ID: 1158978246

View in Genome Browser
Species Human (GRCh38)
Location 18:62732671-62732693
Sequence ATTTTGTCCAGATGTATCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 460
Summary {0: 1, 1: 1, 2: 3, 3: 71, 4: 384}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158978246_1158978249 0 Left 1158978246 18:62732671-62732693 CCCTTGATACATCTGGACAAAAT 0: 1
1: 1
2: 3
3: 71
4: 384
Right 1158978249 18:62732694-62732716 AAATTGAGAACCTTTTGGCAAGG 0: 1
1: 0
2: 22
3: 271
4: 735
1158978246_1158978248 -5 Left 1158978246 18:62732671-62732693 CCCTTGATACATCTGGACAAAAT 0: 1
1: 1
2: 3
3: 71
4: 384
Right 1158978248 18:62732689-62732711 AAAATAAATTGAGAACCTTTTGG 0: 1
1: 3
2: 50
3: 423
4: 1219
1158978246_1158978251 14 Left 1158978246 18:62732671-62732693 CCCTTGATACATCTGGACAAAAT 0: 1
1: 1
2: 3
3: 71
4: 384
Right 1158978251 18:62732708-62732730 TTGGCAAGGTTTCACCATTCCGG 0: 1
1: 0
2: 5
3: 40
4: 570

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158978246 Original CRISPR ATTTTGTCCAGATGTATCAA GGG (reversed) Intronic
901610530 1:10494518-10494540 ATTTTGGCCAGATCAGTCAAGGG + Intronic
901892902 1:12283303-12283325 ATGTCTTCCAGTTGTATCAAAGG + Exonic
903782648 1:25831471-25831493 CTTTTCTCCAGAACTATCAAGGG + Intronic
905708833 1:40083703-40083725 ACTTTGCCCAGATGCATCAAAGG - Intronic
905964424 1:42080360-42080382 TTTTTCTCAAGATGTATCTATGG + Intergenic
906332019 1:44893752-44893774 TTCTTGTCCAGAAGTATCCACGG - Intronic
906758773 1:48350722-48350744 ATTATGGACACATGTATCAAAGG - Intronic
907217015 1:52872965-52872987 ACTTTGTCCAGATTCATCAGGGG - Intronic
907714897 1:56917360-56917382 TGTTAGTCCAGATGTAGCAAGGG - Intronic
908091774 1:60693621-60693643 ACTTTGCCCAGATCCATCAAAGG - Intergenic
909804850 1:79861910-79861932 ATTTTGTAAAAATGTATCTAAGG + Intergenic
910231607 1:84993542-84993564 ACTTTGTCCAGATTCATCAGAGG + Intronic
910269911 1:85383134-85383156 ATTTTGCCCAGATTCATCAGAGG - Intronic
910386627 1:86690761-86690783 ATTTTTTCAAGATGTTTCACTGG + Intergenic
910558217 1:88560441-88560463 ATATAGTCTAGATGTAGCAAAGG - Intergenic
910640155 1:89452086-89452108 ACTTTGCCCAGATTTATCAGGGG - Intergenic
910732776 1:90416491-90416513 ATTTTGCCCAGATCCATCAGAGG - Intergenic
910793944 1:91079368-91079390 ATTTATGCCAGATGTATCAGTGG + Intergenic
911198975 1:95024993-95025015 ACTTTGTCCAGATCCATCAGAGG + Intronic
911296742 1:96126686-96126708 ACTTTGCCCAGATTCATCAAAGG - Intergenic
911955673 1:104231682-104231704 ATTTTGCCCAGATCCATCAGAGG + Intergenic
912095882 1:106143009-106143031 ATTTTTTCCAGAAAGATCAATGG - Intergenic
912873917 1:113336218-113336240 ATTTTGCCCAGATCCATCAGAGG + Intergenic
913351049 1:117859697-117859719 ACTTTGTCCAGATCCATCAGAGG - Intergenic
914415295 1:147474882-147474904 ATTTTGCCCAGATCCATCAGAGG - Intergenic
915585673 1:156842546-156842568 ATTTTGGCCAAATGGGTCAAGGG - Intronic
915845213 1:159256175-159256197 ACTTTGCCCAGATCTATCAGAGG + Intergenic
917336859 1:173932613-173932635 ATTTTTTCCAGATGGATCGTTGG - Exonic
917701686 1:177587870-177587892 CTTTTCTCCATATCTATCAAAGG + Intergenic
917842863 1:178996164-178996186 ACTTTGTCCAGATCCATCAGAGG + Intergenic
918582571 1:186148450-186148472 ACTTTGCCCAGATCCATCAAAGG + Intronic
918606078 1:186427691-186427713 AGTTTGTCCAGATCCATCAGAGG + Intergenic
918843568 1:189578349-189578371 AATTAGTCCAGATCTGTCAAGGG - Intergenic
919020908 1:192104588-192104610 ATTTTGTCTAAATGAGTCAAAGG + Intergenic
920620018 1:207536126-207536148 ATTTTGTTCAGATCCATCAGAGG - Intronic
920621800 1:207554681-207554703 ATTTTGTTCAGATCCATCAGAGG - Intronic
920623425 1:207571776-207571798 ATTTTGTTCAGATCCATCAGAGG - Intronic
921355869 1:214283650-214283672 AGTCTGTCCAGATGTATGAGGGG + Intronic
921492677 1:215797902-215797924 ACTTTGTCCAGATCCATCAGAGG - Intronic
921839284 1:219811307-219811329 AATTTGTTCAGATGCATTAATGG + Intronic
921897770 1:220418516-220418538 ACTTTGTGCAGATCCATCAAAGG - Intergenic
922522917 1:226272941-226272963 ATGATGTCCAGCTGAATCAAAGG - Intronic
922624057 1:227019538-227019560 ATTTTGCCCAGATTCATCAGAGG + Intronic
924259749 1:242217260-242217282 AATTTGCCCAGATCTATCAGAGG - Intronic
924354253 1:243152913-243152935 ACTTTGTCCAGATCTATTAGAGG - Intronic
924499633 1:244625119-244625141 ATTTTGTCCAGATACATCAGAGG + Intronic
1065439618 10:25737770-25737792 ATTTTGCCCAGATCCATCAGAGG - Intergenic
1066795986 10:39121318-39121340 TTTTTCTCCATAGGTATCAATGG - Intergenic
1066927794 10:41719541-41719563 ATTTTATCCACAGGTTTCAATGG - Intergenic
1067404402 10:46008262-46008284 ACTTTGCCCAGATCTATCAGAGG - Intronic
1067536085 10:47111315-47111337 ATTTTCTCCACCTGTTTCAAGGG - Intergenic
1068198852 10:53756258-53756280 ATTTTGTCCACAGATATCTAAGG - Intergenic
1069303919 10:66944590-66944612 ACTTTGCCCAGATCCATCAAAGG + Intronic
1069303927 10:66944659-66944681 ACTTTGCCCAGATCCATCAAAGG + Intronic
1069318979 10:67143935-67143957 ACTTTGCCCAGATCTATCAGAGG + Intronic
1069758544 10:70790634-70790656 TTTTTGTCTAGTTCTATCAATGG + Intergenic
1070489300 10:76961096-76961118 ATTTTGCCCAGATTCATCAAAGG - Intronic
1071854091 10:89605778-89605800 ATTTTACCCAGATCCATCAAAGG + Intronic
1071971265 10:90909826-90909848 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1072474369 10:95745528-95745550 AATTTGTCTAAATGTCTCAAAGG - Intronic
1073128905 10:101172323-101172345 TTTTTGTCCATATGTATCCAGGG + Intergenic
1073335144 10:102701715-102701737 AATTTGACCATATGTATCAATGG + Intronic
1075354652 10:121760306-121760328 ACTTTGCCCAGATCTATCAGAGG - Intronic
1075431691 10:122389134-122389156 ACTTTGCCCAGATCTATCAGAGG + Intronic
1075841172 10:125505328-125505350 ACTTTGTCCAGATCCATCAGAGG - Intergenic
1077694595 11:4383036-4383058 ATTTTGTCAATATGTAATAAAGG - Intergenic
1078165912 11:8884941-8884963 ATGTTGTCCAGAAGTACTAAGGG + Intronic
1078744044 11:14094349-14094371 AATCTGGCAAGATGTATCAAGGG - Intronic
1079303592 11:19302291-19302313 ACTTTGTCCAGATCTATCAGAGG + Intergenic
1080544060 11:33298538-33298560 ACTTTGCCCAGATGCATCAGAGG - Intronic
1080751028 11:35150501-35150523 ATTTTGTCAAAATGTGTCAGAGG + Intronic
1081141243 11:39503152-39503174 ATTTTGTCCAGATTGGTCCATGG + Intergenic
1081266252 11:41026147-41026169 AGTTTGTCCAGATTTATCAGAGG - Intronic
1083040032 11:59676725-59676747 CTTTTGCCCAGATCCATCAAAGG + Intergenic
1083166896 11:60894706-60894728 ACTTTGTCCAGATCCATCAAAGG + Intronic
1085046695 11:73357609-73357631 ATTTTGCACAGATGAATCAATGG - Intronic
1085373059 11:76029408-76029430 ATTTTGCCCAGATCCATCAGAGG - Intronic
1085828615 11:79875125-79875147 ACTTTGTCCAGATCTGTCAGAGG + Intergenic
1086851974 11:91820139-91820161 GTTCTGTCCAGAATTATCAAAGG + Intergenic
1088462970 11:110102202-110102224 ATTTTGCCCAGATCCATCAGAGG - Intronic
1091199291 11:133761208-133761230 ATTTTGTCCAGAAGCATCAGAGG - Intergenic
1091579246 12:1771952-1771974 ATTTTCTCCCTATGTATCAATGG - Intronic
1093683353 12:22028807-22028829 ATTTTATCCAGCAGTATCAAAGG + Intergenic
1094126879 12:27032776-27032798 ATTTTGTCCAGATTAGTCTATGG - Intronic
1094664927 12:32510291-32510313 ATTTTGTGAAGATGTTTTAATGG - Intronic
1095019881 12:37040495-37040517 TTTTTGTCCAAATGTAGAAAAGG + Intergenic
1095191917 12:39267718-39267740 ACTTTGCCCAGATCTATCAGAGG - Intergenic
1095910600 12:47422814-47422836 ATTTTGCCCAGATGCATCCAAGG - Intergenic
1096321092 12:50613538-50613560 TGTTTGTCAGGATGTATCAAAGG - Intronic
1097659432 12:62412929-62412951 ATTTTGCCCAGATCCATCAGAGG + Intronic
1098871003 12:75816860-75816882 ATTTTATCAAGATTCATCAACGG + Intergenic
1098976161 12:76904181-76904203 ATTTGTACCAGATGTATCATAGG + Intergenic
1099480838 12:83164318-83164340 ACTTTGCCCAGATGCATCAGAGG + Intergenic
1099592640 12:84614115-84614137 ATTTTGCCCAGATTCATCAGAGG - Intergenic
1099820508 12:87703267-87703289 ACTTTGTCCAGATTTATCAGAGG + Intergenic
1101620501 12:106382442-106382464 ATTTTGTCCAGATCCATCAAAGG + Intronic
1105547719 13:21363758-21363780 CTTTTGTCCAGATCCATCAGAGG - Intergenic
1105738441 13:23296729-23296751 ATTATGTACAGATATACCAAAGG - Intronic
1107072077 13:36281343-36281365 ATTTTAGCATGATGTATCAAGGG - Intronic
1107176202 13:37401875-37401897 AGTTTGCCCAGATCCATCAAAGG - Intergenic
1108010254 13:45999759-45999781 ATTTTGCCCAGATCCATCAGAGG + Intronic
1108927046 13:55763659-55763681 ATTTTATTCAGTAGTATCAATGG + Intergenic
1109045800 13:57409393-57409415 ATTTTGACCAGTTCTATCCAGGG + Intergenic
1109853442 13:68099328-68099350 ATTTTGCCTAGATCCATCAAAGG + Intergenic
1110379233 13:74830883-74830905 ATTTTGCCCAGATCTGTCAAAGG - Intergenic
1111144160 13:84158245-84158267 ATTTTGTCCAGATTTGTCAGTGG - Intergenic
1111571644 13:90095534-90095556 ATTTTGTTCAGATCCATCAGAGG + Intergenic
1111745492 13:92263670-92263692 ATTTTGTCCCCATTTATAAATGG - Intronic
1112943423 13:104894393-104894415 ATTTTATACAGATGTTACAAGGG - Intergenic
1113086450 13:106574142-106574164 ATTTTGTTCAAAAGTATCATTGG + Intergenic
1115043631 14:28961607-28961629 ACTTTGTCCAGATCCATCAGAGG + Intergenic
1115379052 14:32712941-32712963 ACTTTGTCCAGATCCATCAGAGG + Intronic
1115709630 14:36036801-36036823 ACTTTGCCCAGATCCATCAAGGG - Intergenic
1116311854 14:43337043-43337065 ATTTTATCCAGATCTATAATGGG - Intergenic
1116443256 14:44978996-44979018 ATTTTGTCCACATGTAGGATTGG - Intronic
1117269666 14:54129647-54129669 ATTTTGCCCAGATCCATCAGAGG - Intergenic
1118116215 14:62780224-62780246 ATTTTGACCAGAAGGAGCAAAGG + Intronic
1118166698 14:63343388-63343410 ACTTTGCCCATATGTGTCAAAGG + Intergenic
1119091679 14:71788219-71788241 ATTTTGTCCAGATCCATCAGAGG - Intergenic
1119135376 14:72213468-72213490 ATTTTGTCCAGATTGATCACAGG - Intronic
1121705022 14:95985734-95985756 ACTTTGTCCAGATCCATCAGAGG + Intergenic
1202838666 14_GL000009v2_random:99921-99943 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1202908023 14_GL000194v1_random:89991-90013 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1202885205 14_KI270722v1_random:99314-99336 ATTTTGCCCAGATCCATCAAAGG + Intergenic
1123227497 15:17056757-17056779 TTTTTCACCATATGTATCAATGG - Intergenic
1124560381 15:30768182-30768204 ACTTTGCCCAGATCTATCAGAGG + Intronic
1124670862 15:31637602-31637624 ACTTTGCCCAGATCTATCAGAGG - Intronic
1125000419 15:34764179-34764201 ACTTTGTCCAGATCCATCAGAGG + Intergenic
1125090958 15:35792505-35792527 TTTTTCTAAAGATGTATCAATGG + Intergenic
1126011393 15:44305658-44305680 ATTTTGCCCAGATCCATCAGAGG + Intronic
1126882918 15:53118397-53118419 ATTTTTTCAAAATGTATAAATGG + Intergenic
1126939437 15:53750606-53750628 ACTTTGTCCAGGTATATCAGAGG - Intronic
1127795084 15:62430871-62430893 ATTTGGTCTAGAAGTCTCAAAGG + Intronic
1127841642 15:62836825-62836847 ATTTTGTCCAGTTGTAATCATGG + Intronic
1128189807 15:65681379-65681401 ATTTTGCCCAGATCCATCACAGG + Intronic
1128837722 15:70824527-70824549 ATTTTTTTCAGATGCATCAGGGG + Intergenic
1131769943 15:95726624-95726646 ATTTTGTCCAAATGTATCAAAGG + Intergenic
1131878989 15:96842502-96842524 ACTTTGCCCAGATGCATCAGAGG - Intergenic
1131898721 15:97064087-97064109 ACTTTGCCCAGATCCATCAAAGG - Intergenic
1133685198 16:8159851-8159873 ATCTTTTCCAGAAGTATCAGGGG + Intergenic
1141304596 16:82850139-82850161 ATTTTGTCCTGATCCATCAGAGG - Intronic
1143144650 17:4766782-4766804 ATTTTGTCAGGATGAATCTATGG + Intergenic
1143443079 17:6990850-6990872 ATTTTGCCCAGATCTATCTATGG - Intronic
1145377557 17:22365130-22365152 ACTTTGCCCAGATCCATCAAAGG + Intergenic
1149195539 17:54115417-54115439 CTTCTATCCAGATGTTTCAATGG - Intergenic
1149299506 17:55291736-55291758 ACTTTGCCTAGATCTATCAAAGG - Intronic
1149518314 17:57298128-57298150 ACTATGTCCAGATTTATCAGAGG + Intronic
1150031519 17:61741450-61741472 ACTGTGTCCAGATGCATCAGAGG + Intronic
1150662526 17:67095895-67095917 ACTTTGTCCAGATCCATCAGAGG + Intronic
1151807543 17:76415469-76415491 AATTGGTCCAGGTGTAGCAAGGG - Intronic
1152684123 17:81685486-81685508 ATTTGGTCCAAATGTCTAAAGGG + Intronic
1153181484 18:2439963-2439985 ACTTTGCCCAGATCTATCAGAGG + Intergenic
1153453730 18:5258558-5258580 ATTTTTTTCAGTTGTATAAAGGG - Intergenic
1154066692 18:11113341-11113363 ATTTTGTCCAGGTTGGTCAATGG - Intronic
1155414535 18:25582488-25582510 ATTTTGACCAGAGGGATAAAAGG - Intergenic
1155681662 18:28494192-28494214 ATTTTGTCCAGACAGATCAGTGG - Intergenic
1155729336 18:29133127-29133149 ATTTTTTCCACAAGGATCAAAGG - Intergenic
1156181886 18:34614440-34614462 ACTTTGTCCAGATCCATCAGAGG - Intronic
1158308649 18:56134923-56134945 AATTGGTCTAGGTGTATCAATGG + Intergenic
1158757400 18:60342762-60342784 ACTTTGCCCAGATCTATCAGAGG - Intergenic
1158978246 18:62732671-62732693 ATTTTGTCCAGATGTATCAAGGG - Intronic
1159066276 18:63570959-63570981 ATCTTGTGCAGTTGTCTCAATGG + Intergenic
1160025851 18:75215502-75215524 ATTTTGTCAAGCTGTAGAAATGG + Intronic
1162843985 19:13377767-13377789 CCTTTGCCCAGATGCATCAAAGG - Intronic
1167021689 19:46881301-46881323 ACTTTGCCCAGATCCATCAAAGG + Intergenic
1168167751 19:54563684-54563706 ATTGTGTCCAAATGTTACAAAGG - Intergenic
1168323483 19:55524819-55524841 ACTTTGTCCAGATCCATCAGAGG + Intergenic
1202651514 1_KI270707v1_random:9373-9395 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1202660611 1_KI270708v1_random:66345-66367 ATTTTGCCCAGATCCATTAAAGG + Intergenic
926057645 2:9784400-9784422 ATTTTGCCCAGATCCATCAGAGG - Intergenic
927234837 2:20862435-20862457 ATTTTGTCTAGCTGTTTCAGTGG - Intergenic
927396535 2:22657443-22657465 ATTTTGCCCAGATCCATCAGAGG - Intergenic
927402249 2:22725980-22726002 TTTTTGTACACATGTATCAAAGG - Intergenic
927613804 2:24568375-24568397 ATTTTGGCCAGTTATATTAAGGG + Intronic
928110102 2:28500471-28500493 ATTTAGGCAAGAAGTATCAATGG - Intronic
928141986 2:28737518-28737540 ATTTTGTCCACATATTTTAATGG + Intergenic
928639238 2:33280530-33280552 ATTTTCAACAGAAGTATCAAAGG + Intronic
928852162 2:35761413-35761435 ACTTTGTCCAGATGCATCAGAGG - Intergenic
929256305 2:39814803-39814825 ATTTGGTCCATTTGTATTAAAGG + Intergenic
929441472 2:41968559-41968581 ATTTTGTCCTGAGATTTCAAAGG - Intergenic
931141452 2:59462907-59462929 ATTTTGATCAGATGTGTCTACGG + Intergenic
931955647 2:67421093-67421115 ATTTTGCCCAGATCCATCAGAGG - Intergenic
932001463 2:67888977-67888999 ATATTATCCAGCTGCATCAAAGG + Intergenic
932469814 2:71946960-71946982 ATTTTGCCAAGATTCATCAAAGG + Intergenic
935228087 2:101071895-101071917 ACTTTGCCCAGATGAATCAGAGG + Intronic
935818400 2:106869323-106869345 TTTTTGTCCAAATATCTCAATGG - Intronic
937254875 2:120548013-120548035 TGTTTGCCCAGCTGTATCAATGG + Intergenic
937482361 2:122276056-122276078 ATATTGGATAGATGTATCAAAGG + Intergenic
937815712 2:126248504-126248526 ATTTTGCCATGATGTATGAAGGG - Intergenic
937850833 2:126634296-126634318 GTGTTGCCCAGATGTATCAAGGG + Intergenic
938064610 2:128274295-128274317 TTTTTGTCCAGATGCTTCAAGGG - Intronic
939867870 2:147494879-147494901 ATTTTGCCCAGATCCATCAGAGG - Intergenic
940608504 2:155959892-155959914 ATTTTGTTCAGACCTATCAGGGG - Intergenic
940686204 2:156854418-156854440 ATTTGATACAGTTGTATCAAAGG + Intergenic
940823055 2:158379048-158379070 ACTTTGCCCAGATGCATCAGAGG - Intronic
941912393 2:170776111-170776133 AATTTATCCAGATATATAAAAGG + Intergenic
942051047 2:172141288-172141310 ACTTTGCCCAGATACATCAAAGG - Intergenic
942110384 2:172676306-172676328 ACTTTGCCCAGATATATCACAGG - Intergenic
943144829 2:184029841-184029863 AATTTGTCCACATTTCTCAATGG - Intergenic
943616474 2:190098171-190098193 ACTTTGCCCAGATTTATCAGAGG + Intronic
944255862 2:197623146-197623168 ATTTTGCCCAGATCCATCAGAGG - Intronic
944978768 2:205090010-205090032 ATTTTGTAGAGGTGCATCAACGG + Intronic
945674394 2:212838240-212838262 ATTTTGCCCAGATCCATCAGAGG + Intergenic
945832641 2:214805589-214805611 ATTTTGTGCAGATGAAGAAAAGG + Intronic
946645348 2:221827332-221827354 ACTTTGTCCAGATCCGTCAAAGG + Intergenic
946713502 2:222529833-222529855 ACTTTGTCCAGATCTATCAGAGG + Intronic
946853023 2:223926099-223926121 ACTTTGCCCAGATCTATCAGAGG + Intronic
947252932 2:228128593-228128615 ACTTTGCCCAGATCCATCAAAGG + Intronic
947439956 2:230110714-230110736 ATTTTGTCCAGATCCATCAGAGG - Intergenic
947661029 2:231868279-231868301 ATTTTGTCCACATGTATTATGGG - Intergenic
947974052 2:234348849-234348871 AATTTGACAAGATGTATCATGGG - Intergenic
948573337 2:238931801-238931823 CTTTTGTCTAGTTCTATCAATGG - Intergenic
1170237976 20:14129116-14129138 ACTTTGTCCATATCCATCAAAGG - Intronic
1171525936 20:25811162-25811184 ACTTTGCCCAGATCCATCAAAGG - Intronic
1171550891 20:26044722-26044744 ACTTTGCCCAGATCCATCAAAGG + Intergenic
1174652669 20:52141303-52141325 ACTTTGCCCAGATGCATCAGAGG - Intronic
1174834553 20:53844199-53844221 ACTTTGCCCAGATCTATCAGAGG - Intergenic
1174890017 20:54381748-54381770 ATTTTTTGCAGATGTCTGAATGG + Intergenic
1174991223 20:55512509-55512531 ATTTTGCCCAGATCCATCAGAGG + Intergenic
1176600633 21:8790273-8790295 ATTTTGCCCAGATCCATCAAAGG + Intergenic
1176627385 21:9104675-9104697 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1176646581 21:9356433-9356455 ATTTTGCCCAGATCCATCAAAGG + Intergenic
1176722994 21:10407313-10407335 ATTTTTTTCAGATGTATCATAGG + Intergenic
1177686746 21:24447232-24447254 ATTTAATCCCCATGTATCAAGGG - Intergenic
1179522714 21:41955520-41955542 ATTTTCTGCAGCTGTATTAAGGG + Intergenic
1180304152 22:11060049-11060071 ATTTTTTTCAGATGTATCATAGG + Intergenic
1180328095 22:11449936-11449958 ATTTTGCCCAGATCCATCAAAGG + Intergenic
1180342916 22:11681811-11681833 ATTTTGCCCAGATCCATCAAAGG + Intergenic
1180366340 22:11942570-11942592 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1180417730 22:12784272-12784294 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1184304048 22:43583029-43583051 ATTTTGTCCAGATTAGTCAGTGG - Intronic
949213044 3:1528479-1528501 ATCTTTTCCAGATTCATCAAAGG + Intergenic
949813357 3:8032297-8032319 ACTTTGTCCAAATCTATCAGAGG + Intergenic
950838643 3:15945231-15945253 ATTTTGCCCAGCTCTATCAGAGG - Intergenic
951210448 3:19968936-19968958 ATTTTGGCAACATGTAGCAAAGG - Intronic
951529980 3:23689356-23689378 ATTTTGCCCAGATCCTTCAAAGG + Intergenic
952169340 3:30789080-30789102 ACTTTGCCCAGATCTATCAGAGG + Intronic
952390801 3:32878043-32878065 AGTTTGTCCAGATCCATCAGAGG + Intronic
953546860 3:43869950-43869972 ATTTTGTCCAGAAGTAGCAGAGG - Intergenic
953660134 3:44885789-44885811 ATTTTGTAGAGATGAATCATAGG + Intronic
955426674 3:58798182-58798204 ACTTTGCCCAGATTTATCAGAGG - Intronic
955679397 3:61484750-61484772 ACTCTGTCTAGATGCATCAAAGG + Intergenic
955703374 3:61704233-61704255 AGTTTGTCCAGCTGTAAAAAGGG + Intronic
955938408 3:64124957-64124979 ATTTTGCCCAGATCCATCAGAGG - Intronic
955964034 3:64369673-64369695 ATGGTGTCAAGTTGTATCAAGGG + Intronic
956526622 3:70170232-70170254 ATTTTGTGCAGATGTAGGAAAGG + Intergenic
957093688 3:75757711-75757733 ATTTTGCCTAGATCCATCAAAGG - Intronic
957253163 3:77801043-77801065 ATTTTATTGAGATGAATCAAAGG + Intergenic
957809567 3:85202295-85202317 ACTTTGACCAGATTTATCAAAGG + Intronic
957937053 3:86957662-86957684 ATTCTGTCCAGATATATGTAGGG - Intronic
958075766 3:88675864-88675886 ACTTTGCCCAGATCTATCAGAGG - Intergenic
958116652 3:89228312-89228334 ATTTTGTCCAATTTTTTCAAAGG - Intronic
958494415 3:94825714-94825736 ACTTTGCCCAGATCTATCAGAGG + Intergenic
959214173 3:103428465-103428487 CTTTTGCCCAGACTTATCAATGG - Intergenic
959587020 3:108034314-108034336 ACTTGGCCCAGATGTCTCAATGG - Intergenic
959677034 3:109047979-109048001 TTTTTGTCAAGATGTTTCATAGG - Intronic
960235418 3:115276333-115276355 ATTTTATTCACATGTATAAAAGG + Intergenic
960242179 3:115357752-115357774 ATGTTGCCCAGATCTATCAGAGG + Intergenic
960813743 3:121652090-121652112 ATGTTTTCCAGATTTATCCATGG - Intronic
961613243 3:128157916-128157938 ACTTTGTCCAGATCCATCAGAGG - Intronic
963196748 3:142540424-142540446 ATTTCCTCCAGTTGTCTCAAAGG - Intronic
964942238 3:162173203-162173225 ACTTTGTCCAGATCCATCAAAGG - Intergenic
965863306 3:173173100-173173122 ATTTTCTCCTAATGTATGAAAGG - Intergenic
966386181 3:179401168-179401190 GATTTCTCCAGATATATCAATGG + Exonic
968153773 3:196360994-196361016 ACTTTGCCCAGATTCATCAAAGG - Intronic
1202740304 3_GL000221v1_random:48607-48629 ATTTTGCCCAGATCCATCAAAGG - Intergenic
970629029 4:17921386-17921408 ACCTTGTCCAGATCTATCAGAGG + Intronic
970884520 4:20972290-20972312 ATTTCGTCTAGATCTATCACAGG + Intronic
971525061 4:27606365-27606387 ACTTTGTCCAGATCTATCAGAGG - Intergenic
971698570 4:29937513-29937535 ATTTTGTCCAGATGGCTCACTGG + Intergenic
972157078 4:36177349-36177371 ATTTTGAACAGATGTATGTAAGG - Intronic
972259208 4:37391607-37391629 ATTTGGTCAAGATGTATGCATGG + Intronic
972384583 4:38552479-38552501 ATTTTGGCAATATGTATCAGTGG + Intergenic
972615259 4:40691758-40691780 ATTTTGTCCAGATCTATCAGAGG + Intergenic
973364064 4:49193021-49193043 ATTTTGCCCAGATCCATCAAAGG + Intergenic
973397018 4:49603722-49603744 ATTTTGCCCAGATCCATCAAAGG - Intergenic
974245699 4:59314585-59314607 ATTTTCTCCAGATCTGTCAGTGG + Intergenic
974448796 4:62023009-62023031 AGTTTGTCCAGATCCATCAGAGG - Intronic
975133844 4:70854980-70855002 ACTTTGCACAGATCTATCAAAGG - Intergenic
975323088 4:73030492-73030514 ATTTTGCCCAGATCCATCAGAGG - Intergenic
976468589 4:85400522-85400544 TTTTTGGCCAGATCTATCAGAGG - Intergenic
976848231 4:89514551-89514573 ATTTGGTCTAAATGTGTCAAAGG + Intergenic
977024741 4:91803267-91803289 ACTTTGTCCAGATCCACCAAAGG - Intergenic
977339392 4:95739521-95739543 ATTTTCTCCACATGCATGAAAGG + Intergenic
977548758 4:98417035-98417057 ATTATGTCTGGTTGTATCAATGG - Intronic
977596970 4:98893846-98893868 ACTTTGTCCAGATCCATCAAAGG + Intronic
977612805 4:99053612-99053634 CTTTTGTCCAGATTCATCAGAGG + Intronic
977887046 4:102264131-102264153 ACTTTGCCCAGATGCATCAGAGG + Intronic
978122624 4:105098956-105098978 ATATTGTCCAGATTCATCAGAGG + Intergenic
978204239 4:106060737-106060759 ATTTTGCCCAGATGCATCAGAGG - Intronic
978268335 4:106855555-106855577 ATTTTGTTCAGCTGTAGCCAAGG - Intergenic
978610870 4:110537702-110537724 ACCTTGTCCAGATCCATCAAAGG + Intronic
979247553 4:118526725-118526747 ACTTTGTCCAGATCTATTAGAGG + Intergenic
980409183 4:132392399-132392421 ATTATGTCCATATCTATCATAGG + Intergenic
980419012 4:132535269-132535291 ATATTGTCAAAATGTATGAATGG - Intergenic
980546664 4:134272406-134272428 ACTTTGTCCAAATCCATCAAAGG - Intergenic
981984216 4:150834278-150834300 ACTTTGCCCAGATCCATCAAAGG + Intronic
982297096 4:153840305-153840327 ATCTTGTCTGGATTTATCAAGGG + Intergenic
982453593 4:155580978-155581000 ATTTTGCCCAGATGTTTCAGAGG - Intergenic
983154867 4:164334740-164334762 ACTTTGCCCAGATCCATCAAAGG - Intronic
983387594 4:167084986-167085008 CTTTTGTCCAGAGGGATCCAGGG + Intronic
983464656 4:168072140-168072162 ACTTTGCCCAGATCCATCAAAGG + Intergenic
983796423 4:171869530-171869552 AATTTGTTAAGATGTATGAAAGG - Intronic
983832644 4:172347508-172347530 ACTTTGTTCAGAAGAATCAATGG + Intronic
984299465 4:177896360-177896382 ACTTTGCCCAGATCCATCAAAGG - Intronic
984685654 4:182665572-182665594 ATTTTGCCCAGATCTATCACAGG - Intronic
1202761376 4_GL000008v2_random:114134-114156 ATTTTGCCCATATCCATCAAAGG + Intergenic
985974383 5:3404373-3404395 ATTTTGAGCATATTTATCAATGG - Intergenic
986485759 5:8235081-8235103 ACTTTGCCCAGATCCATCAAAGG + Intergenic
987655940 5:20806044-20806066 ATTTTGCCCAGATTCATCAGAGG - Intergenic
987860688 5:23483913-23483935 ATTTTGTCAAGATTCATAAAGGG - Intergenic
988767613 5:34397867-34397889 ATTTTGCCCAGATTCATCAGAGG + Intergenic
988889008 5:35594114-35594136 ACTTTGTCCAGATCCATCACAGG + Intergenic
989425871 5:41295018-41295040 ATTTTGTCCAGAGGTAACGGAGG - Intergenic
989803568 5:45575943-45575965 ATTTTGCCCAGATTTATCAGAGG - Intronic
990522984 5:56597683-56597705 ACTTTGCCCAGATCCATCAAAGG + Intronic
993349536 5:86831379-86831401 ATGTTGTCCAGATCCATCAGAGG + Intergenic
993368629 5:87063969-87063991 ACTTTGCCCAGATTCATCAAAGG + Intergenic
993897734 5:93558255-93558277 ACTTTGCCCAGATGCATCAGAGG + Intergenic
994020145 5:95013898-95013920 GCTTTGTCCAGATCTATCAGAGG - Intronic
996067414 5:119094645-119094667 ACTTTGTCCAGATCAATCAGAGG - Intronic
996072922 5:119155273-119155295 ACTTTGTCCAGATCCATCAGAGG - Intronic
996123110 5:119693158-119693180 ATTTTATCAAGATGTATCTGAGG + Intergenic
996180754 5:120416893-120416915 GTTTTGTCCCCATGTATCATAGG + Intergenic
996216910 5:120879447-120879469 ATTTTGTCATGAAGTTTCAATGG + Intergenic
996512428 5:124331628-124331650 ACTCTGTCCAGATTTATCAGAGG + Intergenic
997038366 5:130220949-130220971 ATTTTTTCCATATGTAAAAAAGG + Intergenic
998165883 5:139843355-139843377 ATTTTTTCCAAAAGTATCATCGG - Exonic
998847415 5:146324521-146324543 ATTTTTCCCACATGTATCAATGG - Intronic
999825029 5:155265649-155265671 ATTATGTCCACTTGTACCAAAGG + Intergenic
1001183402 5:169542432-169542454 ATTTTGTCCAGATTCATCAGAGG - Intergenic
1002722964 5:181275414-181275436 TTTTTTTTCAGATGTATCATAGG + Intergenic
1004067011 6:12256918-12256940 ATTCTGTACAGACGTATTAAAGG + Intergenic
1005402105 6:25445469-25445491 ACTTTGCCCAGATGCATCAGAGG + Intronic
1006065711 6:31461159-31461181 ATTTTTACCAGATGTCTGAAAGG + Intergenic
1006308914 6:33243411-33243433 ATTTTCTCCAAATGTTTGAATGG + Intergenic
1007341714 6:41194788-41194810 ATGTTGTCCAGATGTGTGAAAGG + Exonic
1007651305 6:43424390-43424412 ACTTTGTCCAGATCCATCAGAGG - Intergenic
1008171195 6:48208395-48208417 ATGTTGTGAAGTTGTATCAACGG + Intergenic
1008268823 6:49464984-49465006 ATTTTGCCCAGATCCATCAGAGG + Intronic
1008390886 6:50950087-50950109 ATTTTGCCCAGATCCATCAGAGG - Intergenic
1010506788 6:76670560-76670582 ATTTTGTCCTTATGTCTCATTGG + Intergenic
1011588719 6:88950448-88950470 ATTTTGCCCAGATTCATCAGAGG - Intronic
1011790319 6:90891753-90891775 TTTTCGTCAAAATGTATCAAGGG + Intergenic
1011976825 6:93311736-93311758 ACCTTGCCCAGATCTATCAAAGG + Intronic
1012558952 6:100554792-100554814 ACTAGGTCCAGATATATCAACGG + Intronic
1013008732 6:106100554-106100576 ATTTATTCCAAATGTCTCAAAGG - Intronic
1013569269 6:111404536-111404558 ATTTTGCCCAGATCCATCAGTGG - Intronic
1013823847 6:114187252-114187274 ATTTTGCCCAGATTCATCAGAGG - Intronic
1014918744 6:127186804-127186826 AATTTTTCCAGATGTCTTAAAGG + Intronic
1014974692 6:127864766-127864788 TGTTTATCCATATGTATCAAAGG + Intronic
1016222892 6:141697479-141697501 ACTTTATCCAGATCTATCAGGGG - Intergenic
1016344004 6:143092044-143092066 ATTTTGCCCAGATCCATCAGAGG + Intronic
1016849980 6:148608804-148608826 ACTTTGTTCATCTGTATCAACGG + Intergenic
1017533278 6:155319110-155319132 ACTTTGCCCAGATCCATCAAAGG + Intergenic
1017579046 6:155840455-155840477 ATTTTGTCTAGATGTTTCAGTGG - Intergenic
1018406066 6:163483853-163483875 ACTTTGCCCAGATTTATCAGAGG + Intronic
1021221639 7:17981164-17981186 ATTTTGCTCAGATCTATCAGAGG + Intergenic
1022006487 7:26270686-26270708 ATTTTGCCCAGATCCATCAGAGG + Intergenic
1022548819 7:31216609-31216631 ACTTTGTCCAGATCCATCAGAGG + Intergenic
1022594662 7:31701122-31701144 ACTTTGTCCAGATCCATCAGAGG - Intronic
1022682324 7:32560728-32560750 ACTTTGCCCAGATCCATCAAAGG + Intronic
1023310529 7:38881884-38881906 TTTTTGTCCATATGTATGCAAGG - Intronic
1023613885 7:41998976-41998998 ATTTTGTTCAAATGTGTCCAGGG + Intronic
1025299751 7:57809248-57809270 ACTTTGCCCAGATCCATCAAAGG + Intergenic
1028065018 7:86373218-86373240 ATTTTGCCCAGATCCATCACAGG - Intergenic
1029000547 7:97150327-97150349 ACTTTGTCCAGATCCATCAGAGG + Intronic
1030794742 7:113773786-113773808 ATTTTGTCCACATTTCTCACTGG + Intergenic
1030865263 7:114694754-114694776 ATTTTGTGCTGTTGAATCAATGG + Intergenic
1031234582 7:119158123-119158145 ATTTTGCCCAGATATATCAGGGG + Intergenic
1031610025 7:123814858-123814880 ATTTTATCCAAATGTATTGAAGG - Intergenic
1032928010 7:136631069-136631091 ATTTTGCCCAGATCCATCATAGG + Intergenic
1033060923 7:138106195-138106217 AATTTGTCAATATGTATCAAGGG + Intronic
1035198779 7:157246109-157246131 ATTTTCTCCAGTCGTATCAGTGG + Intronic
1036954930 8:13177778-13177800 ATTCTGTCCAGGTGTAGCACTGG - Intronic
1037019613 8:13953379-13953401 ATGTTGTCCAGATCCATCAGAGG + Intergenic
1037475081 8:19249097-19249119 TTTTTGCCCAGATGAATGAACGG - Intergenic
1038253806 8:25931525-25931547 TTTTTGTCCACATTCATCAAAGG - Intronic
1039778445 8:40759962-40759984 ATTTTGTCCAGATTTGTTAGTGG - Intronic
1040117375 8:43638432-43638454 ATTTTCACCATATGTCTCAATGG - Intergenic
1040830779 8:51674900-51674922 AATTTGTCCACATCTAACAAAGG - Intronic
1040841247 8:51787325-51787347 ACTTTGTCTAGATCTATCAGAGG - Intronic
1041222788 8:55668894-55668916 ATTATGTCCAGACATAACAATGG + Intergenic
1041956577 8:63562747-63562769 ATCTTGTCCAGATTGGTCAATGG - Intergenic
1041979161 8:63835950-63835972 GTTTTCTCCAGATGTATGATGGG - Intergenic
1042785982 8:72547395-72547417 ACTTTGTCCAGATCTATCAGAGG - Intronic
1043007631 8:74839798-74839820 ATACTCTACAGATGTATCAATGG - Intronic
1044096791 8:88076689-88076711 TTTTTGTCTAGATATAACAAGGG + Intronic
1044186526 8:89259511-89259533 TCTTTGTCCAGATATAGCAAAGG - Intergenic
1044259474 8:90100842-90100864 ACTTTGTCCAGATTCATCAGAGG + Intergenic
1044449464 8:92317300-92317322 ACTTTGCCCAGATCCATCAAAGG - Intergenic
1044919384 8:97152427-97152449 ATTTTCCCCAGATTTATCTATGG + Intergenic
1045482954 8:102607403-102607425 ATTTTATCCAGATGCATAAATGG - Intergenic
1046478407 8:114780413-114780435 ATTTTGCCCAGATTAATCAGAGG - Intergenic
1046542522 8:115604652-115604674 ATTTTGTCTAGAGGAATCGAGGG + Exonic
1046815493 8:118578759-118578781 AATTTGTCCAGTTGTTTAAATGG - Intronic
1047316060 8:123734152-123734174 ATTATTTCCACATTTATCAATGG + Intronic
1047475836 8:125228491-125228513 ATTTTGACCAGCAGAATCAAGGG + Intronic
1048034411 8:130663605-130663627 AATTTGGCAATATGTATCAAAGG + Intergenic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1053172389 9:35898219-35898241 ACTTTGCCCAGATTCATCAAAGG + Intergenic
1053575172 9:39352520-39352542 ACTTTGCCCAGATCTATCGAAGG - Intergenic
1053624854 9:39858952-39858974 ATTTTGTCAATATGTGTGAAAGG + Intergenic
1053793843 9:41706752-41706774 ACTTTGCCCAGATCCATCAAAGG - Intergenic
1053880015 9:42584276-42584298 ATTTTGTCAATATGTGTGAAAGG - Intergenic
1053885165 9:42638829-42638851 ATTTTTTTCAGATGTATCATAGG + Intergenic
1053892650 9:42710032-42710054 ATTTTGTCAATATGTGTGAAAGG + Intergenic
1054096735 9:60911203-60911225 ACTTTGCCCAGATCTATCGAAGG - Intergenic
1054118137 9:61186829-61186851 ACTTTGCCCAGATCTATCGAAGG - Intergenic
1054182251 9:61918765-61918787 ACTTTGCCCAGATCCATCAAAGG - Intergenic
1054219042 9:62391746-62391768 ATTTTGTCAATATGTGTGAAAGG - Intergenic
1054224186 9:62446278-62446300 ATTTTTTTCAGATGTATCATAGG + Intergenic
1054231674 9:62517423-62517445 ATTTTGTCAATATGTGTGAAAGG + Intergenic
1054471107 9:65539217-65539239 ACTTTGCCCAGATCCATCAAAGG + Intergenic
1054589618 9:66995735-66995757 ACTTTGCCCAGATCTATCGAAGG + Intergenic
1055296964 9:74843443-74843465 ACTTTGTCCAGATCCATCAGAGG + Intronic
1055325846 9:75128606-75128628 ATTTTGTCCATATATATATATGG + Intronic
1055536342 9:77249322-77249344 ATTTTATTCAGTTGTTTCAAGGG + Intronic
1055849092 9:80603938-80603960 ATTTCGTCCAGATGTGAAAAAGG + Intergenic
1055872472 9:80899634-80899656 ATGTTGTCCAGATTCTTCAATGG - Intergenic
1056061972 9:82892847-82892869 ATTTTGTCCAGATTGGTCAATGG + Intergenic
1056998297 9:91484275-91484297 AGATTTTCCAGAGGTATCAAGGG + Intergenic
1057067190 9:92066351-92066373 ATTTTGTCCACATGCAGCAGGGG + Intronic
1058927882 9:109686286-109686308 ACTTTGACCAGATTAATCAAAGG + Intronic
1059092902 9:111380067-111380089 ACTTTGCCCAGATCCATCAAAGG + Intronic
1059187405 9:112287291-112287313 ATTTTGTCCAGAAGTTACTAAGG + Intronic
1059834103 9:118130375-118130397 ATTTTGTCCAGATCCATCAGAGG - Intergenic
1203750229 Un_GL000218v1:72361-72383 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1203483753 Un_GL000224v1:32011-32033 ATTTTGCCCAGATCTATCAAAGG + Intergenic
1203708945 Un_KI270742v1:78563-78585 ATTTTGCCCAGATCCATCAAAGG - Intergenic
1203542146 Un_KI270743v1:99015-99037 ATTTTGCCCATATCCATCAAAGG + Intergenic
1186336702 X:8597417-8597439 ATTTTGTGCTGATTTCTCAAAGG + Intronic
1186376950 X:9013874-9013896 AGTCTGTCCAAATGTACCAAAGG + Intergenic
1186849132 X:13562727-13562749 ACTTTGTCCAGATCCATCAAAGG + Intergenic
1187110781 X:16297612-16297634 ATTTTGCCCAGATCCATCAGAGG + Intergenic
1188151045 X:26675802-26675824 ATTTTCCCCAGATTTAGCAATGG - Intergenic
1188249706 X:27877216-27877238 ATTGTTTCGACATGTATCAATGG + Intergenic
1188855527 X:35190540-35190562 ATTTTGCCCAGATTTCTCAGAGG + Intergenic
1189072529 X:37879166-37879188 ACTTTGCCCAGATCTATCAGAGG - Intronic
1189768574 X:44397786-44397808 ATTTTGTCCAGATTGATCAGAGG - Intergenic
1191578002 X:62728204-62728226 ATTTTCCCCAGAGGCATCAATGG + Intergenic
1192028460 X:67482640-67482662 ATTTAGTCCAGATCCATCAGAGG + Intergenic
1192127909 X:68519308-68519330 ATTTTTTCCCGCTCTATCAATGG - Intronic
1192701013 X:73473034-73473056 ACTTTGTACAGATTGATCAAAGG + Intergenic
1194326257 X:92521170-92521192 ATTTTACACAGATGTATCAGAGG + Intronic
1194449128 X:94020931-94020953 ATTTTGACAATATGAATCAAAGG - Intergenic
1194591350 X:95803845-95803867 AATTTGCCCAGGTGCATCAAAGG - Intergenic
1194694816 X:97033184-97033206 ATCTAGTCTAGATGTATCTATGG - Intronic
1194759888 X:97783659-97783681 ACTTTGCCCAGATGCATCAGAGG - Intergenic
1194872390 X:99147702-99147724 TTTTTCTCAAGATGTATCTATGG - Intergenic
1194982769 X:100457491-100457513 ATTTTGGTCAAATTTATCAAAGG - Intergenic
1195628308 X:107027254-107027276 ACTTTGCCCAGATCTATCAGAGG + Intergenic
1196154605 X:112414467-112414489 ATAATGTCCAGATGGACCAAAGG - Intergenic
1196721549 X:118859225-118859247 CCTTTGCCCAGATCTATCAAAGG - Intergenic
1198057222 X:133007142-133007164 ATTTTGTCCAGATTGGTCAGTGG + Intergenic
1198102393 X:133433194-133433216 ATTTTGTCCAGATGTGACCTTGG + Intergenic
1199359329 X:146899568-146899590 ATTTTGCCCAGATCTGTCAGAGG - Intergenic
1199369758 X:147033833-147033855 ACTTTGTCCAGATACATCAGAGG - Intergenic
1200634978 Y:5640372-5640394 ATTTTACACAGATGTATCAGAGG + Intronic
1201163880 Y:11189998-11190020 ATTTTGCCCAGATCCATCAAAGG - Intergenic