15:44355774-44355796 CTTCTTGGTGTGGTGGGGGACGG - Intronic
1126995248 15:54435570-54435592 CCTCTCGGTGGGTGGGGGTGGGG + Intronic
1127269781 15:57390165-57390187 GCTGTTGGTTGGGTGTGGTTTGG + Intronic
1127314433 15:57781505-57781527 CCTTGTGATGGGGTGGGGTGGGG + Intronic
1127602640 15:60553700-60553722 CCTCTTCCTGGTATGGGGTTGGG - Intronic
1127863018 15:63010241-63010263 CTGCTTGGTGGGGTGGGGTAGGG - Intergenic
1128080501 15:64854282-64854304 CCGAGTGGTGGGGTGGGGATGGG + Intronic
1128497103 15:68204954-68204976 GCTGTTGGCGGGGTGGGGGTTGG - Intronic
1128610056 15:69066040-69066062 CCTTTTAGTGGGATGGGGATGGG + Intergenic
1129660471 15:77550277-77550299 CCACTTGGGAGGGTGGGGTGGGG + Intergenic
1130273733 15:82465686-82465708 CCTCTAGGAGGGGTGGGGTGGGG + Intergenic
1130466081 15:84193057-84193079 CCTCTAGGAGGGGTGGGGTGGGG + Intergenic
1130498182 15:84480479-84480501 CCTCTAGGAGGGGTGGGGTGGGG - Intergenic
1130588373 15:85197653-85197675 CCTCTAGGAGGGGTGGGGTGGGG + Intergenic
1132052541 15:98618866-98618888 TTTCTTGGAGGGGTGGGGTGGGG - Intergenic
1132148333 15:99441896-99441918 CCTTTTGGTTGGGTGTGTTTTGG + Intergenic
1132354204 15:101159307-101159329 TCTCTTGGTGGGGTGGTGAGTGG - Intergenic
1132439241 15:101842175-101842197 CCTGTTGTGGGGCTGGGGTTGGG - Intergenic
1132448753 15:101953411-101953433 CGGCTTGGTGGGGTGGGGATGGG - Intergenic
1132531217 16:450842-450864 CCTAAGGGTGGGGTGGGGTGGGG - Intronic
1132573945 16:656280-656302 TCTGTGGGTGGGGTGGGGTCAGG - Exonic
1132694374 16:1195354-1195376 GCTCTTGCGGGGCTGGGGTTGGG + Intronic
1132756414 16:1487520-1487542 CCTCAGGCTGGGTTGGGGTTGGG + Exonic
1133168358 16:3964732-3964754 CCTCTTGGGGTGGGGAGGTTGGG + Exonic
1134675464 16:16086995-16087017 CCTGCTGGCGGGGTGGGGCTTGG + Intronic
1134773537 16:16831944-16831966 CCTGTTGGGGGGGTGGGGTGGGG - Intergenic
1134903670 16:17961011-17961033 CATCTTGGTTTGGTGGGCTTTGG - Intergenic
1135346162 16:21690342-21690364 CCTATTGTGGGGGTGGGGTGGGG - Intronic
1136377855 16:29876228-29876250 CCCCGTGCTGGGTTGGGGTTAGG - Intronic
1136777298 16:32878777-32878799 CCCCCTGGAGGGGTGGGGTGGGG + Intergenic
1136893327 16:33982736-33982758 CCCCCTGGAGGGGTGGGGTGGGG - Intergenic
1137391297 16:48083520-48083542 CCACTTGGTGGGCTTGGGGTTGG - Exonic
1137729747 16:50680764-50680786 TCCCCTGGTGGGGTGGGGGTGGG + Intronic
1137800780 16:51260223-51260245 CCTGATGATGGGGTGGGGTGGGG - Intergenic
1138245902 16:55467145-55467167 CCCTTAGGTGGGGTGGGGTTGGG - Intronic
1138659579 16:58509368-58509390 TCTCTAGGTGGTGTGGGGTGGGG - Intronic
1139361040 16:66400453-66400475 CCTGTTACTGGAGTGGGGTTAGG + Intronic
1140408014 16:74723814-74723836 CATCTTGGAGGGGTGTAGTTAGG + Intronic
1141222422 16:82083601-82083623 CCTCATGGTGGGATGGTTTTTGG - Intronic
1142134224 16:88444278-88444300 CCTCTCTGTGCGGTGGGGTGTGG - Intergenic
1142227196 16:88883329-88883351 CCACGTGGTTGGGTGGTGTTTGG - Intronic
1203079712 16_KI270728v1_random:1140886-1140908 CCCCCTGGAGGGGTGGGGTGGGG + Intergenic
1143114490 17:4574975-4574997 CCTGATGGTGGGCTGGGGATGGG - Intergenic
1143122524 17:4617792-4617814 GCCCTTGGTGTGGTGGGGGTGGG - Intergenic
1143396696 17:6604989-6605011 CCTCCCGGAGGGCTGGGGTTAGG - Intronic
1143480373 17:7224615-7224637 CCGGTAGGTGGGGTGGGGGTGGG - Intronic
1143504546 17:7356468-7356490 CCTCCTGGTGGAGTGAGTTTTGG + Exonic
1143885121 17:10059551-10059573 CCTCTTGCTTGGCTAGGGTTTGG - Intronic
1144250256 17:13409206-13409228 CCTCTTAGTGGGGATGGGTGAGG - Intergenic
1144661507 17:17073682-17073704 CCTCTGGGTGGGGTCTGCTTAGG + Intronic
1146059158 17:29595546-29595568 CATCTTGCTGGGGTAAGGTTGGG + Intronic
1146210150 17:30936055-30936077 GCTAGTGGTGGGGTGGGGTGGGG - Intronic
1146773294 17:35588224-35588246 TCTATTGGAGGGGTGGGGTGGGG + Intronic
1147331339 17:39700905-39700927 CCTCTTGCTGGGGTCTGGGTTGG + Intronic
1147650657 17:42059965-42059987 CATCTTGGTGTGGTGGGATTGGG + Intronic
1147692719 17:42326914-42326936 CTTCTTGGTGTGGTGAGGCTTGG - Intronic
1147736252 17:42640429-42640451 CCTTCTGGTTGGGTGGGGTATGG + Intergenic
1147998560 17:44374922-44374944 GCTCTGGGAGGGGCGGGGTTTGG - Intronic
1148560325 17:48602371-48602393 CGCCTTGGTGGGGTGGGGGTGGG + Intronic
1148717972 17:49729317-49729339 GCTCTTGGTGGAGGGAGGTTAGG + Intronic
1148753121 17:49957339-49957361 CCACTTGCGGGGGTGGGGTGAGG - Intergenic
1148786306 17:50147828-50147850 CCTCTTGCTGGGGTGGGAGGTGG + Intronic
1149429075 17:56582403-56582425 GCTGTTGTTGGGGTGGGGTGGGG - Intergenic
1149863073 17:60135015-60135037 TCTTTCGGTGGGGAGGGGTTGGG - Intergenic
1150011646 17:61510266-61510288 CATGTTGGTGGCCTGGGGTTGGG + Intergenic
1151707853 17:75780383-75780405 TCTCTTGGTGGGGTGGGAAGGGG + Intronic
1151961432 17:77407893-77407915 CCTCTGGGTGGAGTGGGGTGGGG + Intronic
1152757497 17:82093061-82093083 CCTCCTGGTGGGGTGGGGGCCGG - Intronic
1152759753 17:82101651-82101673 CCCCTTAGTGGGGCGGGGTGGGG + Exonic
1153351973 18:4091085-4091107 CCTATTGTTGGGGTGGGGGTAGG + Intronic
1153470962 18:5444842-5444864 CCTTTTGCCGGGGTGGGGTTGGG - Intronic
1153829016 18:8903787-8903809 CCTTTTGTTGGGTTTGGGTTTGG - Intergenic
1154162271 18:11989509-11989531 CCCTTTGGTGGGGTGGGGGTCGG + Intronic
1154231405 18:12559170-12559192 CCACGGGGTGGGGTGGGGTGGGG + Intronic
1155932664 18:31723960-31723982 CAGCCTGGTGGGGTGGGGTGGGG - Intergenic
1156371524 18:36475467-36475489 CCTCGTGGAGGGGTTGGGTGCGG + Intronic
1156476581 18:37409396-37409418 CCTCATTGTGGGGGAGGGTTGGG + Intronic
1157258921 18:46162028-46162050 CATCTTGGTTTGGTGGGATTTGG + Intergenic
1157450345 18:47781836-47781858 CCTCTTGCAGGGGTGGGGCTGGG - Intergenic
1157452656 18:47799999-47800021 CCTCTAAGTGGGGTGGGGTGGGG - Intergenic
1157496095 18:48158507-48158529 GGTCTTGGAGGGGTGGGGTGGGG + Intronic
1157725396 18:49959902-49959924 CTTCTTGGAGGAGTGGGCTTGGG + Intronic
1158473888 18:57762503-57762525 ACTCTTTGTTGTGTGGGGTTTGG + Intronic
1158813706 18:61068892-61068914 CTTGTTTGTGGGGTGGGGGTGGG - Intergenic
1158960422 18:62583680-62583702 CCTCTTGGTGGGGTGGGGTTGGG - Intronic
1159246390 18:65810701-65810723 CCTGTTGGAGGGTTGGGGGTAGG - Intronic
1159447243 18:68556047-68556069 CATCTTGGTTTGGTGGGTTTTGG + Intergenic
1160268471 18:77361905-77361927 CCTGTGGGTGGCATGGGGTTTGG - Intergenic
1160557395 18:79735216-79735238 CCTGCTGCGGGGGTGGGGTTAGG + Intronic
1160636509 19:79142-79164 CGGCTTGGTGGGGTGGGGATGGG + Intergenic
1160738555 19:675820-675842 CCTGTGGGTGGGGAGTGGTTGGG - Intergenic
1160871836 19:1281293-1281315 CCTCTGGGTGGGGGGGGGTGGGG + Intergenic
1160989280 19:1853971-1853993 GCTTTCGGTGGGGTGGGGGTGGG + Exonic
1161130114 19:2583414-2583436 CGTCTTCATGGGGTGAGGTTGGG + Intronic
1161273818 19:3404592-3404614 CTCCTGGGTGGGGTGGGGGTGGG - Intronic
1161433436 19:4247554-4247576 ACTTTGGGTGGGGTGGGGTGGGG + Intronic
1161587703 19:5114460-5114482 CCTGTTGGTGGGGAGGGCTCAGG - Intronic
1161861527 19:6801689-6801711 CCTGGTGCTGGGGTGGGGGTGGG + Intronic
1162554446 19:11378151-11378173 ACTTTAGGTGGGGTGGGGTAGGG + Exonic
1163402226 19:17101085-17101107 CCTCTGGATGGGGTGGGATGGGG + Intronic
1163445820 19:17345928-17345950 CCTTTTTTTGGGGGGGGGTTGGG + Intergenic
1163757269 19:19113509-19113531 GCTCTTGTTGGGGTGGGAGTAGG + Intergenic
1164389348 19:27804926-27804948 CCTGGGGGTGGAGTGGGGTTGGG + Intergenic
1164633275 19:29775410-29775432 CCTCTTTGTGGGCTAGGGGTGGG - Intergenic
1165511316 19:36268225-36268247 CCCCGTGGCGGGGTGGGGGTGGG + Intergenic
1165907963 19:39205004-39205026 CCTCGTGGTGGGGCGGGGGGGGG + Intergenic
1166193015 19:41188222-41188244 CGTATGGGTGGGGTGGGGTGGGG + Intergenic
1166588738 19:43975531-43975553 CCTCTTGGAGGGGTGGAGGGAGG + Intronic
1166888088 19:45973538-45973560 CCTCATGGTGGGGGGGGGCGGGG + Exonic
1166907229 19:46119784-46119806 CCAGTGGGTGGGGTGGGGTGGGG + Intergenic
1167144485 19:47673550-47673572 CCACTGGATGGGGTGGGGTCAGG - Exonic
1167166499 19:47803091-47803113 TCTTTTGGTGGGGTGGGGGATGG - Intronic
1167503598 19:49860377-49860399 CATGTGGGGGGGGTGGGGTTGGG + Exonic
1167691277 19:50984768-50984790 AATATTAGTGGGGTGGGGTTAGG - Intergenic
1167933842 19:52890569-52890591 CCTCTGTGTGGGGTTTGGTTAGG - Intronic
1168239079 19:55080354-55080376 CCTCTAGGTGGGGCGGGGCCTGG + Intronic
925167930 2:1730382-1730404 CCTCTTGTAGGTGTGGAGTTTGG - Intronic
926735313 2:16069259-16069281 CGTGTTGGAGGGGTGGGATTGGG + Intergenic
927095992 2:19747978-19748000 CCTCTGGGTGGGCTGGCCTTTGG - Intergenic
927557494 2:24046106-24046128 CCTGTTGGGGAGGTGGGGGTGGG + Intronic
927686985 2:25178016-25178038 CCTGGAGGTGGGGTGGGGGTGGG - Intergenic
927808454 2:26168814-26168836 CCTCTAGATGGGGTGGGGCAGGG + Intergenic
929171514 2:38937316-38937338 ACTCCTGGTGGGGTGGGGGGAGG - Exonic
929410898 2:41696657-41696679 CATCTTGGCGGGGGGGTGTTGGG - Intergenic
929558120 2:42938044-42938066 CCTGTTGGTGGCGTGGGAGTGGG - Intergenic
929887212 2:45889559-45889581 GCTGTTGGTGGGGTGGGGTGGGG + Intronic
930067070 2:47335798-47335820 CCTGTTGGTGGGGTGGGAGGAGG - Intergenic
930347268 2:50199393-50199415 TATTTTGGTGGGGTGGGGTTGGG - Intronic
931024125 2:58089327-58089349 CCTCTTTGTGCAGTGCGGTTTGG + Intronic
931120830 2:59217694-59217716 CCTTTTGTTGATGTGGGGTTGGG - Intergenic
931154973 2:59617831-59617853 CCACTGGGTGGGGTGGGGGTTGG - Intergenic
931801882 2:65766618-65766640 CCTTTTTGGGGGGTGGGGTGGGG + Intergenic
931848366 2:66228370-66228392 CCACTTGGTGGTGGGGAGTTGGG + Intergenic
932187570 2:69712169-69712191 GGTGGTGGTGGGGTGGGGTTGGG - Intronic
932308366 2:70719946-70719968 TTTCTTGGTGGGGGGTGGTTGGG - Intronic
932845683 2:75133920-75133942 CATCTTGGTTTGGTGGGGTTTGG - Intronic
933151930 2:78925732-78925754 CCTCTTGGTTGAGTGGCCTTTGG - Intergenic
933423103 2:82077129-82077151 CTACGTGGTGGGGTGGGGTAGGG + Intergenic
933942144 2:87253757-87253779 CCTCTTGCTGGTGTGGGGATGGG + Intergenic
933995416 2:87664575-87664597 GGTTTTGGGGGGGTGGGGTTTGG - Intergenic
934775068 2:96932173-96932195 CCTCTGTGTGGGCTGGGGTGGGG - Intronic
935581293 2:104758116-104758138 CCCCTGGGTGGGGTGGGGTGGGG - Intergenic
936228889 2:110682216-110682238 TTTCATGGTGGGGTGGGGGTGGG + Intergenic
936338081 2:111607812-111607834 CCTCTTGCTGGTGTGGGGATGGG - Intergenic
936564972 2:113575898-113575920 CGGCTTGGTGGGGTGGGGATGGG - Intergenic
937290619 2:120779569-120779591 CCTCTTGCTGGGCAGGGATTAGG - Intronic
937428665 2:121820083-121820105 ACACCTGGTGGGGTGGGGTGAGG + Intergenic
937985826 2:127637679-127637701 CATTCTGGTGGGGTGGGGTGGGG - Exonic
938387007 2:130873762-130873784 CACTTTGGAGGGGTGGGGTTTGG + Intronic
938393838 2:130927020-130927042 TCTCTGGTTGGGGAGGGGTTTGG + Intronic
938458591 2:131483024-131483046 CCTGCTGCTGGTGTGGGGTTGGG + Intronic
940004605 2:148999243-148999265 ACCCTGGGTGGGGTGGGGGTGGG - Intronic
940349402 2:152665033-152665055 TTTCTTGGTGGGGTGGGGTGGGG - Intronic
940385403 2:153065522-153065544 CATCTTCGTGGGGTGGGGTGAGG - Intergenic
940517617 2:154699599-154699621 CCTTTTGGGGGGTTGGGGGTTGG + Intronic
940625984 2:156175751-156175773 CCTTTTGGTTTTGTGGGGTTGGG + Intergenic
941589718 2:167404292-167404314 CCTAATGGGGGGGTGGTGTTTGG - Intergenic
942213376 2:173693886-173693908 CCTGTTGGGGGGATGGGGTTGGG - Intergenic
942227547 2:173830519-173830541 CCTGGTGGTGGGCTGGGGCTAGG - Intergenic
942228151 2:173834861-173834883 TCTTTTGTTGGGGTGGGATTGGG - Intergenic
942885014 2:180912464-180912486 TCTCTTGGTGGGGGCGGGTGGGG + Intergenic
943085559 2:183306802-183306824 CCTGGGGGTGGGGTGGGGTATGG + Intergenic
943507905 2:188785126-188785148 CCTGTTGGAGGGTTGGGGGTGGG + Intronic
943552749 2:189360767-189360789 CCTGTTGGAGGGGTGGGGGAAGG - Intergenic
944189176 2:196983020-196983042 CCTGTTGGTGGGTTGGGGTAAGG + Intronic
944603231 2:201324836-201324858 CCTCTGGGATAGGTGGGGTTCGG + Intronic
945017961 2:205539739-205539761 CCTGGGGGAGGGGTGGGGTTCGG - Intronic
946286781 2:218710170-218710192 CCGCTGGGTGGGTTGGGGTTAGG + Intergenic
947492766 2:230610285-230610307 CCTCATGGTGGAGAGGGGTGGGG - Intergenic
947592447 2:231393410-231393432 CCTGATGGTGGGGTGGGGGTGGG - Intergenic
948825213 2:240570679-240570701 GTTCTTGCTGGGGTGGGGTGGGG - Intronic
1170042546 20:12053452-12053474 CCTCTTGATGGGGTGGGGGATGG + Intergenic
1170432651 20:16290719-16290741 CTTCTTCATGGGGTGGGGTCAGG - Intronic
1170765058 20:19282784-19282806 CCTGTTGCTGGGGTGTGTTTTGG + Intronic
1171004971 20:21455596-21455618 CCTGTCGGTGGGGTGGGGGGAGG - Intergenic
1171164666 20:22959197-22959219 CCCCTTTTTGGGCTGGGGTTGGG - Intergenic
1171495493 20:25552131-25552153 CCAGTTGGCGGGGTGGGGATGGG + Intronic
1171847882 20:30288770-30288792 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1172014177 20:31863180-31863202 TCTATAGGTGGGGTGGGGTTAGG + Intronic
1172555565 20:35837995-35838017 CCTCTTGGAGGGGTTTGTTTAGG + Intronic
1172649529 20:36493036-36493058 CCTGTGGGTAGGGTGGGGATGGG - Intronic
1172697950 20:36835347-36835369 GGTATTGGTGGGGTGGGGTGGGG - Intronic
1173539479 20:43840726-43840748 GCTTTTGGTGGGGTGGGGCTGGG + Intergenic
1173563940 20:44025961-44025983 GCTCCTGGCGGGGTGGGGTGGGG + Intronic
1173667843 20:44775364-44775386 CCTTTTTCTGGGGTGGGGTGTGG + Intronic
1173790477 20:45824704-45824726 CCTCTAGGCAGGGTGGGGGTTGG - Intronic
1173801086 20:45894922-45894944 CCTCCTGGTGAGGTGGGGGCAGG + Intronic
1173821979 20:46025531-46025553 TCTCCAGGTGGGGTGGGGATCGG + Intronic
1174738659 20:52990448-52990470 CCTTGGGGTGGGGTGGGGTGGGG + Intronic
1175301729 20:57947788-57947810 CCTGGAGGTGGGATGGGGTTTGG - Intergenic
1175401274 20:58701239-58701261 CCTGGGGGTGGGGTGGGGTGGGG + Intronic
1175479288 20:59300378-59300400 CGGCTGGGTGGGGTGGGGTAGGG - Intergenic
1176987675 21:15456197-15456219 TCCCCTGCTGGGGTGGGGTTTGG - Intergenic
1177342100 21:19816541-19816563 CCTCTTCATGGGGTGGGGAGAGG + Intergenic
1179185120 21:39079707-39079729 GCTCTTGCAGGGGTGGGGTTGGG - Intergenic
1179544428 21:42105053-42105075 CCTCCTGGTGGGGGAAGGTTGGG - Intronic
1179881967 21:44296704-44296726 GCTCTTGTTGGGGAGGGGCTGGG - Intronic
1180187529 21:46146877-46146899 CGTCTCTGTGGGGTGGGGTGGGG - Intronic
1180818290 22:18806943-18806965 ACTCTTGGTGGGGAACGGTTTGG - Intergenic
1181204513 22:21241398-21241420 ACTCTTGGTGGGGAACGGTTTGG - Intergenic
1181236388 22:21450006-21450028 CCGCTGCCTGGGGTGGGGTTAGG - Exonic
1181305797 22:21916589-21916611 CCTCTGGGTGGGGGGGGGGGAGG - Intergenic
1181386594 22:22550517-22550539 CCTCCTGGTGGGGTGGGAATTGG - Intronic
1181436811 22:22915937-22915959 CCTGTGGGTGGGGTGAGGGTCGG - Intergenic
1181437652 22:22919863-22919885 CCTGTGGGTGGGGTGAGGGTCGG - Intergenic
1181438300 22:22922918-22922940 CCTGTGGGTGGGGTGAGGGTCGG - Intergenic
1181550897 22:23638598-23638620 CCTGTGGGTGGGGTGGGGGCTGG + Intergenic
1181797389 22:25320091-25320113 CCTGTGGGTGGGGTGGGGGCTGG - Intergenic
1181847114 22:25719686-25719708 TTTCTTGGTGGGGTGGGGGGGGG + Intronic
1183212819 22:36461471-36461493 CCTCCTTGTGGGGTGGGGGTTGG + Intergenic
1183356822 22:37364217-37364239 CCTATTGGTGTTGTGAGGTTAGG - Intergenic
1183868227 22:40721147-40721169 CAGCTTGGTGGGGTGGGGGAAGG - Intergenic
1184001828 22:41680305-41680327 CTTCTTGGTGAGGTGGGCATCGG + Exonic
1184118732 22:42437061-42437083 CCTTTTGGTGTGGCGGGGTTGGG - Intergenic
1184120381 22:42446028-42446050 CCTCTGGCTGGGGTGGGCTGTGG + Intergenic
1184130810 22:42515481-42515503 CCTCTTCCTGGGGAGGAGTTGGG - Intronic
1184375205 22:44107626-44107648 CCTCTGGGTGGGGTGGAGAGGGG + Intronic
1184514523 22:44953911-44953933 TCTCCTGGCGGGGTGGGCTTGGG - Intronic
1184557060 22:45239440-45239462 CCTCATGCAGGGGTGGGGTGGGG - Intronic
1185218717 22:49618113-49618135 CCTCCTGGTGGGTAGGGCTTGGG - Intronic
1185220321 22:49626383-49626405 CCCCAGGGTGGGGTGGGGTTGGG - Intronic
1185273013 22:49937251-49937273 CCTGCGGGTGGGGTGGGGGTGGG - Intergenic
1185326800 22:50229659-50229681 ACTCTAGGTGGCGTGGGGTTGGG - Intronic
1185344302 22:50304707-50304729 GCTGTGGGTGGGGTGGGGCTGGG - Intronic
1185371244 22:50461899-50461921 CCCCTTGGATGGGTGGGGCTGGG - Intronic
1203222412 22_KI270731v1_random:54017-54039 ACTCTTGGTGGGGAACGGTTTGG + Intergenic
1203268418 22_KI270734v1_random:32797-32819 ACTCTTGGTGGGGAACGGTTTGG - Intergenic
949474762 3:4432914-4432936 CCCAGGGGTGGGGTGGGGTTTGG - Intronic
949543253 3:5050734-5050756 GCAGTTGGTGGGGTGGGGTGAGG + Intergenic
949977985 3:9477985-9478007 CCTCTTGGGGGGGTAGGGGCGGG + Exonic
950075829 3:10186229-10186251 CCTCCTGCTGGTGTGGGTTTGGG + Intronic
950728130 3:14932464-14932486 CCTCTGTGTGGGGTGTGCTTTGG - Intronic
951680755 3:25292263-25292285 CATTTTGGTGGGGTGAGGGTGGG - Intronic
952523163 3:34182891-34182913 CCCCTTAGTGTGGTGAGGTTTGG - Intergenic
953803747 3:46050105-46050127 CCTCTTGGAGAGTTGGGGGTAGG + Intergenic
954305334 3:49722559-49722581 GCTGTTGGTGGGCTGGGGTGGGG - Intronic
954536244 3:51361464-51361486 CATCATGGTGTGGGGGGGTTGGG + Intronic
954705900 3:52480348-52480370 CCCCTGGCTGGGCTGGGGTTGGG + Intronic
955322678 3:57985617-57985639 CCTCGTGGTGGAGTGAGGCTGGG + Intergenic
955329430 3:58034843-58034865 CCTCTGGGAGGTGTGGGGTGTGG - Intronic
955347602 3:58172639-58172661 CCTTTTGTGGGGGTGGGGTGGGG + Intergenic
955366798 3:58317639-58317661 ACCTTTGGTGGGGTGGGCTTCGG + Exonic
955410829 3:58654346-58654368 CCTCCAGGTGGCTTGGGGTTGGG + Intronic
956279069 3:67537217-67537239 CCTGTCGGTGGGTTGGGGGTAGG - Intronic
956823224 3:72972812-72972834 CTACTGGGTGGGGAGGGGTTGGG + Intronic
957745289 3:84333267-84333289 CCTATTGGAGGGTTGGGGGTAGG - Intergenic
958881009 3:99669848-99669870 GCTCTTTGAGGGGTGGGCTTGGG + Intronic
958995964 3:100905254-100905276 CCTGTTGTTGGGGTGGGGTATGG + Intronic
961368345 3:126415253-126415275 CCTGTTGGGTGGGTGAGGTTGGG - Intronic
961622519 3:128235883-128235905 CCTGTCACTGGGGTGGGGTTGGG - Intronic
961862248 3:129926311-129926333 CCCCTCGGTGGGGTAGGGCTGGG + Intergenic
962268812 3:133963106-133963128 CATGCTGGTGGGGTGGGGCTGGG - Intronic
962515733 3:136149561-136149583 TCTTTTGGTGGGGTGGGGGTGGG - Exonic
963000513 3:140677393-140677415 CCTCTTTTTGGAGTGGGGGTAGG + Intergenic
965539383 3:169857141-169857163 CCTATTGGTAGGGTGGTTTTAGG + Intronic
967961297 3:194926813-194926835 CATGGTGGTGGGGTGGGGTAAGG - Intergenic
967967460 3:194973466-194973488 CCTGTGGGTGGGGTGGGATGGGG - Intergenic
968479542 4:827126-827148 GCTCCTGGCGGGGTGGGGGTGGG + Intergenic
968512123 4:1000386-1000408 TCTCTTGATGGTGTAGGGTTGGG + Intronic
969338735 4:6527587-6527609 CCTGGAGGTGGGGTGGGGTCGGG - Intronic
970868439 4:20785008-20785030 CCAGTTTCTGGGGTGGGGTTAGG - Intronic
971251048 4:24973841-24973863 CCTCATGGAGGGATTGGGTTTGG + Intronic
971906472 4:32732552-32732574 CCCCTGCGTGGGGTGGGGTGTGG + Intergenic
972939233 4:44177273-44177295 CCTGGGGGTGGGGTGGGGTTAGG - Intronic
973757633 4:54091320-54091342 CCTCTTGGTGGGGTGCGCTACGG - Intronic
974126860 4:57707207-57707229 CATCTTGGTTGGGTGGGGAGGGG + Intergenic
974585158 4:63864454-63864476 CCTGTTGGTGGGTGGGGGCTAGG + Intergenic
975754884 4:77562216-77562238 GCCCATGGTGGGGTGGGGGTTGG - Intronic
978119004 4:105055758-105055780 CCTGTTGGAGGGTAGGGGTTAGG + Intergenic
978603285 4:110450690-110450712 TTTCTTAGTGGGGTGGGGATGGG + Intronic
978937405 4:114394890-114394912 CCTCTGGGTGATGTGAGGTTTGG - Intergenic
979251646 4:118572545-118572567 CCTCCTGGTAGCCTGGGGTTTGG - Intergenic
980707135 4:136513524-136513546 CTGTTTTGTGGGGTGGGGTTTGG + Intergenic
980858502 4:138470102-138470124 CCTGTTGGTGGGGTAGGGGTGGG - Intergenic
981949258 4:150386415-150386437 CCTCTTGGAGGGTGGGGGGTGGG - Intronic
982849159 4:160290188-160290210 CTTCTTGGTGGGGAAGAGTTAGG - Intergenic
983703188 4:170623646-170623668 CCTGTGGGTGGCTTGGGGTTGGG + Intergenic
983826158 4:172263791-172263813 AATCCTGGTGGGGTGGGGTGAGG + Intronic
985255259 4:188063602-188063624 TCTCTTGTTGGGGTGGGGGCGGG - Intergenic
985545278 5:505916-505938 CCTCACTTTGGGGTGGGGTTAGG + Intronic
985786584 5:1898498-1898520 AATTTTGGTGGGGTGGGGTGGGG - Intergenic
985908976 5:2864215-2864237 CCGCTTGGTGGGATGAGGGTGGG + Intergenic
988617773 5:32792331-32792353 ACTCGGGGTGGGGTGGGGTAGGG + Intergenic
990435297 5:55784183-55784205 CCTCTTGGTGGGGCGGAGTCAGG + Intronic
990654798 5:57943210-57943232 CAACTTGGTGGGGTAGGGGTAGG - Intergenic
990851656 5:60211447-60211469 AATCTTGGGGGGGTGGGGTAGGG + Intronic
991130147 5:63113084-63113106 ACTCTGCGTGGGGTTGGGTTGGG + Intergenic
991342963 5:65632133-65632155 CCTCTTGGTGGGCGGGGGTAGGG + Intronic
991480295 5:67070884-67070906 CTTCTTTGTGGTGCGGGGTTGGG - Intronic
994356242 5:98796818-98796840 CCTCCTGGTGGGGAGGATTTGGG + Intronic
994702988 5:103161107-103161129 CCTGTTGTGGGGGTGGGGGTTGG - Intronic
995896769 5:117022275-117022297 CCTCTTGCTGGGGTGGTGATGGG + Intergenic
996204468 5:120714981-120715003 CCTGTTGGTGGTGGGGGGTGAGG + Intergenic
997049228 5:130358906-130358928 CCTATTGGAGGGTTGGGGGTGGG + Intergenic
997306129 5:132837972-132837994 CCTCTTGGTGAGGCTGGGTGAGG + Intergenic
997520825 5:134524161-134524183 CCTCTAGCTGGGGAGGGGGTGGG - Intergenic
997901111 5:137765627-137765649 CCTTTTGCTGGGTTTGGGTTTGG - Intergenic
999514862 5:152290892-152290914 CCTGTTGGGGTGGTGGGGGTGGG - Intergenic
1001118287 5:168957671-168957693 CCTCTTGTAGGGGTGGGGCCTGG - Intronic
1001170941 5:169418347-169418369 CCCCTTGCTGGGCTTGGGTTTGG - Intergenic
1001205767 5:169761639-169761661 ACCCTTGCTGGGGTGGGGTAAGG + Intronic
1001537121 5:172505955-172505977 CCTCCTGGTGGGTTGGACTTGGG - Intergenic
1001783549 5:174391656-174391678 CTACTTGGTAGGGTGGGGTGGGG + Intergenic
1002132814 5:177091864-177091886 CCTCTTGGTGGGGTCTAGTCTGG + Intronic
1002134004 5:177097201-177097223 TCTCTGGGTGGGGAGGAGTTTGG - Intronic
1002467176 5:179413442-179413464 CCTTTTGTGGGGGTGGTGTTGGG - Intergenic
1002909189 6:1475839-1475861 CCTGTTGGGGGGTTGGGGTGAGG + Intergenic
1003532763 6:6951881-6951903 CCTGCTGATGGGGTGAGGTTTGG - Intergenic
1003759509 6:9160888-9160910 CCTGTTGGTGGGTGGGGGCTAGG + Intergenic
1004110075 6:12709193-12709215 CCTCATGGGGTGGTGGGGGTTGG - Intergenic
1004604324 6:17179574-17179596 CTTCTGGGTGGGGTGGTGGTGGG + Intergenic
1004819711 6:19353980-19354002 CCTGTTGGAGGGTTGGGGGTGGG + Intergenic
1005301887 6:24479097-24479119 TCTCTGGTTGGGGAGGGGTTTGG - Intronic
1007237430 6:40400991-40401013 CCTCTGGGGGAGGTGGGGTTAGG - Intronic
1007285799 6:40746652-40746674 GGTCTTGTTGGGGAGGGGTTGGG - Intergenic
1007393733 6:41565490-41565512 CCTCGTGCTGGGGTGGGGAAGGG - Intronic
1007496341 6:42262370-42262392 CCACTTTGTGGGGAGGGGGTAGG + Intronic
1008604310 6:53125096-53125118 CCTCTTGGAGGGGTGGGAATAGG + Intergenic
1008660855 6:53665891-53665913 CCGGTTGGTGGAGAGGGGTTGGG + Intergenic
1008836380 6:55836588-55836610 TGTGTTGGTGGGGTGAGGTTAGG - Intronic
1010242416 6:73628572-73628594 CCTTTTTGGGGGGTGGGGGTGGG - Intronic
1011943775 6:92875509-92875531 CATTTTTGAGGGGTGGGGTTAGG - Intergenic
1012009888 6:93770260-93770282 CCTTGTGGTGGGGTGGGGGGAGG - Intergenic
1012052521 6:94362237-94362259 GCCCTTGGCGGGTTGGGGTTGGG + Intergenic
1012276595 6:97282553-97282575 CCTGTTGGGGGGGGGGGGGTGGG + Exonic
1012787352 6:103647694-103647716 CCTGTTGGGGGTGTGGGGCTAGG + Intergenic
1013020117 6:106206249-106206271 CATGTTGGGGGGGTGGGGGTGGG + Intronic
1013130016 6:107223761-107223783 GCTCTTGGTGGGTCGGGGTCGGG - Intronic
1013188793 6:107784547-107784569 TCTCTTGCTGGGGTGGGGAGAGG + Intronic
1013211661 6:107992298-107992320 CCTCCTGGTGGGTGGGGGTGGGG - Intergenic
1013604935 6:111738877-111738899 CTTCTTGGTGGGGCGGGGAGGGG + Intronic
1015301492 6:131657710-131657732 ATCCTTGGTGGGGTGTGGTTTGG + Intronic
1015545199 6:134354810-134354832 CCTGTTGGTGGGATGGGATTGGG - Intergenic
1015843945 6:137498240-137498262 ACTCTTGCGGGGGTGGGGGTGGG - Intergenic
1016168267 6:140975034-140975056 CCTGTCGGTGGGGTGGGGGCTGG + Intergenic
1017598732 6:156058565-156058587 CCTGTTGGTGGGGTGAGGTTGGG + Intergenic
1018006959 6:159631243-159631265 CTTGTGGGTGGGGTGGGGGTGGG + Intergenic
1018033168 6:159860036-159860058 TCCCTAGGTGGGGTGGGGGTCGG - Intergenic
1018185574 6:161263135-161263157 CTTGGTGGTGGGGTGGGGTGGGG - Intronic
1018344107 6:162882731-162882753 CATGTTGGTGGGATGGAGTTGGG - Intronic
1018676075 6:166223345-166223367 CCTGGGGGTGGGGTGGGGGTGGG - Intergenic
1019287080 7:229028-229050 CATCTTGGTGGTGGGGGGGTGGG - Exonic
1019348325 7:541355-541377 CCTGTGGGTGGGGTGGGGGTGGG - Intergenic
1019441522 7:1049949-1049971 CTCCTTGTTGGGGTGGGGTGGGG - Intronic
1019585979 7:1803744-1803766 TCTCTGGTTGGGGAGGGGTTTGG + Intergenic
1019612281 7:1942570-1942592 CCTCTTGGTGGGGTGGGTGCAGG - Intronic
1020353442 7:7250645-7250667 CTTTTTGGTGGGGTGTGGGTAGG + Intergenic
1020704123 7:11521693-11521715 CCTCGTGGTGGGGTCGGGGGAGG - Intronic
1020706413 7:11549762-11549784 CCTGTTGGGGGAGTGTGGTTGGG + Intronic
1020949896 7:14662047-14662069 GCCCGTTGTGGGGTGGGGTTAGG + Intronic
1021056875 7:16060110-16060132 TTTTTTGGTGGGGCGGGGTTGGG + Intergenic
1021092433 7:16499448-16499470 CATGTGGGTGGGGTAGGGTTGGG + Intronic
1021515261 7:21477538-21477560 CATCTTGTTGGGGTGGGGGAGGG - Intronic
1022615034 7:31920443-31920465 GCTCTTCATGGGGTGAGGTTGGG + Intronic
1022644184 7:32215603-32215625 CCCCTGGGTGGTCTGGGGTTAGG - Intronic
1023527918 7:41124190-41124212 CCTTTAGGTGGGTTAGGGTTAGG + Intergenic
1024876879 7:54036393-54036415 TCTCTGGTTGGGGAGGGGTTTGG - Intergenic
1026548556 7:71346741-71346763 CCTGTTGGGGGGGCGGGGGTGGG + Intronic
1027215400 7:76180217-76180239 TCCATGGGTGGGGTGGGGTTGGG - Intergenic
1027741895 7:82018982-82019004 TGTCTTGGTGGGGTGGGGGTGGG + Intronic
1028393038 7:90337113-90337135 CCTCTTGGTAGGGTGGTGGGTGG - Intronic
1029104937 7:98167465-98167487 CCTCAAGGTGGGGTGGTGCTGGG + Intronic
1029148423 7:98463293-98463315 ACTCTGGCTGGGGTGGGGATGGG + Intergenic
1029494600 7:100890090-100890112 CGTCGGGGTGGGGTGGGGATGGG + Exonic
1030178373 7:106678428-106678450 CCTGTTGGTGCGGTGGGGGTCGG + Intergenic
1030728638 7:112957129-112957151 TCTCAGGGTGGGGTGGGGTGGGG + Intergenic
1030909100 7:115224612-115224634 TCTCTTGATTGGGTGGGGTTTGG - Intergenic
1030923490 7:115421720-115421742 CCTGTTTGAGGGGTGGGGTGGGG - Intergenic
1032387952 7:131537594-131537616 CTTTTTGGGGGGGTGGGGTGGGG - Intronic
1032457827 7:132087076-132087098 CCTCTGTGTGGGCAGGGGTTGGG - Intergenic
1032493722 7:132344895-132344917 CCTCTTACTGGGGTGGGGAAAGG - Intronic
1032500032 7:132393218-132393240 CTTCTTGGGTGGGTGGGGCTGGG - Intronic
1032871627 7:135991965-135991987 GCTAGTGGTGGGGTGGGGGTGGG + Intergenic
1034100327 7:148445307-148445329 CCACAGGGTGGGGTGGGGTGGGG + Intergenic
1034133790 7:148746104-148746126 CCTCTCTGAGGGGTGGGCTTGGG + Intronic
1034150351 7:148910363-148910385 TCTCCTTGTGGGGTGGGGGTGGG - Intergenic
1035053870 7:156020743-156020765 CCTCCTGGTGGAGGGGGTTTGGG - Intergenic
1035346400 7:158202526-158202548 CCTCTGGCTTTGGTGGGGTTTGG - Intronic
1035702146 8:1644260-1644282 GCTCTTGGTCGGGCGGGCTTAGG - Intronic
1037915531 8:22770528-22770550 TCTCTGGGTGGGTTGGGGTCTGG + Intronic
1038487884 8:27949668-27949690 CCTCTTGATGGGATGCGGTTGGG - Intronic
1038955550 8:32464280-32464302 CATCATGGTGGGGTGGGGGGGGG - Intronic
1040778019 8:51070876-51070898 CCTACAGGTGGGCTGGGGTTTGG - Intergenic
1040944523 8:52869857-52869879 TCTCTGGTTGGGGAGGGGTTTGG + Intergenic
1041345812 8:56896765-56896787 CCTGTTGGCGGGGTGGGGGGAGG + Intergenic
1041364645 8:57089134-57089156 CCTGTTGGAGGGGTGGGGGGAGG - Intergenic
1041641426 8:60206998-60207020 CACCTTGGTGGGCTGGGGTGGGG - Intronic
1042636553 8:70882106-70882128 CCTGTTGGTGGTGGGGGGCTGGG + Intergenic
1042843106 8:73144463-73144485 CCTGTTGGTGGGGGCGGGGTGGG + Intergenic
1043250331 8:78064546-78064568 TCTGGTAGTGGGGTGGGGTTGGG - Intergenic
1044573753 8:93747067-93747089 CCTCTAGGTGGGGGAGGGGTTGG + Intergenic
1045428054 8:102086869-102086891 CATCTTGGTTTGGTGGGTTTTGG - Intronic
1047442370 8:124889327-124889349 TCTCTTTGTGGGGTAGGGGTGGG + Intergenic
1047640639 8:126817954-126817976 TGTCTGGGTGGGGTGGGGTGGGG - Intergenic
1047706343 8:127503372-127503394 CCTGTTGGGGGTGGGGGGTTAGG + Intergenic
1047761652 8:127959030-127959052 CCCCTTAGCGGGGTGGGGTGGGG + Intergenic
1047779291 8:128098441-128098463 CCTGATGGTGGGGTGGGGAGGGG - Intergenic
1047852103 8:128868242-128868264 CCTGTTGGGGGTGAGGGGTTAGG - Intergenic
1048298963 8:133237691-133237713 GCTCTTGTCGGGGTGGGGGTGGG - Exonic
1048443673 8:134477992-134478014 CTGCTGGGTGGGGTGGGGGTAGG - Exonic
1049598176 8:143494182-143494204 CCTCTGTGTGGGGTGTGGGTGGG - Intronic
1049709377 8:144056797-144056819 GCGCTGGGTGGGGTGGGGTCAGG - Intronic
1049887451 9:37315-37337 CGGCTTGGTGGGGTGGGGATGGG + Intergenic
1050281066 9:4050440-4050462 CCTGTTGGTGGGTGGGGGTCTGG + Intronic
1051101719 9:13529845-13529867 CCACTTCCTGGGGTGGGGTCAGG - Intergenic
1051283113 9:15463485-15463507 CTTTTTGGAGGGGTGGGGTGGGG + Exonic
1051905018 9:22085315-22085337 GCACTTGGCAGGGTGGGGTTGGG - Intergenic
1052024344 9:23558250-23558272 AATCTTGGAGGGGTGGGGTCTGG - Intergenic
1052865913 9:33464535-33464557 CCTCTTGGTGGGGGTGGGAGTGG - Intronic
1052997739 9:34559974-34559996 GGTCATGGTGGGGTGGGGGTTGG + Intronic
1053023817 9:34714585-34714607 GCATTTGGTGGGGTGGGGCTGGG + Intergenic
1053786017 9:41653417-41653439 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054174733 9:61867350-61867372 GCTCTTGGTGGGGCTGGGGTTGG - Intergenic
1054662805 9:67713443-67713465 GCTCTTGGTGGGGCTGGGGTTGG + Intergenic
1055740387 9:79382127-79382149 CCTCTGGGAGGGGTGGGCTGGGG + Intergenic
1055852295 9:80646248-80646270 AATGTTGGTGGGGTGGGGTGGGG - Intergenic
1056771060 9:89478767-89478789 CCTTGGGGTGGGGTGGGGTGGGG - Intronic
1057018974 9:91681168-91681190 CCTCCTGCTGGGGTGGGGTGGGG - Intronic
1057140902 9:92726294-92726316 CCTCATGGTGTGTTGGGGTGTGG + Intronic
1058258623 9:102802224-102802246 TCTGTTGGTGGGTAGGGGTTAGG + Intergenic
1058456549 9:105143228-105143250 CCTCCTGGTGGGGTGCTGTCGGG - Intergenic
1058661058 9:107269398-107269420 GCTCTGGGTGGGGTGGGATGTGG - Intergenic
1058706469 9:107641604-107641626 ACGTTTGGTGGGGTGGGGATGGG - Intergenic
1058756227 9:108085283-108085305 CATCTTGGTTTGGTGGGCTTTGG - Intergenic
1058929253 9:109702585-109702607 CCTGTTGTGGGGGTGGGGGTAGG + Intronic
1058942487 9:109826207-109826229 CCTGTTGTGGGGGTGGGGGTAGG + Intronic
1059511352 9:114851200-114851222 CCTCTTGAGGGGGTGGGCTGTGG + Intergenic
1059677648 9:116555219-116555241 CCTCTTGCTGGGGTGGCCTCTGG - Intronic
1060477796 9:123999132-123999154 GCTCTAGGTGGGGTGGCGATGGG - Intergenic
1060597469 9:124856915-124856937 GCTCCTGGTGGGGTGAGGATGGG - Intronic
1061396097 9:130343918-130343940 CTTCCTCGTGGGGTGGGGTGGGG + Intronic
1061547468 9:131313127-131313149 CCGCCTGGCGCGGTGGGGTTTGG - Intergenic
1061739444 9:132689990-132690012 CCACTGGGTGGGTAGGGGTTGGG - Exonic
1062152718 9:135030174-135030196 CCTCCTGATGTGGTGGGGTGTGG + Intergenic
1185762085 X:2696289-2696311 CCAGTTGGGGAGGTGGGGTTCGG + Intronic
1185763790 X:2708339-2708361 ACTCTCTGTGGGGTGGTGTTTGG + Intronic
1186567721 X:10681691-10681713 CCTCTTGGTGGGGCATGGTGAGG + Intronic
1186621101 X:11240932-11240954 CTACTGGGTGGGGTGGGGTGGGG + Intronic
1186913919 X:14199464-14199486 CCTGTCGGTGGGGTGGGGGGAGG + Intergenic
1186964935 X:14776599-14776621 GCTCTTGGAGAGGTGGGGCTGGG - Intergenic
1188445524 X:30249805-30249827 CCTCTATTTGGGGTGGGGGTTGG - Intronic
1189288202 X:39866897-39866919 CCTGTTTGGGGGGTGGGGGTGGG - Intergenic
1189581150 X:42407852-42407874 CCTGTTGGAGGGTTGGGGGTGGG - Intergenic
1189682371 X:43529846-43529868 CATCTTTGTGGGGCTGGGTTGGG - Intergenic
1189777531 X:44483648-44483670 CAACTTGGTGGGGTGGCGGTGGG + Intergenic
1190108965 X:47577713-47577735 CTTGTTGGTGGGGTGGAGTGAGG - Intronic
1190482426 X:50890263-50890285 ACTGGTGGTGGGGTGGGGTGGGG - Intergenic
1191688891 X:63920190-63920212 ACTCCTGGTGGGGTGGGGTCAGG - Intergenic
1192044207 X:67654879-67654901 CCTCTTGGAGGAATGTGGTTTGG + Intronic
1192624388 X:72712844-72712866 CATCTTGGCTGTGTGGGGTTTGG - Exonic
1193555253 X:82945938-82945960 CCTATCGGCGGGGTGGGGTCTGG - Intergenic
1194583415 X:95704633-95704655 CTTCTTTGTGAGGGGGGGTTGGG - Intergenic
1195075841 X:101326513-101326535 GCTGTTGGTGGGGTGGGGGTGGG + Intergenic
1195201355 X:102553239-102553261 CCTGTTGGAGGGGTGGGGTCGGG - Intergenic
1195263541 X:103157842-103157864 CCCCATGGTGGGGTGAGGTATGG - Intergenic
1197479958 X:126970431-126970453 CCTGTTGGTGGGATGGGGAAAGG + Intergenic
1197758933 X:130014499-130014521 CATCTTGGCGGGGTGCGGTGGGG - Exonic
1199060191 X:143346765-143346787 CCTGTTGGTGGGGTGGGGTGGGG - Intergenic
1199699897 X:150367255-150367277 CCTGTTTCTGGGGTGGGGGTGGG + Intronic
1201145924 Y:11065685-11065707 CTTCCTGGTGTGGTGGGGGTGGG - Intergenic
1201626310 Y:16018580-16018602 CCTGTTGCTGGGGTGGGGGAGGG - Intergenic
1201789535 Y:17824365-17824387 TTTCTTGGTGTGGTGGGGTATGG - Intergenic
1201812018 Y:18081623-18081645 TTTCTTGGTGTGGTGGGGTATGG + Intergenic
1202088444 Y:21163432-21163454 TCTCTAGGTGGGGTGGGGGGCGG - Intergenic
1202351187 Y:23994124-23994146 TTTCTTGGTGTGGTGGGGTATGG - Intergenic
1202519592 Y:25675995-25676017 TTTCTTGGTGTGGTGGGGTATGG + Intergenic