ID: 1158970966

View in Genome Browser
Species Human (GRCh38)
Location 18:62665998-62666020
Sequence GTTTTGGTCTGTTCTCTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158970960_1158970966 29 Left 1158970960 18:62665946-62665968 CCTTCCGCAGTGCTCATCTGCCT No data
Right 1158970966 18:62665998-62666020 GTTTTGGTCTGTTCTCTCACAGG No data
1158970963_1158970966 -7 Left 1158970963 18:62665982-62666004 CCAGAGACTTCCAATCGTTTTGG No data
Right 1158970966 18:62665998-62666020 GTTTTGGTCTGTTCTCTCACAGG No data
1158970961_1158970966 25 Left 1158970961 18:62665950-62665972 CCGCAGTGCTCATCTGCCTTCGT No data
Right 1158970966 18:62665998-62666020 GTTTTGGTCTGTTCTCTCACAGG No data
1158970962_1158970966 9 Left 1158970962 18:62665966-62665988 CCTTCGTGTATCTAGACCAGAGA No data
Right 1158970966 18:62665998-62666020 GTTTTGGTCTGTTCTCTCACAGG No data
1158970959_1158970966 30 Left 1158970959 18:62665945-62665967 CCCTTCCGCAGTGCTCATCTGCC No data
Right 1158970966 18:62665998-62666020 GTTTTGGTCTGTTCTCTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158970966 Original CRISPR GTTTTGGTCTGTTCTCTCAC AGG Intergenic
No off target data available for this crispr