ID: 1158976565

View in Genome Browser
Species Human (GRCh38)
Location 18:62715927-62715949
Sequence CCGCTGCCGGGCAGAGCGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 203}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158976552_1158976565 0 Left 1158976552 18:62715904-62715926 CCCCAGGCGAGGCGCCGCCGGGG 0: 1
1: 0
2: 1
3: 12
4: 157
Right 1158976565 18:62715927-62715949 CCGCTGCCGGGCAGAGCGGGGGG 0: 1
1: 0
2: 1
3: 22
4: 203
1158976554_1158976565 -1 Left 1158976554 18:62715905-62715927 CCCAGGCGAGGCGCCGCCGGGGC 0: 1
1: 0
2: 2
3: 7
4: 199
Right 1158976565 18:62715927-62715949 CCGCTGCCGGGCAGAGCGGGGGG 0: 1
1: 0
2: 1
3: 22
4: 203
1158976555_1158976565 -2 Left 1158976555 18:62715906-62715928 CCAGGCGAGGCGCCGCCGGGGCC 0: 1
1: 0
2: 2
3: 29
4: 271
Right 1158976565 18:62715927-62715949 CCGCTGCCGGGCAGAGCGGGGGG 0: 1
1: 0
2: 1
3: 22
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158976565 Original CRISPR CCGCTGCCGGGCAGAGCGGG GGG Exonic
900349488 1:2227961-2227983 CCGGCGCGGGGCGGAGCGGGCGG + Intergenic
903568572 1:24287004-24287026 CCGCTCCCTGGCAGTGCGTGTGG - Intergenic
904256871 1:29259850-29259872 CCGCTGCAGGGAAGAGAGTGAGG - Exonic
904847468 1:33430917-33430939 CGGCTGACGGGCAGCGCGCGGGG - Intronic
910760814 1:90729606-90729628 CCGCGGCCCTGCAGCGCGGGCGG - Intergenic
914265838 1:146037824-146037846 CCGCCGCCCAGCGGAGCGGGTGG + Intergenic
915320161 1:155051951-155051973 CCAGTGCCTGGCCGAGCGGGAGG + Intronic
915598278 1:156907590-156907612 CAGCTGCAGGACAGAGTGGGTGG - Exonic
919807293 1:201387715-201387737 CTGCTGCCGGGCAAGGCTGGGGG + Intronic
919807550 1:201389288-201389310 CCTCTGCCGGGCAAGGCTGGGGG + Exonic
920224696 1:204429992-204430014 CCGCTCCCGGGGAGAGGCGGTGG - Exonic
920660588 1:207911153-207911175 CCTCTCCCGGGCGGAGGGGGCGG - Exonic
921324752 1:213979688-213979710 GCGGTGCTGGGGAGAGCGGGAGG - Intergenic
922460396 1:225810749-225810771 TCTCTGGCGGGCAGAGTGGGGGG + Intronic
923986445 1:239387249-239387271 CAGGCGCTGGGCAGAGCGGGTGG + Intronic
924739884 1:246788944-246788966 CCGGTGCCGAGCAAAGCGTGGGG + Intergenic
1063944674 10:11165254-11165276 CTGCTGTCGAGCAGAGCCGGGGG - Intronic
1065025229 10:21534534-21534556 GGGCTGCCGGGCCGGGCGGGGGG + Intronic
1065140483 10:22714492-22714514 AGTCTGCCGGGCCGAGCGGGCGG - Exonic
1067030293 10:42875195-42875217 CCGCAGGCAGGCAGAGCAGGCGG + Intergenic
1067711865 10:48656365-48656387 CCCCTGCCGGGCAGCGCGGGTGG + Intergenic
1070570650 10:77637751-77637773 CCGCCGCCGCGGAGCGCGGGAGG + Intronic
1070768354 10:79069035-79069057 CGGGCGCCGGGGAGAGCGGGCGG + Exonic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1072673119 10:97446208-97446230 CCGCTGCCTGGCGCTGCGGGCGG + Exonic
1073460173 10:103661505-103661527 CCCCTGCCGGCCCGAGAGGGAGG - Intronic
1077009998 11:375441-375463 CCACTGCGGGGCAGAGAGGGTGG - Exonic
1077051144 11:567657-567679 CCGCTGCGGGAGACAGCGGGTGG - Intergenic
1077148045 11:1054601-1054623 CAGCTGCGGGCCAGGGCGGGGGG - Intergenic
1077453861 11:2666263-2666285 CCGAGGCTGGGCAGAGGGGGTGG + Intronic
1079126005 11:17719349-17719371 CCCCTACCGGGCAGGGAGGGAGG - Intergenic
1082834236 11:57640017-57640039 ACTCTGCCGGGGAGAGCGGGAGG + Intergenic
1083241569 11:61392542-61392564 CCGCGGGCGGGCAGAGGGGCCGG + Exonic
1083752218 11:64766935-64766957 CTGCTGCTGGGCGGAGGGGGTGG + Exonic
1084102389 11:66958265-66958287 CCGCGGCGGGTCGGAGCGGGTGG - Intronic
1084547613 11:69822236-69822258 CCCCTGCCGGGCAGATGTGGAGG - Intergenic
1085395813 11:76206616-76206638 CCCCGGCCGGGCGGAGCGGGAGG - Intronic
1089177881 11:116561391-116561413 CAGGTGCCTGGCAGAGCAGGTGG + Intergenic
1089349946 11:117816565-117816587 GCCCTGCCGAGCAGAGCGGAGGG + Intronic
1091433072 12:453117-453139 CCTCTCCAGGGCCGAGCGGGGGG + Intergenic
1091433094 12:453188-453210 CCTCTCCGGGGCCGAGCGGGGGG + Intergenic
1091433116 12:453259-453281 CCTCTCCGGGGCCGAGCGGGGGG + Intergenic
1091433138 12:453330-453352 CCTCTCCGGGGCCGAGCGGGGGG + Intergenic
1091433160 12:453401-453423 CCTCTCCGGGGCCGAGCGGGGGG + Intergenic
1091433182 12:453472-453494 CCTCTCCGGGGCCGAGCGGGGGG + Intergenic
1092022041 12:5210830-5210852 CTGTTGCCGTGCAGAGCAGGAGG - Intergenic
1092196428 12:6552303-6552325 TCCCTGCTGGGCAGAGCAGGAGG + Intronic
1100391455 12:94148936-94148958 CCGCCCCCGGGCAGGGCGCGCGG - Exonic
1101900281 12:108786918-108786940 CTGCTGCTGGGAAGAGCTGGAGG + Exonic
1102466057 12:113131425-113131447 CCCCTGCAGGGGAGAGCTGGGGG - Intronic
1102549853 12:113683873-113683895 CCTCAGCCGGGAAGAGCTGGAGG - Intergenic
1105004148 12:132710775-132710797 CCGCTTCCGGGCGGCGGGGGCGG - Intergenic
1113898966 13:113785375-113785397 ACACTGCAGGGCAGAGAGGGAGG + Intronic
1118360689 14:65054074-65054096 CCACTGCTGGGCAGGGCTGGAGG + Intronic
1119232669 14:72993167-72993189 CGGGTGCCGGGGAGAACGGGTGG + Exonic
1122830828 14:104394797-104394819 CCGCAGCCAGGCAGAACGTGAGG + Intergenic
1202917955 14_KI270723v1_random:2800-2822 GTGCAGCTGGGCAGAGCGGGCGG - Intergenic
1202926668 14_KI270724v1_random:31783-31805 GAGCAGCTGGGCAGAGCGGGCGG + Intergenic
1123474805 15:20582110-20582132 CCGCCGCCGGGCAGACCGCCTGG + Intergenic
1123643206 15:22418247-22418269 CCGCCGCCGGGCAGACCGCCTGG - Intergenic
1124661508 15:31554135-31554157 CCGCTGGAGGGCAGGGAGGGAGG - Intronic
1127207222 15:56733417-56733439 CTGCTGCAGCGCAGGGCGGGCGG + Intronic
1129612350 15:77070865-77070887 GCGGGGCCGGGCAGAGCGAGGGG - Intronic
1132530042 16:442508-442530 CGGCAGCCCGGCTGAGCGGGAGG - Intronic
1132701846 16:1225335-1225357 CTGCTGTCAGGCAGGGCGGGAGG + Intergenic
1132759420 16:1501556-1501578 CCGCTGCCGGGATGGGAGGGGGG + Intronic
1133284821 16:4685811-4685833 CCGCTGCCTGGCGGGGTGGGCGG + Intronic
1139664784 16:68448049-68448071 CCGTCGCCAGGCACAGCGGGAGG + Intronic
1141635327 16:85311278-85311300 CCGCTGCCTGGCAGAGAGGATGG - Intergenic
1142989886 17:3723578-3723600 CCCCTGCCGGCCAGTGCCGGGGG - Intronic
1143022602 17:3924601-3924623 CCTCTGCGTGGCAGACCGGGCGG + Intronic
1143635753 17:8162992-8163014 CCGCATCCGGGCACTGCGGGCGG + Intronic
1145235926 17:21208410-21208432 CCACTGCCAAGAAGAGCGGGAGG + Intronic
1147184251 17:38705190-38705212 CCGCGGCCGGGCAGGGGGGCCGG + Intergenic
1148534797 17:48430231-48430253 CCGCGGCCGGGCTGGGCGGGCGG - Intronic
1151729804 17:75904594-75904616 CCGGCGCCGAGCAGAGCAGGAGG - Exonic
1152001105 17:77645814-77645836 CCACTGCTGGGCAGGGGGGGTGG - Intergenic
1152253767 17:79225700-79225722 GGGCTGCTGGGCAGAGCCGGAGG + Intronic
1152433012 17:80260247-80260269 CTGCGGCCGCGCAGAGCCGGCGG - Intergenic
1152546820 17:81004320-81004342 CCGCAGCCAGGAAGGGCGGGGGG - Intronic
1152702306 17:81825165-81825187 CCCCTGGTGGGCAGAGGGGGTGG + Exonic
1155218403 18:23662854-23662876 CTGCTGCCGGGCCGGGCGGCGGG - Exonic
1156275611 18:35581131-35581153 CGGCTCCCGGGCCGAGCGCGGGG - Intronic
1158976565 18:62715927-62715949 CCGCTGCCGGGCAGAGCGGGGGG + Exonic
1160685604 19:435134-435156 CTGCTGCCGGGCGGGGCCGGAGG - Intronic
1161108749 19:2456842-2456864 CCGCTGCCCGGCCGCGCGGGCGG - Exonic
1161266650 19:3367379-3367401 CCGCCGCCGGGAGGAGCGGGAGG + Intronic
1161973617 19:7596846-7596868 CCGCAGCCGGGAGGAGCGGGGGG - Intronic
1162456639 19:10788909-10788931 CTACTGCCTGGCAGAGGGGGTGG - Intronic
1164998214 19:32739160-32739182 CCACTGACTGGCAGAGTGGGTGG + Intronic
1165745992 19:38229662-38229684 GCGCTGGGCGGCAGAGCGGGCGG - Intronic
1166197971 19:41219230-41219252 CGGCTGCTGGGCAGAGCCGGTGG + Exonic
1167622654 19:50568036-50568058 CCGCTGCGGGGAGGCGCGGGGGG + Intronic
1168528434 19:57106654-57106676 CCGCTGCCGCACAAGGCGGGCGG - Intergenic
1168671874 19:58246763-58246785 CCTGTGCAGGGCAGAGCAGGAGG + Exonic
930872941 2:56185355-56185377 CCACTGCCAGGGAGAGCGGCTGG + Intronic
931614593 2:64143835-64143857 CCGCTCCCGGGCGGAGGGGGAGG + Intronic
931681267 2:64751398-64751420 CCGCAGCCGGCCAGAGGGGAAGG + Intergenic
932406420 2:71515690-71515712 CCGCTGCAGGGCAGACCAAGCGG + Exonic
932801436 2:74745768-74745790 CCACTGCCGGGGAGAACAGGTGG + Intergenic
934052872 2:88224980-88225002 CCTCTGCAGGGCAGTGAGGGAGG - Intergenic
934105550 2:88691747-88691769 CCGCTGCCCGGGAGGGCCGGGGG + Exonic
934119825 2:88828329-88828351 CCGCTGTCAGGGAGAGTGGGAGG + Intergenic
936090524 2:109498936-109498958 GCGCGGCAGGGCAGAGCTGGTGG + Intronic
936163298 2:110100867-110100889 CCGCTGTCAGGGAGAGTGGGAGG + Intronic
937942100 2:127293981-127294003 CAGCTCCGAGGCAGAGCGGGGGG + Intronic
938407365 2:131039944-131039966 CCGCTGCGGCGCAGGGCGCGGGG + Intronic
940529837 2:154867524-154867546 TCTCTGGCGGGCAGAGTGGGGGG - Intergenic
940530868 2:154874360-154874382 TCTCTGGCGGGCAGAGTGGGGGG - Intergenic
941517238 2:166494444-166494466 CAGCTGCCGGGAAGGGAGGGAGG + Intergenic
941905077 2:170712336-170712358 CCGCGCCCGGGAAGAGCGTGTGG - Intergenic
943835848 2:192512981-192513003 TCTCTGGCGGGCAGAGTGGGGGG - Intergenic
945188707 2:207165573-207165595 CTGCTGCCGGGCAAAACGGGAGG + Exonic
946410220 2:219511860-219511882 CTGCAGCCGGGCAGAGAGGGAGG + Intergenic
947392468 2:229653294-229653316 CCTCTGCTGGGCAGAGCAGTAGG + Intronic
948592843 2:239062402-239062424 AGGCTGCCGGGCAGAGGGGCGGG + Intronic
948741838 2:240053467-240053489 CAGCTGCAGGGCAGGGCGCGAGG + Intergenic
1168828913 20:833776-833798 CCGCGGTCGAGCTGAGCGGGTGG - Exonic
1171781915 20:29427460-29427482 GTGCAGCCGGGCGGAGCGGGCGG - Intergenic
1171876899 20:30585680-30585702 CCGCCGCCGGGCAGAACGCCTGG - Intergenic
1171891923 20:30724856-30724878 CCGATGCCGGCCTGAGCTGGCGG + Intergenic
1172391098 20:34566139-34566161 GCGCTGCTGGGCAGGGCAGGGGG - Intronic
1175851043 20:62093123-62093145 CCCCTGCCTGGCAGAGCTGGTGG + Intergenic
1176242936 20:64083492-64083514 CCGCTGCCGGGGAGAGAGGCTGG + Exonic
1177894339 21:26843225-26843247 AGGCTGCTGGGCAGAGTGGGTGG - Intronic
1179407505 21:41137639-41137661 AGGCTGCCGGGCTGAGTGGGTGG + Intergenic
1179906705 21:44426490-44426512 CGGGTGCCAGGCAGAGCTGGGGG - Intronic
1180014565 21:45074068-45074090 CCGCTGCAGGGAGGAGCGCGGGG + Intronic
1180707216 22:17817270-17817292 CCGCGTGCAGGCAGAGCGGGAGG - Intronic
1180841363 22:18960348-18960370 CCGCTGCAGGGCAGGGGAGGTGG - Intergenic
1182604172 22:31490143-31490165 GCGCTGCAGGGCAGAGCGGACGG + Intronic
1184715376 22:46278985-46279007 CCGGAGCCAGGCAGAGCTGGTGG - Intronic
1184841061 22:47052644-47052666 CCGCTGCCCCTCAGAGCAGGAGG - Intronic
1185055145 22:48575492-48575514 CCGGCGCCGAGCCGAGCGGGCGG + Intronic
950024403 3:9810411-9810433 CCGCTGTAGGCCAGAGCGAGCGG - Intronic
950386350 3:12663684-12663706 CGGCTGCCGGGCAGAGGGCTTGG - Intronic
950583467 3:13878125-13878147 CAGCTGCCCGGCAGGGAGGGAGG - Intronic
950623455 3:14226495-14226517 CCGCTGTGGGGCAGGGTGGGGGG - Intergenic
950729939 3:14948087-14948109 CCGCGGCCGGGCGAAGCGAGCGG + Intronic
951558674 3:23945443-23945465 CCCCTCATGGGCAGAGCGGGCGG - Exonic
951611264 3:24494888-24494910 CCGCCGCCGGGAGGAGGGGGCGG - Intronic
954383070 3:50229956-50229978 CGGCTGGGGGGCAGTGCGGGAGG - Intronic
960747846 3:120908921-120908943 CAGCTGCCGGGGAGGGGGGGAGG - Intronic
963526991 3:146427521-146427543 CCGGTGCTGGGCAGGGAGGGAGG - Intronic
966402684 3:179563256-179563278 CCGGGGGCGGGCAGAGCGTGGGG - Intronic
966975310 3:185077650-185077672 CTGCTGCCCGGCAGAGCTTGGGG - Intergenic
967740146 3:192995856-192995878 TCTCTGGCGGGCAGAGTGGGGGG - Intergenic
967948680 3:194823909-194823931 CCAGAGCAGGGCAGAGCGGGAGG - Intergenic
968353410 3:198080984-198081006 CCGCCGCCGGGCAGACCGCCTGG + Intergenic
969256152 4:6003041-6003063 CTGCTGCAGGGCAGAGCAGGTGG - Intergenic
969480154 4:7442639-7442661 CTGCGGCAGGGCAGAGCTGGGGG - Intronic
974055460 4:56978726-56978748 CCGCTGCCGGGCTGATTGAGAGG - Exonic
978944074 4:114472890-114472912 CAGCTGTCGGGCTGAGTGGGTGG + Intergenic
985782494 5:1878501-1878523 CCACTGCCGGGCGCAGAGGGCGG - Exonic
986716092 5:10524737-10524759 CAGATGCCGGGCCGAGCAGGTGG - Intergenic
988180596 5:27786538-27786560 CCTCTGCCGGGTAGAGCTGTGGG - Intergenic
996091446 5:119355834-119355856 CGGCTGCCGGCCCGAGCGCGCGG + Intronic
996404911 5:123095170-123095192 CCCCTGCCGGGTAGAGGAGGAGG + Intronic
999731685 5:154480081-154480103 CAGGCGCCGGGGAGAGCGGGGGG - Intergenic
1001586190 5:172834922-172834944 CCCAGGCCGGGCAGATCGGGAGG + Intronic
1002193847 5:177491936-177491958 ACACAGCCGGGCAGGGCGGGCGG + Intronic
1002473593 5:179451890-179451912 CCACTGCAGGGCAGTGCTGGGGG - Intergenic
1002480508 5:179497861-179497883 CCACTGCAGGGCAGTGCTGGGGG + Intergenic
1006052871 6:31357037-31357059 CCTCTGCCGGGAGGAGCGAGGGG - Intronic
1006498259 6:34439853-34439875 CCGCTGCTGGGCGGGGGGGGGGG - Intergenic
1006923484 6:37641092-37641114 GAGCTGCCAGGCAGAGTGGGAGG - Intronic
1007137905 6:39540635-39540657 CAGCAGCAGAGCAGAGCGGGAGG + Intronic
1007396128 6:41578822-41578844 GGGCTGCTGGGCAGAGGGGGAGG - Intronic
1007398040 6:41588240-41588262 CCGCAGACAGGCAGGGCGGGAGG + Intronic
1015353194 6:132247044-132247066 CCGCTGCCGCAGAGAGCTGGTGG - Intergenic
1017282226 6:152637135-152637157 CCGGTGCCTGGAAGAGCTGGGGG + Intronic
1018795233 6:167180113-167180135 CTGCTGCCGGGCAGAACTGGAGG + Intronic
1018821087 6:167374949-167374971 CTGCTGCCGGGCAGAACTGGAGG - Intronic
1019405843 7:883708-883730 CCGAGGCCGGGGAGAGTGGGGGG - Intronic
1022973489 7:35537301-35537323 CCGCGGCAGGGCGGGGCGGGGGG + Intergenic
1024521060 7:50304460-50304482 CAGCTGCCGCCCAGAGCGGCGGG - Intronic
1028690619 7:93645356-93645378 TCTCTGGCGGGCAGAGTGGGGGG - Intronic
1029413266 7:100428634-100428656 CCGCTGGCAGGGAGACCGGGCGG + Exonic
1029680108 7:102102625-102102647 CCGAGGCCGGGCAGAGCTGGGGG - Intronic
1029745061 7:102512151-102512173 CCGCTCCCGGGCTGAGGGCGGGG - Intronic
1029763053 7:102611312-102611334 CCGCTCCCGGGCTGAGGGCGGGG - Intronic
1033253326 7:139778191-139778213 GGGCTGCCGCGCAGCGCGGGGGG + Intronic
1033601533 7:142892313-142892335 CTGCAGCTGGGCAGAGCAGGTGG - Intergenic
1034418757 7:150978292-150978314 CCGCGGCCGGGCCGAGCCGCAGG - Exonic
1034429915 7:151036100-151036122 CCGCTGCCGGGCAGAGGAGCTGG + Exonic
1034830679 7:154305079-154305101 CCCCAGCCCGGCTGAGCGGGCGG + Intronic
1035399754 7:158557134-158557156 CGGCTCCCGGGCAGGGCAGGCGG + Intronic
1036007848 8:4687150-4687172 CCGCTGCCAGCCAGAGAGGCAGG + Intronic
1037116823 8:15237338-15237360 CCGCTGGCGGGAGGAGCAGGCGG + Intronic
1037459472 8:19094546-19094568 CCTCTGCCTGGCAGAACTGGAGG + Intergenic
1037897711 8:22669148-22669170 CCTCTTCCGGGCAGAGAGGCGGG - Intronic
1039979164 8:42391977-42391999 CCGCGGCCGAGCAGAGCGCCAGG + Intronic
1040076950 8:43246583-43246605 CCGCCGCCGGGCAGAACGCCTGG - Intergenic
1040514787 8:48125980-48126002 CGGCTGCCGTGCTGAGCAGGAGG + Intergenic
1042207947 8:66347827-66347849 CTGCTGCAGGGGAGAGGGGGAGG - Intergenic
1043438519 8:80256821-80256843 CCACTGCAGGGCAGAGCTGAGGG - Intergenic
1044580249 8:93819298-93819320 CCTCTTCCTGGCAGAGCTGGGGG - Intergenic
1045034750 8:98168418-98168440 CCACGGCAGAGCAGAGCGGGAGG - Intergenic
1049451801 8:142666023-142666045 CGGCTGCCGGGAAGAGCAGAGGG - Exonic
1049705878 8:144041739-144041761 CGGCTGCTGGGCAGGGAGGGCGG + Intronic
1049766650 8:144358235-144358257 CGGCTGCCGGGGAGTGCGGCGGG + Exonic
1049973592 9:841905-841927 CCGCCGCAGGGCAGAGCCGGGGG + Exonic
1051170474 9:14315064-14315086 CGGCTGCCGGGAAAAGGGGGAGG + Intronic
1052494930 9:29213467-29213489 CCGGTGCGGGGCTGGGCGGGCGG + Intergenic
1052781008 9:32782632-32782654 CCCCTGCCTACCAGAGCGGGAGG + Intergenic
1052872726 9:33523952-33523974 CCGCCGCCGGGCAGACCGCCTGG - Intergenic
1052949689 9:34198558-34198580 CCGCAGATGGGCAGAGCTGGTGG + Intronic
1052993911 9:34539446-34539468 CCCATGCAGGGCAGAGCGGGAGG - Intergenic
1054764962 9:69035745-69035767 GCGCTGGAGGGCGGAGCGGGCGG + Exonic
1056665372 9:88577129-88577151 CAGCTGCCGTCCAGAGAGGGAGG + Intronic
1057152719 9:92809002-92809024 CCGCCGCCGGGCAGACCGCCGGG - Intergenic
1060811775 9:126614371-126614393 CCGCGGCGGCGGAGAGCGGGTGG + Intergenic
1060941594 9:127545879-127545901 CCGCTGCCAGGCAGGCGGGGTGG - Intronic
1061090463 9:128423082-128423104 CCACTGCCCTGCAGAGAGGGAGG + Intronic
1061483607 9:130909178-130909200 CCAGTGCGGGGCAGAGCTGGTGG - Intronic
1062055780 9:134469163-134469185 CAGATGCCGGGCACACCGGGCGG - Intergenic
1062153475 9:135033336-135033358 CCGAGGCAGGGCAGAGCGGTGGG - Intergenic
1062391420 9:136335437-136335459 CAGCTGCAGGGCTGAGGGGGAGG - Intronic
1062462119 9:136666370-136666392 CTGCTGCCGGGCAGGTGGGGAGG + Intronic
1062587255 9:137254964-137254986 CCCCTGCGGGGCAGAGGGGCGGG + Intergenic
1202800559 9_KI270719v1_random:170865-170887 CCGCCGCCGGGCAGACCGCCTGG - Intergenic
1186888588 X:13938559-13938581 CCGGGGACGGGCAGAGCCGGTGG + Intronic
1187099525 X:16179379-16179401 TCTCTGGCGGGCAGAGTGGGGGG + Intergenic
1187226124 X:17376373-17376395 CCGCTGCTGGGGAGGGCGCGAGG - Intronic
1188006518 X:25019827-25019849 CCGGTGCTGGGAAGAGCCGGAGG + Intergenic
1189322756 X:40096575-40096597 CCGCTGCCGCGCAACTCGGGAGG - Intronic
1198983251 X:142423555-142423577 TCTCTGGCGGGCAGAGTGGGGGG + Intergenic