ID: 1158965289

View in Genome Browser
Species Human (GRCh38)
Location 18:62617025-62617047
Sequence AGTGCCAGGCTCCTAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158965289_1158965298 26 Left 1158965289 18:62617025-62617047 CCAGGGGCTAGGAGCCTGGCACT No data
Right 1158965298 18:62617074-62617096 TGCGGAATATACTTTGAGGAGGG No data
1158965289_1158965295 22 Left 1158965289 18:62617025-62617047 CCAGGGGCTAGGAGCCTGGCACT No data
Right 1158965295 18:62617070-62617092 TTCCTGCGGAATATACTTTGAGG No data
1158965289_1158965291 8 Left 1158965289 18:62617025-62617047 CCAGGGGCTAGGAGCCTGGCACT No data
Right 1158965291 18:62617056-62617078 CACGCATGCGCCCCTTCCTGCGG No data
1158965289_1158965297 25 Left 1158965289 18:62617025-62617047 CCAGGGGCTAGGAGCCTGGCACT No data
Right 1158965297 18:62617073-62617095 CTGCGGAATATACTTTGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158965289 Original CRISPR AGTGCCAGGCTCCTAGCCCC TGG (reversed) Intergenic
No off target data available for this crispr