ID: 1158965298

View in Genome Browser
Species Human (GRCh38)
Location 18:62617074-62617096
Sequence TGCGGAATATACTTTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158965290_1158965298 12 Left 1158965290 18:62617039-62617061 CCTGGCACTGTACGAGACACGCA No data
Right 1158965298 18:62617074-62617096 TGCGGAATATACTTTGAGGAGGG No data
1158965289_1158965298 26 Left 1158965289 18:62617025-62617047 CCAGGGGCTAGGAGCCTGGCACT No data
Right 1158965298 18:62617074-62617096 TGCGGAATATACTTTGAGGAGGG No data
1158965288_1158965298 27 Left 1158965288 18:62617024-62617046 CCCAGGGGCTAGGAGCCTGGCAC No data
Right 1158965298 18:62617074-62617096 TGCGGAATATACTTTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158965298 Original CRISPR TGCGGAATATACTTTGAGGA GGG Intergenic
No off target data available for this crispr