ID: 1158983059

View in Genome Browser
Species Human (GRCh38)
Location 18:62784129-62784151
Sequence CTTCACATGGGGCAGACAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158983059 Original CRISPR CTTCACATGGGGCAGACAGT GGG Intronic
900484051 1:2913157-2913179 CTTCACCCGGGGCAGGCAGGAGG - Intergenic
900774722 1:4573940-4573962 CAGCTCCTGGGGCAGACAGTGGG - Intergenic
900893587 1:5467171-5467193 CCTCACATGGGGCTGGCAGATGG - Intergenic
901211787 1:7530663-7530685 CTGCATATGGAGCACACAGTAGG + Intronic
902694900 1:18133641-18133663 CGTGCCATGGGGCAGACTGTTGG - Intronic
902707704 1:18217128-18217150 CTTGACCTGGGGCAGACGGGTGG - Intronic
902735903 1:18400626-18400648 GATCACTTGGGGCAGACACTAGG - Intergenic
903384226 1:22916246-22916268 CCCCACATGGGGCTGGCAGTCGG + Intergenic
904306542 1:29593822-29593844 CATCACCTGGGGCAGACAGTGGG - Intergenic
904856707 1:33503334-33503356 CTTGACATGGGGCCAACAGATGG - Intergenic
906644023 1:47460062-47460084 CTTCCCAGAGGGCAGCCAGTGGG + Intergenic
910321997 1:85956628-85956650 CTTCACGTGGGGCAGAAATGTGG + Intronic
910683527 1:89892128-89892150 CTTCATATGGGGCAAACATATGG - Intronic
918938455 1:190955812-190955834 TTTCACAAGGGACAGAAAGTAGG + Intergenic
920725702 1:208432991-208433013 CTTCCCTTGGGGCACACAGTGGG - Intergenic
920967600 1:210714059-210714081 CTTCACATGTGTCTCACAGTGGG - Intronic
921852553 1:219946663-219946685 CTTCTCAGTGGGCAGGCAGTTGG - Intronic
924897187 1:248352823-248352845 CCTCACAAGGGGAAGACAGAAGG + Intergenic
1064533098 10:16330194-16330216 CTTCACATGGGGTAGGTATTTGG + Intergenic
1065110437 10:22435819-22435841 CTTCACCTGGGGGAGGCTGTCGG + Intronic
1065965574 10:30767845-30767867 CTTCACATGGGGCCTCCCGTGGG + Intergenic
1072288253 10:93937802-93937824 CTTCAAATGGTTCAGAGAGTGGG + Intronic
1074448552 10:113540270-113540292 CAGCACATGTGGCATACAGTAGG - Intergenic
1075480193 10:122774368-122774390 CTTCTCATGGGCCTGCCAGTAGG - Intergenic
1076688141 10:132207397-132207419 CTGGACTTGGGGCAGCCAGTGGG - Intergenic
1077154895 11:1086919-1086941 CTGCACTTGGGGCAGGCAGAGGG - Intergenic
1078386369 11:10896476-10896498 GTGCACATGGGGCTGAGAGTGGG + Intergenic
1081637797 11:44732255-44732277 ATTATCATGGGGCAGACACTTGG + Intronic
1082785586 11:57314515-57314537 CCTCACATATGGCAGACACTTGG + Intronic
1085408721 11:76279113-76279135 CTTCACAAGGGGGTGACAGGTGG + Intergenic
1089169738 11:116503662-116503684 CTTCACTTGGAGCTGAGAGTTGG + Intergenic
1091034338 11:132219635-132219657 GTACACATGAGGAAGACAGTGGG - Intronic
1091204258 11:133808737-133808759 CTCCACAGGGGTCAGCCAGTGGG + Intergenic
1093539901 12:20269175-20269197 CTATACATGGGGCAGACTGATGG + Intergenic
1095514478 12:42990899-42990921 ATTCACATGTGCCAGGCAGTGGG + Intergenic
1097148299 12:56957071-56957093 CTTCCCAGGGAGCAGACAGGAGG + Intronic
1097908965 12:64948908-64948930 TGTCACATTGGGCAGGCAGTGGG + Intergenic
1099808717 12:87553328-87553350 CTTGAGATGCTGCAGACAGTGGG - Intergenic
1100990942 12:100250595-100250617 CTACACATGGTACAGACATTAGG - Intronic
1103326357 12:120123714-120123736 CTTCCCCTGGGGCAGGCAGCAGG + Intergenic
1104861748 12:131927736-131927758 CTTCCCAAGGGGCACTCAGTGGG - Intergenic
1105824577 13:24110625-24110647 CTTGCCATGGGCCAGACACTGGG + Intronic
1106367619 13:29097695-29097717 CTTCACATGGTGGAAACAGAGGG + Intronic
1107098300 13:36560319-36560341 CTTCACACTGTGCAGACAGCTGG + Intergenic
1108594501 13:51937940-51937962 CAGCACATGGAGAAGACAGTTGG - Intronic
1109660614 13:65454875-65454897 CTTTACATTTGGCAAACAGTCGG + Intergenic
1111361317 13:87181731-87181753 CTTCACAGGGGGTAGGAAGTGGG - Intergenic
1115497804 14:34024378-34024400 CTTCACAGGGAGCAAACTGTTGG + Intronic
1116608920 14:47040665-47040687 CAACACATGGGGCAGACAGAGGG - Intronic
1122178705 14:99939236-99939258 CTTCTCATGGGCCCGACAGACGG - Exonic
1122733412 14:103819744-103819766 CTTCAGATGGGGCAGAAACAGGG - Intronic
1133295233 16:4748732-4748754 CTTCCCACGGGGCAGACAGCAGG - Exonic
1133929131 16:10217980-10218002 CTTCTTATGAGACAGACAGTGGG + Intergenic
1136085303 16:27880695-27880717 CTTCTCATGGGGCAGGAAGTGGG - Intronic
1139774026 16:69302497-69302519 CTTCAGATGGGGCAGGCACAGGG + Exonic
1140193079 16:72834620-72834642 ATTCCCATGGGGCTGCCAGTTGG - Intronic
1143335816 17:6170806-6170828 CATCACATGGGGCAGCCGGCTGG - Intergenic
1144087216 17:11821682-11821704 CTTGTCCTGGGGTAGACAGTTGG - Intronic
1145910007 17:28537018-28537040 CTTCACATGCTGCAGAGAGCAGG - Intronic
1146050864 17:29552408-29552430 CTTCACTCTGGGCAGACAGAAGG - Intergenic
1146082528 17:29793923-29793945 CTATACAGGAGGCAGACAGTGGG - Exonic
1146414788 17:32621860-32621882 CCTCACATGGGGAAGAGAGGAGG - Intronic
1147772888 17:42879721-42879743 CTTGACCTGTGGCTGACAGTGGG + Intergenic
1151447315 17:74175790-74175812 CTTCCCATGGGGCAGACCTGGGG - Intergenic
1153574425 18:6506509-6506531 CTGCAGATGGGTCAGACAGGCGG + Intergenic
1154087275 18:11319667-11319689 CTTGAGATGGGGCAGAGAGAGGG - Intergenic
1155596100 18:27489340-27489362 TTTCCCATGGGGCAGAATGTGGG - Intergenic
1156229262 18:35138112-35138134 CCTCACATGTGCCAGACAGAAGG + Intronic
1158983059 18:62784129-62784151 CTTCACATGGGGCAGACAGTGGG + Intronic
1159137462 18:64352891-64352913 CTTCACAAGCGTTAGACAGTGGG - Intergenic
1160782048 19:881975-881997 CCCCCGATGGGGCAGACAGTGGG + Intronic
1161176543 19:2846011-2846033 CTTAACATTGGTCAGGCAGTCGG + Intronic
1165397514 19:35573918-35573940 CTTCTGATGGGACTGACAGTAGG + Intergenic
1165942793 19:39423621-39423643 CTGCTCCTGGGGCAGACAGGGGG - Exonic
1166741250 19:45116226-45116248 CTTCAGCTGCGGCAGGCAGTTGG + Intronic
1167784923 19:51628883-51628905 CTGCACATGGGGCTCACAGAAGG + Intronic
926012726 2:9421929-9421951 CTTCAGGTGGGGTATACAGTGGG - Intronic
926298660 2:11586861-11586883 CTTCATTTGAGGTAGACAGTGGG - Intronic
926358826 2:12066130-12066152 CTGCCCATGGGCCAGACACTTGG - Intergenic
927042484 2:19243587-19243609 CTTCACAAGAGGGAGACAGGAGG + Intergenic
932703459 2:74005979-74006001 GTTCCCATGGGGCAGAGTGTGGG - Intronic
933865693 2:86515156-86515178 CTACATATGGGGCTGTCAGTGGG - Intronic
934574313 2:95390747-95390769 CTTCACAGGGGTCAGAGATTGGG + Intergenic
936529221 2:113263748-113263770 CTCCACATGGGAAAGACTGTGGG + Intronic
936691519 2:114895352-114895374 CTTCTCCTTGGGCACACAGTAGG + Intronic
936865791 2:117074947-117074969 CCTCACAATGGGCAGACAGGAGG - Intergenic
940878490 2:158922213-158922235 CATCACATGGGGCAGCCACCTGG + Intergenic
942660448 2:178258540-178258562 CATCACGTGGGGCTGAGAGTTGG - Intronic
942789405 2:179741709-179741731 CATCATATGAGGCACACAGTAGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945977183 2:216280126-216280148 CCTCATATGGGACAGACAGGAGG - Intronic
948107502 2:235427406-235427428 CTTCAGATGAGACAGAAAGTGGG - Intergenic
1169729680 20:8773133-8773155 CATCACATGGGGAAGGGAGTTGG - Intronic
1169885998 20:10398544-10398566 GTCCACATTGGGCACACAGTTGG + Intergenic
1170722674 20:18897649-18897671 CTTGAGATGGGGCAGGGAGTCGG + Intergenic
1173254091 20:41381072-41381094 CTCCCTCTGGGGCAGACAGTAGG - Intergenic
1173837101 20:46133028-46133050 CTCCGGATGGGGCACACAGTGGG - Intergenic
1174093852 20:48071573-48071595 GTTGACATGGGCCAGGCAGTTGG - Intergenic
1179495838 21:41770850-41770872 CTTAACATGGTGCCCACAGTAGG + Intergenic
1181745085 22:24950580-24950602 CATCTCTTGGGGCAGAGAGTAGG + Intergenic
1182426101 22:30273618-30273640 GTTGCCATGAGGCAGACAGTTGG - Intergenic
1184996266 22:48209684-48209706 CTTCTCATGGCGCAGACAGAGGG + Intergenic
949525467 3:4899092-4899114 CTGCACCTGGAGCAGACAATTGG - Intergenic
953421520 3:42756997-42757019 CTTCAGATAGGGCAGACAGCAGG - Intronic
956099072 3:65748615-65748637 CATCAGATGTGGCACACAGTAGG - Intronic
957485049 3:80850116-80850138 CTTGACATGGGGCAGATTATGGG - Intergenic
958461142 3:94397511-94397533 CTTCACATGGTGAAGACAGAAGG - Intergenic
959143304 3:102512478-102512500 TTTCAAATGGGGAAGAAAGTGGG + Intergenic
960895787 3:122503639-122503661 CTATACAAGGGCCAGACAGTGGG - Intronic
961556600 3:127700509-127700531 CCTCACGTGGGGCAGACATGTGG - Intronic
965972181 3:174573162-174573184 CTTAACATGGCTTAGACAGTGGG + Intronic
966016224 3:175140908-175140930 CTTAAGATGGGGCAGAAAGGGGG + Intronic
969205027 4:5637257-5637279 GTTCACATGGGGCGCACAGCAGG + Intronic
970561721 4:17288041-17288063 CACCACTTGGGGCAGACAATAGG + Intergenic
970817903 4:20179301-20179323 CTGCACTTGGAGCAGCCAGTGGG - Intergenic
972992171 4:44834161-44834183 CTTCACATGGGGCTGTCTCTGGG + Intergenic
975710856 4:77158215-77158237 CTTCAGGTGGGGCAGACCGAGGG + Intronic
981173664 4:141654744-141654766 CTTAACTTGGGGCAGACTCTTGG + Intronic
983357938 4:166688392-166688414 CTTCAACTGGGGCAGACTTTTGG - Intergenic
983871739 4:172831830-172831852 CTTCACATGGTGGAGAGAGAAGG - Intronic
986667189 5:10114148-10114170 CTGTACATGGGGCAGGCAGAAGG + Intergenic
988393694 5:30669258-30669280 CTTCACATGGTGGTGTCAGTAGG - Intergenic
989703237 5:44296046-44296068 TTTCACATGGTGAAGACAGGAGG + Intergenic
990661477 5:58020304-58020326 TTTCACATGGCACACACAGTAGG - Intergenic
993526931 5:88976526-88976548 CTTCACAAGTGGAAGACAGAAGG + Intergenic
993860800 5:93134471-93134493 CTTCACTTGGTGCAGGCAGCTGG + Intergenic
997477069 5:134149450-134149472 TTTCACATGGGACAGCCACTGGG + Exonic
997997818 5:138600587-138600609 CTTCACATATGGCAGCCAGGTGG + Intergenic
1002050110 5:176565756-176565778 CCTGACATGGGGCAGACACAGGG - Intronic
1002953342 6:1837876-1837898 CCTCACAGGGAGCAGACAGGAGG + Intronic
1003441779 6:6149562-6149584 CCTCACATGGGGCAGAGAGAGGG - Intronic
1004461517 6:15841202-15841224 CATGACATGGGCCACACAGTAGG + Intergenic
1004870997 6:19903729-19903751 CTTCACATAGGGAAGAGAGAGGG + Intergenic
1004987584 6:21100111-21100133 TTTCACAGGGGACAGAGAGTGGG - Intronic
1007991411 6:46260109-46260131 CTTCCCAGAGGTCAGACAGTAGG + Intronic
1016797367 6:148132405-148132427 CTTCACATGCGATAGATAGTAGG - Intergenic
1017800723 6:157893462-157893484 CGACACATGGGGCAGACAGCTGG - Intronic
1018162325 6:161057602-161057624 CTTCACGTGAGGCACACAGGAGG - Intronic
1019976330 7:4584876-4584898 CTACAGATGGGACTGACAGTAGG + Intergenic
1019977266 7:4593380-4593402 CTACAGATGGGACTGACAGTAGG + Intergenic
1021483033 7:21139088-21139110 TTTCACAAGAGGCAGACAATAGG + Intergenic
1021874001 7:25031646-25031668 CCCCACATGAGGCAGACAGCAGG - Intergenic
1022204552 7:28150679-28150701 CCTCACACGGGGGAGACATTAGG + Intronic
1023832172 7:44045670-44045692 CCACACAAGGGGAAGACAGTTGG - Intronic
1024342011 7:48275252-48275274 CTTCACCTTGGGGAGACAGGTGG - Exonic
1026899692 7:74029908-74029930 CTTGACCTGGGGCAGAGAGCTGG - Intronic
1028470564 7:91202121-91202143 CATCACATGATGCTGACAGTTGG + Intronic
1028873434 7:95793823-95793845 CATCACATTGGGCACATAGTAGG - Intronic
1030628514 7:111870132-111870154 CTTCTCATGGGTCAGAAAATTGG - Intronic
1031979848 7:128117428-128117450 CATCACATGGGGGAGAGAGTTGG + Intergenic
1033667258 7:143453193-143453215 CTTCAAATGGGGCAAACTTTGGG + Intergenic
1035031950 7:155866496-155866518 TTTCACTTGGGGCTGGCAGTGGG - Intergenic
1035901460 8:3461941-3461963 CCTCACATGGGCCGGACAGGAGG + Intronic
1037698913 8:21254205-21254227 TTAGACATTGGGCAGACAGTTGG - Intergenic
1039624801 8:39037929-39037951 ATTCACATGGGGAAGACTATGGG - Intronic
1040678537 8:49781486-49781508 CTTAAAATGAGGCACACAGTAGG + Intergenic
1042655518 8:71091455-71091477 CTTCCCATGGGAAAGACTGTTGG - Intergenic
1043606792 8:82010400-82010422 CTGCATACTGGGCAGACAGTAGG - Intergenic
1044234564 8:89815552-89815574 TCTCATATGGGGCATACAGTTGG + Intergenic
1044632526 8:94293168-94293190 CCTCACCTAGGGCAGACAGCAGG + Intergenic
1047147472 8:122220217-122220239 CTTCACTTGAGGTAGACACTAGG - Intergenic
1048206742 8:132421564-132421586 ATTCACTTGGGGCAGATGGTGGG + Intronic
1051005832 9:12342425-12342447 ATAAACATGGGGCAGACATTTGG + Intergenic
1053173834 9:35908644-35908666 CTCCACATGGAGCAGGCTGTGGG - Intergenic
1053174936 9:35915879-35915901 CTCCACATGGGGCAAAGAGCAGG + Intergenic
1053462046 9:38278626-38278648 CTGCACTTGGGGCAGGGAGTGGG + Intergenic
1055406791 9:75983304-75983326 CTACACATGGGGCAAGCAATAGG - Intronic
1055665798 9:78551555-78551577 CTAAACAAGGGGCACACAGTAGG - Intergenic
1058040316 9:100295185-100295207 CTTCAAAGGAGTCAGACAGTCGG - Intronic
1062408332 9:136408754-136408776 CTTTACATGGGGCTCACAGCTGG - Intronic
1193584688 X:83306487-83306509 CTTCTCATGGGTGTGACAGTTGG + Intergenic
1195246438 X:102999585-102999607 CTAGGCATGGGGCAGACACTTGG - Intergenic
1199025930 X:142937793-142937815 CTTCAGGTGTGGCAGAAAGTTGG - Intergenic
1200985711 Y:9302541-9302563 CCACACACGGGGCAGTCAGTGGG - Intergenic