ID: 1158982136

View in Genome Browser
Species Human (GRCh38)
Location 18:62773537-62773559
Sequence AAAAATCTGGCATGTTTTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 391}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158982136_1158982148 21 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982148 18:62773581-62773603 AAAATTATTTTTGGGGTGAGGGG 0: 1
1: 0
2: 2
3: 72
4: 640
1158982136_1158982146 19 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982146 18:62773579-62773601 ATAAAATTATTTTTGGGGTGAGG 0: 1
1: 0
2: 5
3: 59
4: 796
1158982136_1158982150 26 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982150 18:62773586-62773608 TATTTTTGGGGTGAGGGGGATGG 0: 1
1: 0
2: 13
3: 142
4: 959
1158982136_1158982142 12 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982142 18:62773572-62773594 TTCCTAAATAAAATTATTTTTGG 0: 1
1: 0
2: 6
3: 113
4: 1088
1158982136_1158982149 22 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982149 18:62773582-62773604 AAATTATTTTTGGGGTGAGGGGG 0: 1
1: 0
2: 1
3: 56
4: 694
1158982136_1158982151 27 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982151 18:62773587-62773609 ATTTTTGGGGTGAGGGGGATGGG 0: 1
1: 0
2: 9
3: 55
4: 546
1158982136_1158982145 14 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982145 18:62773574-62773596 CCTAAATAAAATTATTTTTGGGG 0: 1
1: 1
2: 4
3: 75
4: 686
1158982136_1158982147 20 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982147 18:62773580-62773602 TAAAATTATTTTTGGGGTGAGGG 0: 1
1: 0
2: 9
3: 87
4: 798
1158982136_1158982143 13 Left 1158982136 18:62773537-62773559 CCTCCAAAACATGCCAGATTTTT 0: 1
1: 0
2: 2
3: 29
4: 391
Right 1158982143 18:62773573-62773595 TCCTAAATAAAATTATTTTTGGG 0: 1
1: 0
2: 5
3: 101
4: 913

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158982136 Original CRISPR AAAAATCTGGCATGTTTTGG AGG (reversed) Intronic
903104450 1:21063273-21063295 AAGAATCTGGAAGGGTTTGGTGG + Intronic
903761612 1:25702483-25702505 TAGACTCTGGTATGTTTTGGGGG - Intronic
904829785 1:33299232-33299254 AAGATTCTGGACTGTTTTGGTGG + Exonic
906212286 1:44018775-44018797 AAAAAACTGGCAAGGTGTGGTGG + Intronic
906231882 1:44171459-44171481 AAGCATCTGGCTTGTTTTGAGGG - Intergenic
906469203 1:46113444-46113466 AAAAATCTGGCTGGGTGTGGTGG - Intronic
906584349 1:46963359-46963381 TACAATCTGGCATGTTTTTGCGG + Intergenic
906831786 1:49040042-49040064 AAAAGACAGGCATGGTTTGGAGG + Intronic
907546937 1:55269783-55269805 AATAATCTGGCTGGTTTTGGTGG - Intergenic
908081065 1:60578875-60578897 AAAAAGATGGCATAATTTGGTGG - Intergenic
908153784 1:61331333-61331355 AAAAAGTTGCCATGTTTTGGAGG - Intronic
908314512 1:62919757-62919779 AAAACTCTGGCATGATTGTGAGG + Intergenic
908836935 1:68237814-68237836 ACAAATATGGCATGTTATAGGGG + Intergenic
909664108 1:78114645-78114667 AAAAATCTGGGATGTATAGGAGG + Intronic
909940092 1:81601658-81601680 ATGAATCTGGAATATTTTGGGGG - Intronic
910080072 1:83331039-83331061 ATGAATCTGGCATTATTTGGTGG - Intergenic
910182517 1:84501431-84501453 AAAAATCTGCAATGTTTATGGGG - Intronic
910256576 1:85254370-85254392 AAACGTTTGGCTTGTTTTGGTGG - Intronic
911865437 1:103014247-103014269 AGAAATCTTGCGTGTTATGGTGG + Intronic
912034394 1:105293518-105293540 AAAAATCAGGATTTTTTTGGGGG + Intergenic
912118029 1:106431890-106431912 AAAAGACTGGCAAGTTTTGTTGG - Intergenic
912872552 1:113322958-113322980 ATAAAACTGGCATGAGTTGGGGG - Intergenic
913666641 1:121054935-121054957 ACAAATCTGGCATGCAATGGTGG + Intergenic
914018325 1:143842059-143842081 ACAAATCTGGCATGCAATGGTGG + Intergenic
914656940 1:149750576-149750598 ACAAATCTGGCATGCAATGGTGG + Intergenic
915189081 1:154133550-154133572 AAAAATCTGGCTGGGTGTGGTGG + Intronic
915812991 1:158935780-158935802 AAACAACAGGCAGGTTTTGGGGG + Intronic
915898959 1:159832933-159832955 GAAAACCTGGCAGGTCTTGGAGG - Exonic
916325299 1:163550695-163550717 AAAATTCTAGCAGGTTTTTGTGG - Intergenic
917060898 1:171037775-171037797 TAAAATATTGCATGTTTAGGGGG - Intronic
917204998 1:172562758-172562780 AAAATTCAAGCATGTTGTGGAGG - Intronic
917337935 1:173944406-173944428 AAAAATCATGCATGTGGTGGGGG + Intronic
918447481 1:184629754-184629776 AACTACCTGGCATGTTTTAGAGG + Intergenic
918572387 1:186012821-186012843 AAAAATCGGGAATATTGTGGTGG + Intronic
918843429 1:189575607-189575629 AAAAATGTGGAATGTTATTGTGG + Intergenic
919060425 1:192625017-192625039 TACAATTTGGCATGTTTTTGCGG - Intergenic
920540086 1:206771628-206771650 AAAAATCTGGCCGATTTTGAAGG + Intronic
921605625 1:217150982-217151004 AGAAAACAGGCATGTTTTGAAGG + Intergenic
922006279 1:221533786-221533808 AAAAATCTGCAACCTTTTGGAGG + Intergenic
922464062 1:225834605-225834627 AAAAATCTGGAATGATTTTTTGG + Intronic
922569259 1:226623977-226623999 AAAAACCTGGAAAGTTTTGCTGG + Intergenic
1063870809 10:10415900-10415922 GAAAATCTGATATGGTTTGGTGG + Intergenic
1064361390 10:14668328-14668350 AAAAACCTGGCCTGGTGTGGTGG - Intronic
1064942519 10:20750993-20751015 AAAAATCTGGCAAGGCATGGTGG + Intergenic
1065046944 10:21753630-21753652 AAAAATTTGCCAGGTGTTGGTGG + Intergenic
1065888364 10:30098842-30098864 AAAAATCAGGAAGTTTTTGGGGG - Intronic
1066561553 10:36675098-36675120 AAAAATCAGGCATGTGTAGAAGG - Intergenic
1067129862 10:43553506-43553528 AAAATCCTGGCATTTTTGGGAGG - Intergenic
1067333581 10:45343499-45343521 TACAATGTGGCATGTTTTTGTGG - Intergenic
1068239841 10:54290431-54290453 TACAATTTGGCATGTTTTTGAGG - Intronic
1068755737 10:60650604-60650626 AAAAATCTGAAATTTTATGGAGG + Intronic
1069029900 10:63584406-63584428 AAAGATGGGGCATGTGTTGGGGG - Intronic
1070187989 10:74084572-74084594 AAAAATTTGGCAGGTCATGGTGG - Intronic
1070318544 10:75337034-75337056 AAAATTCTGGCAGGGTGTGGTGG + Intergenic
1070716047 10:78721923-78721945 AAAAGTCTGGAATAATTTGGGGG + Intergenic
1071452077 10:85805452-85805474 AAACATCTGGGATTTTTTGGGGG - Intronic
1071884544 10:89935638-89935660 TACAATTTGGCATGTTTTTGCGG + Intergenic
1072288317 10:93938699-93938721 AAAAATTTAGCAGGTTGTGGTGG - Intronic
1072311798 10:94163762-94163784 TACAATTTGGCATGTTTTTGCGG + Intronic
1075307405 10:121380314-121380336 AATCATCTGGGAAGTTTTGGTGG + Intergenic
1075377477 10:121990403-121990425 AAAATTCTGGCAGTGTTTGGTGG - Intronic
1077363252 11:2150426-2150448 TCAAATCTGGCATGTGTTGGGGG + Intronic
1080972887 11:37300696-37300718 AAAAATGTGGCCTTTATTGGGGG + Intergenic
1081110126 11:39125799-39125821 ACAAATAGGGCATGTTATGGGGG + Intergenic
1081273991 11:41123857-41123879 AAAACTCTGGCATGATTAGCAGG - Intronic
1081819285 11:45976051-45976073 GAAGCTCTGGCATGCTTTGGAGG + Intronic
1081942043 11:46951570-46951592 AACAATCTGGCAGGGTATGGTGG - Intronic
1082946517 11:58766828-58766850 AAAAAGCTGGCACACTTTGGGGG + Intergenic
1083239749 11:61378972-61378994 AAAAATCTGTTATGTTTTAAAGG - Intergenic
1086179028 11:83927837-83927859 ATAAATCTGAGATATTTTGGAGG + Intronic
1086662816 11:89442647-89442669 TAAACTGTGGCTTGTTTTGGAGG + Intronic
1087829194 11:102800364-102800386 AAAAAGCAGGCATGATGTGGCGG - Intergenic
1087961650 11:104358077-104358099 CAAATTCTCCCATGTTTTGGAGG + Intergenic
1088948564 11:114540701-114540723 CAAAAGCAGGCAAGTTTTGGTGG + Intronic
1089140611 11:116280932-116280954 AAAAACCTGGGGTGATTTGGGGG - Intergenic
1089199782 11:116717255-116717277 AATAATCTGGAATGGGTTGGAGG - Intergenic
1090550569 11:127815321-127815343 AGAAGTCTGGCTTGGTTTGGGGG + Intergenic
1091260499 11:134230424-134230446 AGAAATCAGGTTTGTTTTGGTGG + Intronic
1091891838 12:4062177-4062199 AAAAATATGGCATAATTTTGAGG + Intergenic
1092455671 12:8640493-8640515 AAAAATCGGACAGGTTGTGGTGG + Intronic
1092933728 12:13340712-13340734 AAAAATCTGGCTTGAGTGGGCGG - Intergenic
1093863825 12:24200702-24200724 AAAACTCTGGCAGGTATTGCAGG + Intergenic
1094219838 12:27980194-27980216 TAACATCTGGGATATTTTGGAGG - Intergenic
1094308048 12:29043256-29043278 AATAACATGTCATGTTTTGGGGG - Intergenic
1095509157 12:42930366-42930388 AGACATTTGGCAAGTTTTGGGGG - Intergenic
1095822111 12:46489639-46489661 CAAAAACAGGCATGTTTCGGTGG + Intergenic
1095881154 12:47138151-47138173 AAAGAACAGACATGTTTTGGAGG - Intronic
1097351012 12:58549215-58549237 AATATTCTGTTATGTTTTGGAGG - Intronic
1098016692 12:66112500-66112522 AAAAATCTGGCCTTTGATGGAGG + Intergenic
1098461364 12:70736438-70736460 AATAAATTGGCATGCTTTGGGGG - Intronic
1098820950 12:75228167-75228189 AAACATTTGGCCGGTTTTGGTGG - Intergenic
1098991364 12:77067451-77067473 AAAAATCTGACATTTTTTATAGG + Intergenic
1100005255 12:89887921-89887943 AAAAATCTCACATATTTTTGAGG - Intergenic
1101212738 12:102550979-102551001 AAAACACTGACATCTTTTGGAGG - Intergenic
1101637067 12:106553033-106553055 AACCATGTGGGATGTTTTGGTGG - Intronic
1101860282 12:108476903-108476925 AAATATCAGGCCTGTTGTGGTGG - Intergenic
1102053189 12:109878194-109878216 AATTATCTGGCTGGTTTTGGAGG - Intronic
1102066775 12:109983453-109983475 TAAAATCTGCCCTGCTTTGGAGG + Exonic
1102373808 12:112404635-112404657 ACAAATCTGGCAGGGTGTGGTGG + Intergenic
1102742928 12:115223970-115223992 AAAAATCTGGAATGATTTGTGGG - Intergenic
1102795773 12:115687678-115687700 CAAAATCGGGCCTGTCTTGGAGG - Intergenic
1105718339 13:23089508-23089530 AAATATCTGGCAAGGTGTGGTGG - Intergenic
1106727957 13:32505420-32505442 AAAAATTTAGCATGTTCTGGAGG - Intronic
1107325608 13:39239141-39239163 TAAAATTTGGTATGTTTTTGTGG + Intergenic
1107606528 13:42062961-42062983 AAAAATCTGGTATTTCTTGGTGG + Intronic
1108014045 13:46054549-46054571 AATAATCTGACTTTTTTTGGGGG + Intronic
1108359539 13:49656741-49656763 AAAAAACTGGCAGGGTGTGGTGG + Intergenic
1108560561 13:51639548-51639570 ATAAATCTGATATGTTTTGTAGG - Intronic
1108811830 13:54235099-54235121 AAAAATCTGGCAAGAATTGTCGG - Intergenic
1109705475 13:66085967-66085989 AAAATCCTGGCAAGTTTTTGAGG - Intergenic
1110366609 13:74693840-74693862 AAAATTCAGGAATGTTTTAGAGG - Intergenic
1111400497 13:87727894-87727916 AAAAATCTCGAAATTTTTGGTGG - Intergenic
1112071159 13:95851952-95851974 CGAAATCTGGCATGTTATTGAGG + Intronic
1112212291 13:97389799-97389821 AAAAATCAGACATGATTTGATGG + Intronic
1112224611 13:97526248-97526270 ATAAATCAGGCATGTTTTCATGG - Intergenic
1114138404 14:19881749-19881771 AAAAATCTGGCTTTTGTTGATGG - Intergenic
1114367915 14:22050152-22050174 AAAAATCTGCCTTGATTTGAGGG + Intergenic
1116386696 14:44339562-44339584 AAAAATCTGCATTTTTTTGGTGG - Intergenic
1117130081 14:52677575-52677597 AGAAATCTGGCCTGGTGTGGAGG + Intronic
1117373188 14:55097344-55097366 ATGAATCTGGCCTGTTGTGGAGG + Intergenic
1119285275 14:73448476-73448498 TAAAATCTGGCCTGGTGTGGTGG - Intronic
1120052590 14:79884472-79884494 AAAACTCAGGCAGGTTTGGGAGG - Intergenic
1120652160 14:87147741-87147763 TAAGATCTGACATGTTCTGGAGG + Intergenic
1124075269 15:26438100-26438122 GAACATCTGCCATGTTTTGTTGG - Intergenic
1124633231 15:31349171-31349193 AAAAAGCTGCCATGAGTTGGGGG - Intronic
1125186636 15:36938499-36938521 ATAACTGTGGCAGGTTTTGGTGG - Intronic
1125643022 15:41247380-41247402 AAAATTCTGGCCGGTTGTGGTGG + Intronic
1125689221 15:41583147-41583169 AAAAAATTAGCATGTTGTGGTGG - Exonic
1126262027 15:46704577-46704599 AAAAATGTGGCAAATTTTTGAGG - Intergenic
1127274005 15:57426430-57426452 AAAAATGTGGCCTGGTGTGGTGG - Intronic
1128530468 15:68441725-68441747 AAAAATCAAGCATCATTTGGAGG + Intergenic
1129314791 15:74735172-74735194 AAAAATCCTCCATGTTTTGGTGG + Intergenic
1131428732 15:92368842-92368864 AAGAATGTGGTGTGTTTTGGAGG - Intergenic
1131652368 15:94414759-94414781 AAAAGTGTGGCATGTTTTGGGGG + Intronic
1132000814 15:98178495-98178517 AAAAATCACACATGTTGTGGTGG + Intergenic
1132204215 15:99975496-99975518 AAAGATCTGGCTGGTTGTGGTGG - Intronic
1132360268 15:101206811-101206833 AGAAATTTGGTATTTTTTGGAGG - Intronic
1134348901 16:13418066-13418088 AGACACCTGTCATGTTTTGGAGG + Intergenic
1134366978 16:13588451-13588473 AAAGACCTGGGATGTGTTGGAGG + Intergenic
1138694061 16:58795183-58795205 AAAATAATGACATGTTTTGGTGG + Intergenic
1140077777 16:71718178-71718200 AAAAATCAGGCCTGGTGTGGTGG - Intronic
1142159904 16:88551964-88551986 AAAAATCAGGCCTGGTGTGGTGG - Intergenic
1147539308 17:41343759-41343781 AGAATTATGGCTTGTTTTGGAGG - Intergenic
1147798148 17:43060656-43060678 AAAAAACTAGCATGGTGTGGTGG - Intronic
1148838732 17:50480566-50480588 AAGAGCCTGGCATGTTTTGGGGG + Intronic
1148952779 17:51328487-51328509 TACAATTTGGCATGTTTTTGCGG - Intergenic
1150503981 17:65680082-65680104 AAAAATCTGTCTTGTTTTAGAGG + Intronic
1151511835 17:74565555-74565577 AAAAATCTGGCCAGGTGTGGTGG + Intergenic
1153762789 18:8347939-8347961 AAATGTCTGGCATGATTTGGGGG + Intronic
1154051439 18:10962997-10963019 AAATATCTGGCCTGGTATGGTGG + Intronic
1154322637 18:13367447-13367469 AAGAGCCTGGCAGGTTTTGGAGG + Intronic
1154467854 18:14667230-14667252 AAAAATCTGGCCAGGTTTGGTGG - Intergenic
1155862087 18:30914635-30914657 AATAATCAGGCATGTTTGTGTGG - Intergenic
1156443582 18:37217273-37217295 TACAATTTGGCATGTTTTTGCGG + Intronic
1157107005 18:44783197-44783219 AGATATTTTGCATGTTTTGGGGG + Intronic
1158427051 18:57349740-57349762 AAAAATCTCCCAGGGTTTGGGGG - Intergenic
1158647332 18:59258666-59258688 TAAAATTTGGCATGTTTTTGCGG - Intergenic
1158820326 18:61151567-61151589 AAAAATCTGGCCAGGTGTGGTGG + Intergenic
1158869538 18:61671473-61671495 TCAAATATGGCATGTTTTGAAGG - Intergenic
1158982136 18:62773537-62773559 AAAAATCTGGCATGTTTTGGAGG - Intronic
1159144150 18:64432031-64432053 AAAAAGCAAGCTTGTTTTGGAGG - Intergenic
1159454807 18:68647641-68647663 AAAACTATGGAATGTTTTAGAGG - Intergenic
1159635146 18:70796259-70796281 TACAATTTGGCATGTTTTTGCGG - Intergenic
1160570263 18:79812064-79812086 CCAAATCTGGGAGGTTTTGGGGG - Intergenic
1160737328 19:669591-669613 AGAAATCTGACATGTATCGGGGG - Intergenic
1161569329 19:5021919-5021941 AAAAATCTGGCTGGATATGGTGG - Intronic
1161742423 19:6031079-6031101 AAACAGCTGGCAGGTTTTTGTGG - Intronic
1162492955 19:11005207-11005229 AAAACTCTGGGAGGTTGTGGTGG + Intronic
1162515653 19:11145902-11145924 AAAAATTTGGCCTGGTGTGGTGG - Exonic
1165557273 19:36644929-36644951 AAAAATCTGGCCTGGAGTGGTGG + Intronic
1166592839 19:44016484-44016506 AAAAATATTGCATCTTCTGGTGG + Intergenic
1167834183 19:52052990-52053012 TATAATTTGGCATGTTTTTGTGG - Intronic
1168434843 19:56308645-56308667 AAAAAAATGTGATGTTTTGGGGG - Intronic
925334491 2:3084399-3084421 TACAATTTGGCATGTTTTTGCGG - Intergenic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
925594042 2:5537692-5537714 AAAAATCAGGCAAGTTATGGAGG - Intergenic
925678153 2:6388072-6388094 ATATATCAGGCATGGTTTGGAGG + Intergenic
926713372 2:15902157-15902179 AAAAATCAGCCAGGTTGTGGTGG + Intergenic
927265124 2:21138067-21138089 ATAAATCTGGCATTTGTTGAGGG - Exonic
928027226 2:27750360-27750382 AAAAATCTGCCAGGGCTTGGTGG - Intergenic
929626731 2:43416569-43416591 AAAAATGTGGCATCTCTTGGGGG + Intronic
929698648 2:44142225-44142247 AAAGGTCTGGAATGATTTGGTGG + Intergenic
930228361 2:48817955-48817977 AAACATATGGCAAGTTTTGTGGG - Intergenic
930794652 2:55375813-55375835 AAAAATATGGCCTGGTGTGGTGG - Intronic
931185923 2:59951319-59951341 AAAAATTTTGCATTCTTTGGGGG - Intergenic
932671405 2:73740702-73740724 AAAAATGTGGCAAGATATGGTGG + Intergenic
933540003 2:83627417-83627439 AAAAAACTGGCCTGGTATGGTGG - Intergenic
933816540 2:86073221-86073243 AAAAAAATGACAGGTTTTGGTGG + Intronic
935560284 2:104552014-104552036 AACAATCTGGCCTGGTGTGGTGG - Intergenic
937569335 2:123336272-123336294 AAAAATCTGAAATTTTTTTGAGG + Intergenic
938023979 2:127928901-127928923 AAAAATCTGGCAGGGCATGGTGG + Intergenic
938161988 2:128994344-128994366 AAAAATCTGGCAGTTATTGAGGG + Intergenic
938612970 2:132968330-132968352 AAAAATCAGGAATATTTTGAAGG + Intronic
938855611 2:135307351-135307373 AAAAATCTGGCCGGGTGTGGTGG - Intronic
938907815 2:135855189-135855211 AAAAATCTTGAATGTTTTAAAGG + Intronic
939952441 2:148490948-148490970 AAAAATCTGGTAGCCTTTGGAGG + Intronic
940187056 2:150997355-150997377 AAAAATCTGGAATAGTTTAGGGG - Intergenic
940430068 2:153579262-153579284 AAAAATCTGCCATGTCTTCCTGG - Intergenic
941280758 2:163547906-163547928 TAATATGTGGCAGGTTTTGGAGG - Intergenic
941422025 2:165294376-165294398 AAAAATGAGGGATGTTTTGGAGG + Intronic
942049590 2:172126872-172126894 AAGTATCTGGCAAGTTTTGGAGG - Intergenic
942308865 2:174635261-174635283 AAAATGCTGGCATATTTTGGAGG - Intronic
942738382 2:179142643-179142665 AAAGAACTGGCATTTTGTGGAGG - Intronic
943844930 2:192634049-192634071 AAAAATCAGGCCAGGTTTGGTGG - Intergenic
943973534 2:194441759-194441781 TAAAATTTGGTATGTTTTTGTGG - Intergenic
945481710 2:210352640-210352662 TACAATTTGGCATGTTTTTGCGG - Intergenic
945889971 2:215420060-215420082 AAAAACCTAGAGTGTTTTGGTGG + Intronic
946260533 2:218486703-218486725 AAAAATCTGGCTGGGTGTGGTGG - Intronic
947237424 2:227957050-227957072 AAAAATCTGCCATGTTTAATTGG + Intergenic
947397751 2:229702960-229702982 AAAATTCTACCCTGTTTTGGAGG + Intronic
1169041971 20:2502848-2502870 TACAATTTGGCATGTTTTTGAGG - Intronic
1170856348 20:20059367-20059389 AAAAATCTGGGATGCTGAGGTGG + Intronic
1171072440 20:22086646-22086668 AAAAATATGCCATGGCTTGGAGG - Intergenic
1171777471 20:29382515-29382537 AAAAAACTTGCTTGTTTTTGTGG + Intergenic
1172267576 20:33630077-33630099 AAGCCCCTGGCATGTTTTGGTGG + Intronic
1172825510 20:37780074-37780096 AAAAATCGAGCATGTTTATGTGG + Intronic
1172830832 20:37833056-37833078 AAATGTCTGTCATGATTTGGAGG + Intronic
1174681950 20:52417126-52417148 AAAAAACTGGAATTTTTTGTTGG - Intergenic
1174777734 20:53361154-53361176 AAGAATCTGACAAGCTTTGGGGG - Intronic
1174838913 20:53883385-53883407 AAAAATCTGGCCTGGTGAGGTGG - Intergenic
1174877206 20:54240045-54240067 TACAATTTGGCATGTTTTTGCGG - Intergenic
1175300916 20:57942158-57942180 CAAAAACTGGCATGATTCGGGGG + Intergenic
1176806658 21:13490425-13490447 AAAAATCTGGCCAGGTTTGGTGG + Intergenic
1177807801 21:25891171-25891193 AACAATCATGTATGTTTTGGTGG + Intronic
1177860347 21:26445348-26445370 AAAAATCTAGCAAGTTTTGGTGG + Intergenic
1179198868 21:39195098-39195120 AAGAAACTGTCATGTTTTGTGGG - Intronic
1179681408 21:43023899-43023921 AAAAATCTGGCCAGGTGTGGTGG - Intronic
1183960273 22:41407396-41407418 AAAAATCTGGCCGGGTGTGGTGG - Intergenic
1185225982 22:49652897-49652919 AAAAATCTGGCCAGGTGTGGTGG + Intronic
949563509 3:5224337-5224359 AATCATTTGGTATGTTTTGGAGG - Intergenic
949868511 3:8567286-8567308 AAAAATCTGGCATAAATTTGAGG - Intronic
951468443 3:23028914-23028936 AAAAATCTGGCATTACTTCGTGG + Intergenic
952153279 3:30615877-30615899 AAAAAACTGGCCGGTCTTGGTGG - Intronic
952406282 3:33008133-33008155 AAAAGTGTGGGATGTGTTGGAGG - Intronic
952550378 3:34470406-34470428 TACAATTTGGCATGTTTTTGTGG + Intergenic
952662567 3:35869352-35869374 AAAAATCTGGCACTATTTAGTGG + Intergenic
952796763 3:37245960-37245982 AAAAATGTGGCCTGGTATGGTGG + Intronic
954207667 3:49072371-49072393 AAAAATTAGGCAGGTGTTGGTGG + Intronic
955515926 3:59726308-59726330 GTAATTCTGGCATGGTTTGGAGG - Intergenic
957403084 3:79742226-79742248 AAAACTCTGAAATGTCTTGGAGG - Intronic
957408712 3:79808116-79808138 AAAAATCTGGAATGTCCTGTTGG + Intergenic
957849962 3:85794978-85795000 AATAATTTTGCATGTTTTTGGGG + Intronic
957903072 3:86522483-86522505 GAATCTCTGGCATCTTTTGGTGG + Intergenic
959228885 3:103621231-103621253 AAAAATTTGGCTGGGTTTGGTGG + Intergenic
959927268 3:111937481-111937503 AAAAATCTGGCTGGGTGTGGTGG + Intronic
960082127 3:113552891-113552913 AAAACCCTTGCATGTTCTGGAGG - Intronic
960382230 3:116977579-116977601 AAAAATCTGTCATTTTTTACTGG - Intronic
961022098 3:123516519-123516541 AAAAATCTGGCCGGGTATGGTGG - Intronic
961924332 3:130461250-130461272 AAAAAAGTGGCATGCTTTGGGGG + Intronic
963310437 3:143704703-143704725 AAAAATGTGGCTTGGTGTGGTGG + Intronic
964566588 3:158061764-158061786 AATAATCAGCGATGTTTTGGGGG - Intergenic
965418000 3:168421244-168421266 TACAATTTGGCATGTTTTTGCGG - Intergenic
966128540 3:176608511-176608533 AAAAACCCTGCATGTTGTGGTGG - Intergenic
966139740 3:176742540-176742562 AACAATTTGGCATTTTTTTGAGG - Intergenic
966607100 3:181832238-181832260 GAAGATCTGGCCAGTTTTGGTGG - Intergenic
966679899 3:182630903-182630925 AAAAAGCTTAGATGTTTTGGAGG - Intergenic
970244966 4:14051203-14051225 ATAAATCTGGCATGATTATGTGG - Intergenic
970287821 4:14538035-14538057 GAAAATCTGGCATTAATTGGTGG - Intergenic
970303123 4:14702538-14702560 AAAAAACTGGCAAGTTTAGTGGG + Intergenic
970384229 4:15540218-15540240 CAATAACTGGCATTTTTTGGTGG + Intronic
970942139 4:21646966-21646988 AAAAATCTAGAAAGTTTTGAGGG + Intronic
971788001 4:31129913-31129935 AAAATTGTGGCCTGTTATGGTGG - Intronic
973784404 4:54321558-54321580 AGCAACCTGGCATGGTTTGGGGG - Intergenic
974355792 4:60811075-60811097 AAACATGTTGCAGGTTTTGGAGG + Intergenic
975385342 4:73751824-73751846 AATAATCTGGCATATTTTAAAGG - Intergenic
975678905 4:76855462-76855484 AAAAATCTGGCATTTCTGGCAGG - Intergenic
976302041 4:83524572-83524594 TAAAAGCTGTCTTGTTTTGGGGG - Intergenic
976369743 4:84273888-84273910 AAAAATTATGCATGTATTGGAGG + Intergenic
976860732 4:89663257-89663279 ACAAATGTAGCATTTTTTGGTGG + Intergenic
977247746 4:94653594-94653616 AAAAATCGGTCATGTTGGGGAGG + Intronic
978026854 4:103887071-103887093 TAAAATATTGCATGTATTGGAGG - Intergenic
978128637 4:105166287-105166309 AAAAATGTGGCATAATTTTGAGG - Intronic
978152649 4:105455485-105455507 ACAAATCTCGTGTGTTTTGGAGG - Intronic
980466025 4:133183414-133183436 AAAAATCTGTAATGTTTCAGTGG + Intronic
980595143 4:134945148-134945170 AAAAATGTGGTCTATTTTGGTGG - Intergenic
981425568 4:144598822-144598844 AAAAATCAGGACAGTTTTGGGGG + Intergenic
981878071 4:149573262-149573284 TAATATTTGGCATGTTTTTGTGG - Intergenic
981999530 4:151009559-151009581 AAAAAACTAGCGGGTTTTGGTGG + Intronic
983311381 4:166066067-166066089 AAAAATCTGCCCCTTTTTGGAGG - Intronic
983742165 4:171149467-171149489 ACTACTTTGGCATGTTTTGGTGG + Intergenic
983901438 4:173139295-173139317 ATAAATCTGGAATGATGTGGGGG + Intergenic
983998104 4:174210400-174210422 GAAAATCTAGTAAGTTTTGGTGG + Intergenic
984020309 4:174477027-174477049 AAAAATTTGCCATGTGGTGGTGG - Intergenic
984125565 4:175805143-175805165 AAAAAGCTGTCAAGTTTTGGGGG + Intronic
984127700 4:175832697-175832719 AGAAATCTTGCATGGTTTGGGGG - Intronic
984292952 4:177818400-177818422 AATAATCTGGCCAGTTGTGGTGG - Intronic
986047221 5:4050806-4050828 AAAACTCTGGAATCTTTTAGAGG + Intergenic
986777709 5:11033541-11033563 AAAAATCTGGCCAGGCTTGGTGG + Intronic
987412622 5:17630003-17630025 AATTATCTTGCATATTTTGGGGG + Intergenic
987567316 5:19608360-19608382 AAAAATCCTGCATATTTTGATGG + Intronic
987838202 5:23188165-23188187 TATAATTTGGCATGTTTTTGTGG - Intergenic
988024893 5:25672909-25672931 AAAAATTTGGTGTGTTTTGATGG + Intergenic
990224564 5:53634899-53634921 AAAAATCTGGCTGGGTGTGGTGG + Intronic
990870720 5:60429053-60429075 ACAAATTTGGCATTTTTTGAGGG - Intronic
992223707 5:74597872-74597894 ACAAATCTGGCTTCTTTCGGTGG + Intergenic
992876086 5:81057236-81057258 TACAATTTGGCATGTTTTTGCGG + Intronic
993104072 5:83578724-83578746 GAGAATGTGGCATGTTTTTGTGG + Intronic
994131355 5:96232014-96232036 GAAAATATGGTATGTGTTGGTGG + Intergenic
994175950 5:96711360-96711382 AAAATTCTGGAATGCTCTGGGGG + Intronic
994292677 5:98047790-98047812 AAGAACCTGGCATACTTTGGAGG + Intergenic
996240457 5:121193972-121193994 AAAAATATGACCTGTGTTGGTGG - Intergenic
998026894 5:138824840-138824862 AGAAATCTGTTATCTTTTGGGGG - Intronic
999080319 5:148837400-148837422 GAAAATATAGCATGTTTTGAGGG + Intergenic
999523655 5:152379217-152379239 AAAGATCTTGCATGGTTTGCAGG + Intergenic
1000257865 5:159558036-159558058 TAAAATCTGGGATGCCTTGGAGG + Intergenic
1000598049 5:163238174-163238196 TACAATTTGGCATGTTTTTGCGG - Intergenic
1000969785 5:167700969-167700991 AAAAAGCTAGCAAGTTTTTGGGG + Intronic
1001128786 5:169046132-169046154 AAAAATAAGGCACCTTTTGGGGG - Intronic
1002030084 5:176421751-176421773 AAAAATCTGGCCAGGTATGGTGG - Intergenic
1004936283 6:20511522-20511544 AAAAAACTGGCCTGGTGTGGTGG - Intergenic
1006616800 6:35333994-35334016 TACAATTTGGCATGTTTTTGCGG - Intergenic
1006869956 6:37242520-37242542 AAAAGCCTGTCATGCTTTGGTGG + Intronic
1007124576 6:39414899-39414921 AAAAATCTGGCCAGGTGTGGTGG + Intronic
1008107505 6:47455170-47455192 AAAAAACTAGCCTGTTGTGGTGG + Intergenic
1010362007 6:75005721-75005743 TACAATTTGGCATGTTTTTGTGG - Intergenic
1010536959 6:77042885-77042907 AAGAATCAGGCATATTTTGTAGG - Intergenic
1011094557 6:83645557-83645579 AAAAATCTGGCCAGGTATGGTGG + Intronic
1011104978 6:83769457-83769479 CAAAATCTGTTTTGTTTTGGGGG + Intergenic
1011514110 6:88133746-88133768 AAAAATCTGGCTTATTTTTATGG - Intergenic
1011522469 6:88223908-88223930 AAAAGTCTGGGATGTTTTACAGG - Intergenic
1012304923 6:97642993-97643015 AAAAATCTGGCCTGGCCTGGTGG - Intergenic
1012808643 6:103928868-103928890 AAATATCTGTCATTTTTTAGGGG + Intergenic
1012849339 6:104428230-104428252 AGAAAGCTAGTATGTTTTGGGGG - Intergenic
1012902895 6:105028495-105028517 AAAATTCTGATATGTTTTGAAGG + Intronic
1013319486 6:108972953-108972975 AAAAGTCTGGCCAGTTGTGGTGG - Intronic
1013388586 6:109659066-109659088 AAAAATCTTTCATGTTTTCAAGG - Intronic
1013990501 6:116249837-116249859 AAAAATCTTGGAAGGTTTGGTGG + Intergenic
1014362720 6:120500014-120500036 AAAAATCTGACATATTCTTGGGG + Intergenic
1014515244 6:122369635-122369657 AAAAATTTGGGATTTTTTGGGGG - Intergenic
1015204510 6:130619545-130619567 AAAAATTTTGCATGTTTTACAGG - Intergenic
1015437591 6:133207368-133207390 TAAAATTTGACATATTTTGGTGG + Intergenic
1017689484 6:156949250-156949272 ATAATTCTGGCCTGTTTTAGGGG + Intronic
1018746510 6:166766511-166766533 AAAAATCTTGCCTGTTTCTGTGG + Intronic
1019107137 6:169677668-169677690 AGATATCTGGAATGTCTTGGAGG - Intronic
1020161236 7:5773526-5773548 AAAAATCTGGCTGGGTGTGGTGG - Intronic
1020608822 7:10370073-10370095 AATAATCTGTCATATTTTTGTGG - Intergenic
1020692393 7:11371909-11371931 AAAAATTGGGCATGTTTAGTGGG + Exonic
1022026827 7:26455926-26455948 AGGAAACTGGCATGTTTGGGTGG + Intergenic
1023332573 7:39134161-39134183 AAAAATCTGGCTGGGCTTGGTGG - Intronic
1024374297 7:48619910-48619932 AAAACTCTTGCCTGTTATGGAGG - Intronic
1025796308 7:64740720-64740742 AAACAGCTGGCCTGTTTTGCAGG + Intergenic
1027297840 7:76796318-76796340 ATGAATCTGGCATTATTTGGTGG - Intergenic
1027377560 7:77567969-77567991 ATAAAGCTGACATTTTTTGGTGG + Intronic
1028860504 7:95644539-95644561 AAAAAACTGACTTTTTTTGGAGG - Intergenic
1029813439 7:103071680-103071702 AAAAATCAGGCCTGGCTTGGTGG - Intronic
1030019701 7:105261232-105261254 AAAAATCTGGCCGGGTGTGGTGG + Intronic
1030815263 7:114028338-114028360 CATAATCTAGCATGTTTGGGAGG + Intronic
1031744590 7:125478123-125478145 AAAAATCTGGCTGGGTGTGGTGG + Intergenic
1032654922 7:133917280-133917302 AAGCATATGGTATGTTTTGGGGG - Intronic
1032707660 7:134435063-134435085 AAAAGTCAGGTAAGTTTTGGTGG - Intergenic
1034479387 7:151308008-151308030 AAGACTTTGGCATCTTTTGGGGG - Intergenic
1035210171 7:157321891-157321913 AAAACTCTTGCATTTTTTGATGG + Intergenic
1036786373 8:11690565-11690587 AAAAAGCTGGCCTGGTGTGGTGG + Intronic
1036828183 8:11996171-11996193 GTAAAACTGGCATATTTTGGGGG - Intronic
1036974878 8:13399283-13399305 AAAAAACTGGCATGTTGGGAAGG + Intronic
1037147950 8:15596262-15596284 AAAAATATGCCATGTTTTTAGGG + Intronic
1037460290 8:19101769-19101791 GAAAATCTAGAATGTGTTGGAGG - Intergenic
1037497141 8:19450755-19450777 AAAAATCTGGCTGGATGTGGTGG + Intronic
1037532005 8:19785962-19785984 AAAATTTTGGCAAGTTCTGGAGG + Intergenic
1038342945 8:26703452-26703474 AAAAATCTGGAAGGTTGTGCAGG + Intergenic
1038832942 8:31083049-31083071 AAATATTTGGCATTTTTTGAGGG + Intronic
1039102892 8:33959342-33959364 AAAATTCCTGCATGCTTTGGTGG + Intergenic
1040523732 8:48199796-48199818 CAGAATCTGGCAGGTTTGGGGGG - Intergenic
1041154584 8:54972232-54972254 AAAAAACTAGCCTGTTTTGGTGG - Intergenic
1041647813 8:60271506-60271528 AAAAAGTTGCCATGTTTGGGGGG + Intronic
1041816420 8:61977069-61977091 AAAAGTTTGGCATGTTTGTGGGG + Intergenic
1042732763 8:71955271-71955293 AAAAGTCAGGCATGAATTGGGGG + Intronic
1042946078 8:74156018-74156040 ACAGATCTGGCATGATGTGGAGG + Intergenic
1043651779 8:82603749-82603771 AAAAATCTCACATATTTTGTAGG - Intergenic
1044086718 8:87951701-87951723 AAAGATCAGTCATGTTTTTGAGG - Intergenic
1045803639 8:106130683-106130705 AAAAATCTGGCAATTTATGGAGG - Intergenic
1046066642 8:109205019-109205041 AAAAATCTGGCAGGCTTAGCTGG - Intergenic
1046488907 8:114921541-114921563 ATAAATCTGACAAGTATTGGTGG - Intergenic
1047036677 8:120947564-120947586 AAAAATCTGACAGGTTTTTTGGG + Intergenic
1048521060 8:135155713-135155735 TATAATTTGGCATGTTTTGGGGG + Intergenic
1050079143 9:1897018-1897040 TAAAATGTGGCATGATTTTGAGG - Intergenic
1050187534 9:2990851-2990873 ACAACTCTGGCATGTTTGGAGGG - Intergenic
1050228851 9:3494416-3494438 ACAAATCTGACTTTTTTTGGTGG - Intronic
1050433711 9:5587556-5587578 AATTATCTTCCATGTTTTGGGGG - Intergenic
1050728660 9:8681989-8682011 AAAATCCTTGCATGTTTTGTGGG - Intronic
1051343394 9:16131122-16131144 ATAACACTGGCGTGTTTTGGGGG + Intergenic
1051999206 9:23256120-23256142 AAAAATGTGGCATTTTTTTCTGG - Intergenic
1052045862 9:23793273-23793295 AAGTACCTGGCATGATTTGGTGG - Intronic
1053568231 9:39275805-39275827 TACAATTTGGCATGTTTTTGCGG - Intronic
1054128913 9:61343205-61343227 TACAATTTGGCATGTTTTTGCGG + Intergenic
1054776717 9:69130206-69130228 AAATATCTGTTGTGTTTTGGAGG + Intronic
1054932283 9:70648185-70648207 AAAAAACTGGCCAGGTTTGGTGG + Intronic
1055142691 9:72893699-72893721 AAAAATCTGCAATTGTTTGGAGG - Intergenic
1058063144 9:100520481-100520503 AAAAATCTGGCATTTTGGTGAGG + Intronic
1059868175 9:118540540-118540562 AAAAATATAGCATGTTGAGGAGG - Intergenic
1060443470 9:123664212-123664234 AAAAATCTATCAGGTTTAGGTGG - Intronic
1060950147 9:127596442-127596464 AAAAAACTGGCAAGGTGTGGTGG - Intergenic
1186574497 X:10750975-10750997 AAATATCTGGCCGGTTCTGGTGG + Intronic
1187831138 X:23381963-23381985 CACAATCTTGAATGTTTTGGGGG + Intronic
1188184772 X:27100334-27100356 AAATATCTGGCAGGGTGTGGTGG - Intergenic
1188691584 X:33136025-33136047 AAAAATCAGGCTGGGTTTGGTGG + Intronic
1189077015 X:37927046-37927068 AAAAAGATGGCATGATTGGGGGG + Intronic
1190178810 X:48174039-48174061 AAAAATCAGGCATGTTTGTCTGG + Intergenic
1190179619 X:48181055-48181077 AAAAATCAGGCATGTTTGTCTGG - Intergenic
1190190582 X:48273714-48273736 AAAAATCAGGCATGTTTGTTTGG + Intronic
1190654669 X:52600546-52600568 AAGAATCTGGCCTGTTTAGTTGG - Intergenic
1190991285 X:55553200-55553222 TACAATTTGGCATGTTTTTGCGG + Intergenic
1191751031 X:64542918-64542940 AAAAATGTGGCCAGGTTTGGTGG + Intergenic
1192373758 X:70538180-70538202 AAAACTCTGTCTTGTTTTGGGGG + Intronic
1192423801 X:71057822-71057844 AAAAATCTGGCCAGGTATGGTGG - Intronic
1193859681 X:86649933-86649955 AAAAATCTGGTAGATTTTGAAGG - Intronic
1195099198 X:101538199-101538221 TAAAATCTGGCATGTTCTTCAGG + Intergenic
1195623530 X:106983831-106983853 AAAAATCTGGCCAGGTGTGGTGG - Intronic
1195695799 X:107666380-107666402 AAAAATCTAGCCTGGTGTGGTGG - Intergenic
1196071101 X:111522986-111523008 AAAAATCTGGCCAGGCTTGGTGG - Intergenic
1196404958 X:115351398-115351420 AAAAGCCTTGGATGTTTTGGAGG - Intergenic
1196597102 X:117557693-117557715 TACAATTTGGCATGTTTTTGTGG - Intergenic
1197236110 X:124065989-124066011 AATAAACTTGCATGTTTTGTGGG + Intronic
1197461953 X:126753906-126753928 GAAACTCTGGCATCCTTTGGGGG + Intergenic
1197555942 X:127953772-127953794 AAAAATCTGGGAAGGTTAGGGGG - Intergenic
1197979736 X:132202839-132202861 ACCATTCTGGCATATTTTGGGGG - Intergenic
1198144768 X:133843785-133843807 AAAAATCTGGAAAGTTTCTGTGG + Intronic
1198206684 X:134472259-134472281 GAAAAACTGGCATGGTGTGGTGG - Intronic
1198262296 X:134975648-134975670 ATAAGTCTGGCATGTTGTAGTGG - Intergenic
1198571404 X:137960757-137960779 AAGGATCTGGGATTTTTTGGAGG - Intergenic
1199099541 X:143782482-143782504 CAAAAACTGGAATGATTTGGAGG + Intergenic
1201619897 Y:15945070-15945092 TACAATTTGGCATGTTTTTGTGG + Intergenic
1201679450 Y:16627197-16627219 AAAAATATGGCATCCTTTGCAGG + Intergenic