ID: 1158976479

View in Genome Browser
Species Human (GRCh38)
Location 18:62715641-62715663
Sequence CGCTGCCTCCGGAGCTGGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 315
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 275}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158976459_1158976479 21 Left 1158976459 18:62715597-62715619 CCGCCGCCGTCTCCCACCTCCGC 0: 1
1: 0
2: 5
3: 65
4: 658
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976467_1158976479 -9 Left 1158976467 18:62715627-62715649 CCTCCCTCTCCGCCCGCTGCCTC 0: 1
1: 0
2: 8
3: 97
4: 955
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976458_1158976479 28 Left 1158976458 18:62715590-62715612 CCGCGCGCCGCCGCCGTCTCCCA 0: 1
1: 0
2: 7
3: 40
4: 398
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976463_1158976479 8 Left 1158976463 18:62715610-62715632 CCACCTCCGCCTCATCGCCTCCC 0: 1
1: 0
2: 5
3: 125
4: 1189
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976465_1158976479 2 Left 1158976465 18:62715616-62715638 CCGCCTCATCGCCTCCCTCTCCG 0: 1
1: 0
2: 4
3: 36
4: 554
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976466_1158976479 -1 Left 1158976466 18:62715619-62715641 CCTCATCGCCTCCCTCTCCGCCC 0: 1
1: 0
2: 2
3: 78
4: 777
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976460_1158976479 18 Left 1158976460 18:62715600-62715622 CCGCCGTCTCCCACCTCCGCCTC 0: 1
1: 0
2: 23
3: 199
4: 1629
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976462_1158976479 9 Left 1158976462 18:62715609-62715631 CCCACCTCCGCCTCATCGCCTCC 0: 1
1: 0
2: 1
3: 22
4: 479
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976461_1158976479 15 Left 1158976461 18:62715603-62715625 CCGTCTCCCACCTCCGCCTCATC 0: 1
1: 0
2: 9
3: 138
4: 1419
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275
1158976464_1158976479 5 Left 1158976464 18:62715613-62715635 CCTCCGCCTCATCGCCTCCCTCT 0: 1
1: 0
2: 2
3: 58
4: 638
Right 1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG 0: 1
1: 0
2: 3
3: 36
4: 275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158976479 Original CRISPR CGCTGCCTCCGGAGCTGGGG GGG Exonic
900578058 1:3394060-3394082 TGCTGCCCTCGGAGCCGGGGTGG + Intronic
901921691 1:12541559-12541581 CTCTGTCCCCAGAGCTGGGGAGG + Intergenic
902720917 1:18303396-18303418 CTCAGCCTCCTCAGCTGGGGAGG - Intronic
903077889 1:20786592-20786614 CGCTGCTTCCGTCGCCGGGGCGG - Intronic
905343932 1:37298670-37298692 CGCCTCCCCAGGAGCTGGGGAGG + Intergenic
905862556 1:41361241-41361263 CGCCGCCTACGGAGCAGGGGCGG - Intergenic
905973180 1:42156081-42156103 CTCTTGCTCCGAAGCTGGGGAGG - Intergenic
906642746 1:47451155-47451177 AGCAGGCTCCAGAGCTGGGGAGG - Intergenic
906802201 1:48748197-48748219 AGATGCCTCCGGAGCTGGGTAGG + Intronic
912464730 1:109864059-109864081 CAGTGCATCAGGAGCTGGGGTGG - Intergenic
912711940 1:111956337-111956359 CTCGGGCTCCGGAACTGGGGAGG - Intronic
912713244 1:111964431-111964453 AGCTGCCTCAGGAGCTGTGGGGG - Intronic
912911001 1:113759181-113759203 GGCTGCCTCCGAAGCTGGGGCGG - Exonic
913235342 1:116775999-116776021 CTCTGCCTCCCTAGCTGAGGTGG - Intergenic
913591756 1:120335701-120335723 ACCTGCCTCAGGAGCTGAGGTGG - Intergenic
913651601 1:120919444-120919466 ACCTGCCTCAGGAGCTGGGGTGG + Intergenic
913961093 1:143338706-143338728 CCCTGCCTACGGTGCTGGGCAGG + Intergenic
914055447 1:144164279-144164301 CCCTGCCTACGGTGCTGGGCAGG + Intergenic
914123699 1:144802083-144802105 CCCTGCCTACGGTGCTGGGCAGG - Intergenic
914169505 1:145209626-145209648 ACCTGCCTCAGGAGCTGGGGTGG - Intergenic
914250515 1:145918291-145918313 CTCTGCCCCCAGAGCTGAGGAGG - Intronic
914524619 1:148453588-148453610 ACCTGCCTCAGGAGCTGAGGTGG - Intergenic
914599052 1:149182245-149182267 ACCTGCCTCAGGAGCTGAGGTGG + Intergenic
914641782 1:149613552-149613574 ACCTGCCTCAGGAGCTGGGGTGG + Intergenic
914879085 1:151533966-151533988 CGCAGCCTCTGGATCTGGGCAGG - Exonic
915141434 1:153770943-153770965 AGCTGCCCTCGGAGGTGGGGAGG + Intronic
915507744 1:156368201-156368223 GGCTGCCTCTGCAGCTGGAGCGG - Intergenic
915565918 1:156712613-156712635 CCCTGCCCTGGGAGCTGGGGAGG - Intergenic
917591363 1:176480257-176480279 GGGTGCCCCAGGAGCTGGGGAGG - Intronic
920522173 1:206635764-206635786 CGTTACCTCCGCTGCTGGGGCGG - Exonic
921039474 1:211416463-211416485 CCCTGCCTCCGGAGCGCCGGCGG + Intergenic
922743668 1:228031009-228031031 CACTGCCTCCAGGGCTGGTGGGG + Intronic
922968689 1:229715896-229715918 AGTTGCCTCCAGAGCTGGGAGGG - Intergenic
923545078 1:234918059-234918081 CGCTGCCTGCAGAGCAGGTGAGG + Intergenic
1062920051 10:1272858-1272880 CTCTGCCTCCAGAGCTTCGGGGG - Intronic
1066685396 10:37976566-37976588 CGGTGCCTCCGGGTCTGGGCTGG - Exonic
1067029538 10:42871107-42871129 CCCTGCCTACGGTGCTGGGCAGG + Intergenic
1067464557 10:46487925-46487947 GGCTGTCTCCAGGGCTGGGGAGG + Intergenic
1067564302 10:47325786-47325808 ATCTGCCTGCGGGGCTGGGGAGG + Exonic
1067622638 10:47896728-47896750 GGCTGTCTCCAGGGCTGGGGAGG - Intergenic
1069021375 10:63492144-63492166 AGCTGCTTCCGGGGCTGAGGCGG - Intergenic
1070305111 10:75235075-75235097 CGCAGCCCCCGGAGCTGGGACGG - Exonic
1073099224 10:100998268-100998290 AGCTGCCGCCTGAGCTGGGCAGG + Intronic
1075952521 10:126493936-126493958 CCCAGCCAGCGGAGCTGGGGAGG - Intronic
1076233245 10:128839288-128839310 CTCTGCCTCCTGGGCTGGGAGGG + Intergenic
1076670963 10:132120929-132120951 CGCTGCCCCCGCAGCTCGAGCGG - Intronic
1076696583 10:132250135-132250157 CGCTGGCTCCGCACCGGGGGAGG + Intronic
1076736657 10:132462095-132462117 AGCAGCCTCCGGAACCGGGGCGG + Intergenic
1076851211 10:133094179-133094201 CGCTGTCACTGGAGCTTGGGCGG + Intronic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1077429845 11:2510961-2510983 GGCTGCCCCAGGAGCTGGTGTGG - Intronic
1077446072 11:2591481-2591503 CCCTGAATCCGGAGCTGTGGGGG - Intronic
1077499205 11:2901730-2901752 AGCAGCCTCCGGGTCTGGGGAGG + Intronic
1077891120 11:6418944-6418966 CGCAGCCACCGGGGCTGGGCCGG + Intronic
1078145989 11:8722177-8722199 TGATGCCTGAGGAGCTGGGGTGG - Intronic
1078519657 11:12052884-12052906 CGCTGGCTCCTGGGCTGGGGAGG + Intergenic
1078729961 11:13964676-13964698 CGCTCCCTCCCGGGCTGGGCGGG - Intronic
1079190532 11:18273263-18273285 CGCTCCCTCCAGTGCTGGTGGGG - Intergenic
1080386076 11:31811863-31811885 CGCGGCCTCCGCAGCTGGAATGG - Intronic
1082180059 11:49106415-49106437 AGCTGCCCCCAGAGCTGAGGAGG + Intergenic
1083302241 11:61745302-61745324 CACTGACTCTGCAGCTGGGGTGG - Exonic
1084310382 11:68313017-68313039 CGCTGCGTCCCGGGCTGGCGAGG + Intronic
1084586397 11:70065252-70065274 GGCTGCCTCTGGAGGTGGCGAGG + Intergenic
1084598968 11:70133632-70133654 TGCAGCCTCCGGAGCAGGGGAGG - Intronic
1085056453 11:73406967-73406989 CACTGCCTCAGGAGCTGCTGAGG + Intronic
1085279346 11:75320045-75320067 GGCTGCCTCCTGCTCTGGGGGGG - Intronic
1087076222 11:94129103-94129125 CGCTGCCTCCGCCGCCGGCGGGG - Exonic
1088881407 11:113976087-113976109 CTCTCCCTACAGAGCTGGGGTGG + Intronic
1089046347 11:115504425-115504447 GGCTGCCTCCGGAGCCCGAGCGG + Intronic
1089174257 11:116536874-116536896 CGCTGCCACCGGAAATGGTGGGG + Intergenic
1090461557 11:126895723-126895745 CCCAGCCTCTGGAGCTGGTGGGG + Intronic
1091227659 11:133967337-133967359 CGCTGGGACCGGAGCAGGGGTGG - Intergenic
1091773979 12:3172322-3172344 GGCTGCCTCCAGAGCTGGGCGGG - Intronic
1094624210 12:32107169-32107191 CGCTGCCACCAGAGCCGGCGGGG + Intronic
1095891081 12:47235595-47235617 TTCTGCCGCCGGAGCTTGGGCGG - Exonic
1095986684 12:48004146-48004168 CGCGGGCTCCAGAGCTGGAGCGG + Intronic
1097145942 12:56939385-56939407 GGCAGCCTCCTAAGCTGGGGAGG - Intergenic
1097319884 12:58213469-58213491 AGCTGCCTCTAGAGGTGGGGAGG - Intergenic
1100315484 12:93441496-93441518 CGCGGCCTCCGGCGGGGGGGTGG + Intronic
1101716660 12:107318520-107318542 AGCTGCCCGCGGAGCTGCGGCGG + Exonic
1102783592 12:115585761-115585783 GTCTGCCCCGGGAGCTGGGGTGG - Intergenic
1105639875 13:22251570-22251592 CGTTGCCTCCGCACCTGGGATGG - Intergenic
1105871908 13:24512786-24512808 CCCTGCCCCCGGGGCTGGGCGGG + Exonic
1106512121 13:30421551-30421573 CGCTGCCCACAGGGCTGGGGCGG + Intergenic
1108648267 13:52451287-52451309 AGCTGCTTCCGAAGCTGAGGCGG + Intergenic
1111951857 13:94713808-94713830 CTCTTCCTCCGTAGCTGGAGAGG - Intergenic
1112290932 13:98143471-98143493 CGCAGCCGCCGGCGCTGTGGAGG + Intronic
1112494330 13:99893657-99893679 GGCTGCCTGTGGGGCTGGGGTGG - Exonic
1113508521 13:110832866-110832888 GGCAGCCCCGGGAGCTGGGGAGG + Intergenic
1113614315 13:111670166-111670188 CGCGGCCTCCGGAGCTGACAAGG - Intronic
1113619783 13:111755080-111755102 CGCGGCCTCCGGAGCTGACAAGG - Intergenic
1113796165 13:113059990-113060012 CTCCGCCTCCGGGGCTGGGAGGG - Intronic
1113798680 13:113075217-113075239 GGCTGGTTCCGCAGCTGGGGGGG - Intronic
1113894019 13:113752194-113752216 CGCTGGCTCCGTGGCTGAGGAGG + Intergenic
1113894075 13:113752434-113752456 CGCTGGCTCCGTGGCTGAGGAGG + Intergenic
1113913308 13:113854958-113854980 CGATGCCACCGGGGCTGGGGTGG - Intronic
1114233427 14:20803473-20803495 CGATGCCCCCAGAGCAGGGGTGG - Intergenic
1115120239 14:29928506-29928528 CGGTGCCTTAGGAGCTGGGGTGG - Intronic
1116777218 14:49194812-49194834 CTCTGCCTCCAGTGCTGAGGAGG - Intergenic
1116828328 14:49693361-49693383 CGCAGCCTCGGGAGCGGGTGTGG - Intronic
1118601239 14:67472646-67472668 TGCTGGCTAGGGAGCTGGGGTGG + Exonic
1120088944 14:80308841-80308863 TGCTGCCTCCGGAGCTTTTGAGG + Intronic
1120985456 14:90330963-90330985 CGCTGCATCCTGCCCTGGGGTGG - Intronic
1121320926 14:92991228-92991250 CTCTGCCTCTGCAGCTGGTGGGG + Intronic
1121716357 14:96078792-96078814 AGCGGCCTCCTGAGCTGGGGCGG - Intronic
1124659929 15:31539021-31539043 CTCTGCCACCGGTTCTGGGGAGG + Intronic
1126502918 15:49366758-49366780 CGCTGCCTCCGTGGCGGGGGCGG + Intronic
1127165786 15:56243843-56243865 GGCTGCCTCCGGGGCTGGCAGGG - Intergenic
1127515426 15:59689085-59689107 CGGTGGCTCCGGAGCTGGACTGG - Intronic
1128766989 15:70257325-70257347 CCCTCCCTCCTGAGCTGTGGTGG - Intergenic
1128983281 15:72201405-72201427 CTGTGTCTCAGGAGCTGGGGAGG + Intronic
1129653266 15:77506402-77506424 CACTGCCTCCGGAGCAGGCAAGG - Intergenic
1131215111 15:90529919-90529941 CGCTGGCTCCGGGGCCGCGGCGG + Intronic
1132154342 15:99485243-99485265 AGCTGCCTCGTGAGCTGAGGAGG - Intergenic
1132499749 16:280181-280203 AGCTCCCTCAGGAGCGGGGGAGG + Intronic
1132747420 16:1442838-1442860 GGCTGGCTCCGGAGCTTGCGTGG - Intronic
1132814668 16:1820038-1820060 GGCTGCCTGCTGAGCTGAGGGGG + Intronic
1132814673 16:1820059-1820081 GGCTGCCTGCTGAGCTGAGGGGG + Intronic
1132847032 16:2005426-2005448 TGCTGCTTCGGGAGCTGTGGTGG - Intronic
1133020056 16:2963353-2963375 CGCTGCCCCCAGGGCTTGGGGGG - Intergenic
1134615747 16:15650191-15650213 CGCAGGCTCCGGGGCGGGGGCGG + Intronic
1136682683 16:31977149-31977171 CCCAGCCTCAGGACCTGGGGAGG + Intergenic
1136782943 16:32918317-32918339 CCCAGCCTCAGGACCTGGGGAGG + Intergenic
1136886851 16:33935533-33935555 CCCAGCCTCAGGACCTGGGGAGG - Intergenic
1137768759 16:50997714-50997736 CGCTGGCTACGGAGCAGGGCTGG - Intergenic
1138251032 16:55502070-55502092 TGCTGCCGCCGGAACTGAGGTGG + Intronic
1139340183 16:66263371-66263393 CTCAGCCTCCAGAGATGGGGGGG + Intergenic
1141559099 16:84854783-84854805 AGCTGCCTCCATAGCTGGGTGGG - Exonic
1142226468 16:88880138-88880160 CACTGCCCACGCAGCTGGGGAGG + Intronic
1203085592 16_KI270728v1_random:1182301-1182323 CCCAGCCTCAGGACCTGGGGAGG + Intergenic
1143026531 17:3944801-3944823 TGCCGCCTGCGGAGCCGGGGCGG + Exonic
1143448808 17:7023679-7023701 CGCTCCCTCCGGGGCGGCGGGGG - Exonic
1144642964 17:16948818-16948840 CGCTGTCTCCTGAGCTCTGGTGG + Exonic
1144788607 17:17845349-17845371 CGCTGGCGCTGGAGCTGGAGCGG + Intronic
1145041340 17:19580054-19580076 CGCTGCCCCCGGACCTGCGGGGG + Intergenic
1145210741 17:21011349-21011371 GGTTGCCTCTGGAGCTGGGTGGG - Intronic
1145240735 17:21239890-21239912 CCCTCCCTCAGTAGCTGGGGCGG + Exonic
1146373841 17:32281352-32281374 GGCTGCCTCCCAGGCTGGGGAGG - Intronic
1147143206 17:38470491-38470513 CCCAGCCTCAGGACCTGGGGAGG + Intronic
1147184394 17:38705601-38705623 AGCTCCCTCCGGGGCTGGGGCGG - Exonic
1147447504 17:40483590-40483612 CGCTGGCCCCGGGGGTGGGGAGG + Intronic
1148554534 17:48570440-48570462 GGCTGCCTCCAGAGCTGCTGAGG - Intronic
1148695550 17:49556111-49556133 GGCTGCTTCCAGAGCTGAGGGGG - Intergenic
1148697537 17:49570241-49570263 CGCCCCCTGCGGAGCTGGCGTGG + Intergenic
1148747726 17:49927800-49927822 CGCTGGCTCGGGAGCCAGGGTGG - Intergenic
1150123379 17:62621267-62621289 CCCCGCCTCCCCAGCTGGGGAGG + Intergenic
1150416907 17:64995405-64995427 CGCAGCCTCCCGAGGAGGGGAGG + Intergenic
1150632417 17:66889346-66889368 GGCTGCATGCAGAGCTGGGGTGG + Intergenic
1151890142 17:76946906-76946928 CGCTCCCTCGGGGGCTGAGGTGG - Intronic
1151928012 17:77213029-77213051 TCCTGCCTCCGTAGGTGGGGTGG + Intronic
1152111867 17:78361039-78361061 GGCTGTCTCCGGAGCTGGAAAGG + Intergenic
1152581668 17:81168059-81168081 CACTCCCTCCTGAGCTGGGGAGG - Intergenic
1154132766 18:11750979-11751001 CGCCGCCTGGGGAGCCGGGGCGG + Intronic
1154218417 18:12432306-12432328 CGCTGCCTTCAGGACTGGGGAGG - Intergenic
1155199413 18:23503831-23503853 CGCCGCCTCCCGCGCTGGGACGG - Intronic
1156149285 18:34223664-34223686 GGCTGCGTCCGGGGCTGGGCAGG + Intronic
1157176596 18:45457857-45457879 AGCTACCCCCGGGGCTGGGGCGG + Intronic
1157662709 18:49460134-49460156 CGGTGCTTCCGGAGATGGGGCGG - Intronic
1158478616 18:57802442-57802464 CCCTGCCACAGGAGCTGGGGAGG + Intronic
1158497014 18:57965299-57965321 GGCAGCCTCCGGAGCCAGGGTGG + Intergenic
1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG + Exonic
1160373065 18:78390518-78390540 ATCTGACTCCGGACCTGGGGAGG + Intergenic
1160715029 19:572685-572707 CGGAGCCTCCGGGGCTGGTGAGG + Exonic
1160745292 19:708684-708706 CTCTGGCCCAGGAGCTGGGGAGG + Intergenic
1161077708 19:2294398-2294420 TTCCGCCTCCGGAGCTGGGAAGG + Intronic
1161400403 19:4064673-4064695 AGCTGCCTCCGGAGAGGGCGTGG - Intronic
1161400650 19:4065349-4065371 CGCTGCGGCCGGGGCGGGGGAGG - Intronic
1161455368 19:4367161-4367183 CGCTGCCTGCAGAGCAGGGTGGG + Intronic
1161723034 19:5914206-5914228 AGGTGCCTCTGGAGATGGGGTGG - Exonic
1161849759 19:6732230-6732252 AGCAGCCTCCGGAGCAGGGCGGG - Intronic
1162144443 19:8605253-8605275 CGCTGCCTCCGGGGAGGAGGTGG + Exonic
1162445072 19:10718030-10718052 CGCAGCCCCCGGGGCCGGGGCGG + Intergenic
1162799936 19:13104719-13104741 CGCTGGCTCCGGCTCTGGGGTGG + Intergenic
1163646913 19:18494808-18494830 CTCTGCCTTCAGAGCTTGGGAGG + Intronic
1163778881 19:19235062-19235084 AGCTGCCCCCATAGCTGGGGAGG - Exonic
1164483176 19:28632250-28632272 GGCAGCCTGCGGAGCTGGGACGG + Intergenic
1165326917 19:35119264-35119286 CCCTGCCTGGGGAGCAGGGGAGG + Intronic
1165434098 19:35787366-35787388 CGCTGTCTCTGGAGGTGGGCGGG + Exonic
1165758075 19:38305494-38305516 CGCAGCGTCCGGATCTGGGTGGG + Exonic
1166230684 19:41424519-41424541 TGCTGCTTGCGGAGCTGGGCGGG - Exonic
1202694930 1_KI270712v1_random:116956-116978 CCCTGCCTACGGTGCTGGGCAGG + Intergenic
925386493 2:3465468-3465490 CGCTGACGCAGGAGCTGGCGGGG - Intronic
926313317 2:11691203-11691225 CTGTGCCCCCGGACCTGGGGAGG - Intronic
926696110 2:15771071-15771093 CGCTTCCTGCTGGGCTGGGGTGG + Intergenic
927893585 2:26767463-26767485 TGCTGCCTGCTGTGCTGGGGCGG + Intronic
928097286 2:28412462-28412484 GACCCCCTCCGGAGCTGGGGAGG - Exonic
929240713 2:39650446-39650468 CTCTGCCTCCTGAGCTGGTGTGG - Intergenic
930694560 2:54397922-54397944 AGCTACTTCTGGAGCTGGGGTGG + Intergenic
931429074 2:62195642-62195664 CGCCCCCTCCAGTGCTGGGGCGG - Intergenic
933876243 2:86623786-86623808 CGCGGTCTCCGGAGGTGGCGGGG - Exonic
933897514 2:86825070-86825092 AGCTGCCTTAGGAGCTGTGGAGG - Intronic
933997616 2:87681287-87681309 TGCTGCCTGCTGAGCTGGGAGGG + Intergenic
934553512 2:95276026-95276048 CGCTGCCACCGGCGCTGCGGGGG + Exonic
934713739 2:96531472-96531494 CAGTGACTCCGGAGCTGAGGTGG - Intergenic
934993307 2:98936304-98936326 CGCCGCCTCCGCAGCTGGCCCGG + Intergenic
935414722 2:102803350-102803372 CACTGCCTCCAGAGCAGGGAAGG - Intronic
936296236 2:111269583-111269605 TGCTGCCTGCTGAGCTGGGAGGG - Intergenic
942455670 2:176136740-176136762 CGCCACCTCCGGAGCTGGTGGGG + Intergenic
942987576 2:182161460-182161482 CACTGCCTCTGGAGGTGGAGAGG - Intronic
943179552 2:184525136-184525158 CCCTGCCTCCTGAGTTGGAGGGG - Intergenic
943658734 2:190535003-190535025 CGCTGCCCTCGGCGCAGGGGTGG + Intergenic
944414932 2:199471122-199471144 CAGGGCATCCGGAGCTGGGGAGG + Intronic
948624563 2:239261130-239261152 CTCAGCCTCCTGAGATGGGGTGG + Intronic
948953793 2:241272309-241272331 CGCCCCCGCCGGAGCGGGGGAGG + Intronic
1168784540 20:526602-526624 CCCTGCCTCTGCAGGTGGGGGGG + Intronic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1170304947 20:14928193-14928215 AGCTGCCTCTGGAGCTGATGGGG - Intronic
1171413962 20:24965156-24965178 CCCTGTCTCCAGAGCTGGGGAGG - Intronic
1172013843 20:31861662-31861684 AGCTGCCGGCGAAGCTGGGGTGG + Exonic
1172213567 20:33217688-33217710 TGCTGCCTACGGGGCTGGGGAGG + Intronic
1176030546 20:63009201-63009223 CGCCGCCTCTGAAGCTGGCGGGG - Intergenic
1176546626 21:8205136-8205158 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1176554520 21:8249327-8249349 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1176565577 21:8388183-8388205 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1176573442 21:8432351-8432373 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1178582455 21:33848082-33848104 CGCTGGCTGCGGAGCTGGGAAGG - Intronic
1179884175 21:44306426-44306448 TGGTGCCTCCTGAGATGGGGAGG + Intronic
1180259770 21:46661433-46661455 CGCCGCGTCTGGAGATGGGGCGG + Intronic
1183382458 22:37496990-37497012 CCCTGCCTCCTGAGCTGGGGGGG - Intronic
1185054051 22:48568863-48568885 CACAGCCTCTGGGGCTGGGGTGG + Intronic
1185359915 22:50399853-50399875 TGCTGCCTCCAGCCCTGGGGTGG - Intronic
1203251491 22_KI270733v1_random:121402-121424 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1203259541 22_KI270733v1_random:166484-166506 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
950099404 3:10347804-10347826 CCCTGCCTCCAGTCCTGGGGTGG + Intronic
950452566 3:13073420-13073442 CGCAGCATCCGGAGAAGGGGCGG + Intergenic
952431900 3:33231920-33231942 GGCTGCCTTCGGGGCTGTGGAGG + Intergenic
953561241 3:43995361-43995383 TGCTGTGTGCGGAGCTGGGGCGG - Intergenic
953989871 3:47475813-47475835 CGCCGCCGCCGCAGCTTGGGAGG - Exonic
955818796 3:62874852-62874874 CGCCGGCGCCGGAGCCGGGGTGG - Exonic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
961340382 3:126213318-126213340 CGCGTCCTCTGGGGCTGGGGCGG - Intergenic
961550419 3:127667765-127667787 CGCAGCCCCTGGAGCTGGGCTGG - Intronic
961635847 3:128331793-128331815 TGCAGCCTCAGGTGCTGGGGAGG + Intronic
967232469 3:187353212-187353234 CGCTGCCTCCAGGGCTGAGGTGG + Intergenic
968756084 4:2417353-2417375 CGCTGCAGCCGGAGCAGGGCCGG - Intronic
968765843 4:2468768-2468790 AGCTGCCTCCGGAGCCGAGCAGG - Intronic
968926996 4:3554509-3554531 CTCTGCCTCCGGAGCAGCTGGGG + Intergenic
968961095 4:3744089-3744111 GGCTGCCTTAAGAGCTGGGGAGG + Intergenic
968962848 4:3753909-3753931 CCCTGCCTTCGTAGCTGGGAGGG - Intergenic
969261337 4:6036051-6036073 CGCTGCAGCAGGAGCCGGGGCGG - Exonic
969573925 4:8025532-8025554 GGCTGTCTCGGGAGCTGAGGAGG + Intronic
973993257 4:56432753-56432775 CGCTGTCTCCCAGGCTGGGGTGG - Intronic
977574011 4:98658419-98658441 CGAGGCCGCCGGAGCCGGGGTGG + Exonic
979547163 4:121951556-121951578 CGCCGCCGCCGGGGCTGGAGGGG - Exonic
981434954 4:144709517-144709539 CTCTGCCACCAGAGGTGGGGAGG - Intronic
983323690 4:166227089-166227111 CCCTGCCTCCTGAGTTGGCGGGG + Intergenic
984973368 4:185209754-185209776 CCCTGCCTCCGGAGCGCCGGCGG + Intronic
985580664 5:693750-693772 CGCGGCCTCCTGGGGTGGGGTGG + Intergenic
985595288 5:785082-785104 CGCGGCCTCCTGGGGTGGGGTGG + Intergenic
988816156 5:34837051-34837073 CTCTACCTCCGGATCAGGGGAGG + Intergenic
988934159 5:36066199-36066221 AGCTGCATCCGGAGCCAGGGTGG - Intronic
989983863 5:50673145-50673167 ACCTGCCTCAGGAGCTGGGGTGG + Intronic
992528076 5:77630558-77630580 CTCTGCCGCCGGCGCTGGGCAGG - Exonic
993900967 5:93584264-93584286 AGCTGCCGCCGGAGCTGCTGCGG - Exonic
993904065 5:93604154-93604176 CGCGGCCGCCGTGGCTGGGGCGG - Intergenic
997470742 5:134115485-134115507 TGCCGCCTCCTGAGCTGCGGTGG - Intronic
997811260 5:136972903-136972925 AGCTACCTCAGAAGCTGGGGTGG - Intergenic
998169611 5:139864807-139864829 GGCAGCCTTCGGAGCAGGGGAGG + Intronic
998538771 5:142959544-142959566 CGCTGCCTCCAGAGGCTGGGAGG - Intronic
999478631 5:151924836-151924858 GGCTCCCTGCGGCGCTGGGGAGG + Exonic
1001312694 5:170622815-170622837 CCCAGCCTCCAGAGCTGGGAAGG + Intronic
1002182122 5:177436064-177436086 CACCACCTCCGGAGCTGGGCGGG - Exonic
1003267384 6:4577870-4577892 AGCTGCCTCTGGAGCTGGGGTGG - Intergenic
1003824048 6:9932525-9932547 CTCAGCATCCGGAGTTGGGGTGG + Intronic
1004183938 6:13405999-13406021 TGCTGCCTCAGAAGTTGGGGTGG - Intronic
1006299290 6:33185295-33185317 TGCTGCCTCTGGTCCTGGGGCGG + Intronic
1010203013 6:73299430-73299452 CGCTGACTGCGGAGCTGGGAGGG + Intronic
1010926599 6:81752597-81752619 CGCTGCCACCCCAGCTGCGGTGG + Exonic
1014045323 6:116877509-116877531 TGCCGCATCCGGAGCTGGGAAGG + Intronic
1018252218 6:161882421-161882443 AGCTGCCGCCTGGGCTGGGGAGG - Intronic
1019994895 7:4717631-4717653 CCCTGCCTCTGGGGCTAGGGTGG - Intronic
1022224372 7:28347904-28347926 CCCTCCCTCCTGAGCTGGGGAGG + Intronic
1022339744 7:29456830-29456852 GGCTGCCTCCTGGGCTGGGGAGG + Intronic
1023875384 7:44283771-44283793 CTCTGCCCCCAGAGCTGGAGGGG - Intronic
1023875808 7:44285764-44285786 GGCTGCCTCAGGAGATGTGGGGG + Intronic
1024117564 7:46208416-46208438 CCCTGCCTCTGCAGCTGGGCAGG - Intergenic
1027831960 7:83188477-83188499 GGCTGCATCCGGGGCTGGCGTGG + Intergenic
1029707196 7:102282290-102282312 CGCCACCTCCACAGCTGGGGAGG - Intronic
1033311164 7:140263015-140263037 CTGTGCCTCAGAAGCTGGGGAGG - Intergenic
1033462044 7:141555521-141555543 CTCTGCCTGCTGACCTGGGGAGG + Exonic
1033732739 7:144195387-144195409 CGCAGGCTCCGGAAATGGGGGGG - Intronic
1033743590 7:144293967-144293989 CGCAGGCTCCGGAAATGGGGGGG - Intergenic
1033750312 7:144355630-144355652 CGCAGGCTCCGGAAATGGGGGGG + Intronic
1034522718 7:151632570-151632592 CGCGGCCGCCGGTGCTGGGAAGG - Intronic
1035159279 7:156939299-156939321 CTCTGCCTCAGGGTCTGGGGAGG + Intergenic
1035645203 8:1213814-1213836 CGCTGCCTCCTGACCTGGTCTGG + Intergenic
1035764219 8:2092531-2092553 GGCTGACTCCAGGGCTGGGGAGG - Intronic
1036733385 8:11285084-11285106 GGCTCCCTGCGGAGCTGGGGTGG - Intronic
1037825370 8:22157283-22157305 CGCAGCCTCTGGAGCTGGAGTGG + Intronic
1039554754 8:38467948-38467970 CGGCGCCCCCGGATCTGGGGCGG - Intronic
1040413963 8:47181224-47181246 TGCTGGCTAGGGAGCTGGGGTGG - Intergenic
1044725922 8:95194143-95194165 GGCTGCCTCCAGAGCAGGGCAGG - Intergenic
1044934409 8:97279004-97279026 GGCTGCCTCCGGGACTGTGGGGG - Intergenic
1044990629 8:97792365-97792387 AGCTGCCTGGGGAGCTGGGGTGG - Intronic
1049102463 8:140589393-140589415 AGCTGCCACCTGAGCTTGGGTGG + Intronic
1049443507 8:142619695-142619717 CGCAGCCCCAGGGGCTGGGGAGG - Intergenic
1049610363 8:143552440-143552462 CACTCCTTCCAGAGCTGGGGAGG + Intergenic
1049658766 8:143810425-143810447 CGCTGACCCGGGAGCTGTGGTGG - Intronic
1049672114 8:143874573-143874595 CACTTCCTCCGGAGCTCGAGGGG - Intronic
1050324986 9:4490287-4490309 CGCTGCGGCAGGAGCTGGGGCGG - Intergenic
1051265789 9:15307239-15307261 CGCTCCCTCCGGGTCTCGGGCGG + Exonic
1053181240 9:35972221-35972243 CGCTGCCTGCAGTGCTGGGGTGG + Intergenic
1054463061 9:65476275-65476297 CTCTGCCTCCGGAGCAGCTGGGG - Intergenic
1055527601 9:77151082-77151104 TGCTGGCTCTGAAGCTGGGGTGG - Intergenic
1057311509 9:93946066-93946088 AGCTGCCGCGGGGGCTGGGGCGG + Intergenic
1060819921 9:126655328-126655350 CACTGCCTCCAGTGCTGGAGGGG - Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062346891 9:136119115-136119137 CGCTGCTGCCGTCGCTGGGGTGG + Intergenic
1203467893 Un_GL000220v1:104553-104575 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1203475714 Un_GL000220v1:148525-148547 CTCGGCTTCCGGAGCTGCGGTGG + Intergenic
1187372967 X:18725745-18725767 GGCTGCTTCCCAAGCTGGGGTGG + Intronic
1189332558 X:40152667-40152689 CGCTGGCTCCGGGGCCCGGGTGG - Intronic
1194870517 X:99125874-99125896 AGCTGCCTCTGAAGGTGGGGAGG - Intergenic
1200149112 X:153942827-153942849 GGATGCCTGGGGAGCTGGGGTGG - Intronic