ID: 1158970965

View in Genome Browser
Species Human (GRCh38)
Location 18:62665992-62666014
Sequence AGAGAACAGACCAAAACGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158970965_1158970968 14 Left 1158970965 18:62665992-62666014 CCAATCGTTTTGGTCTGTTCTCT No data
Right 1158970968 18:62666029-62666051 TATGGCACTTTGTTGAGCCTTGG No data
1158970965_1158970967 -4 Left 1158970965 18:62665992-62666014 CCAATCGTTTTGGTCTGTTCTCT No data
Right 1158970967 18:62666011-62666033 CTCTCACAGGAGTCACTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158970965 Original CRISPR AGAGAACAGACCAAAACGAT TGG (reversed) Intergenic
No off target data available for this crispr