ID: 1158970967

View in Genome Browser
Species Human (GRCh38)
Location 18:62666011-62666033
Sequence CTCTCACAGGAGTCACTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158970963_1158970967 6 Left 1158970963 18:62665982-62666004 CCAGAGACTTCCAATCGTTTTGG No data
Right 1158970967 18:62666011-62666033 CTCTCACAGGAGTCACTCTATGG No data
1158970962_1158970967 22 Left 1158970962 18:62665966-62665988 CCTTCGTGTATCTAGACCAGAGA No data
Right 1158970967 18:62666011-62666033 CTCTCACAGGAGTCACTCTATGG No data
1158970965_1158970967 -4 Left 1158970965 18:62665992-62666014 CCAATCGTTTTGGTCTGTTCTCT No data
Right 1158970967 18:62666011-62666033 CTCTCACAGGAGTCACTCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158970967 Original CRISPR CTCTCACAGGAGTCACTCTA TGG Intergenic
No off target data available for this crispr