ID: 1158962376

View in Genome Browser
Species Human (GRCh38)
Location 18:62597240-62597262
Sequence GATCTCTCCCCTCTTAGTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158962376_1158962380 5 Left 1158962376 18:62597240-62597262 CCTGAACTAAGAGGGGAGAGATC No data
Right 1158962380 18:62597268-62597290 TCTTGTCTGCAAAACAGGCAGGG No data
1158962376_1158962379 4 Left 1158962376 18:62597240-62597262 CCTGAACTAAGAGGGGAGAGATC No data
Right 1158962379 18:62597267-62597289 CTCTTGTCTGCAAAACAGGCAGG No data
1158962376_1158962378 0 Left 1158962376 18:62597240-62597262 CCTGAACTAAGAGGGGAGAGATC No data
Right 1158962378 18:62597263-62597285 TGGACTCTTGTCTGCAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158962376 Original CRISPR GATCTCTCCCCTCTTAGTTC AGG (reversed) Intergenic
No off target data available for this crispr