ID: 1158985831

View in Genome Browser
Species Human (GRCh38)
Location 18:62815583-62815605
Sequence AAGCCAGCTGCCCTGTCGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 3, 2: 86, 3: 207, 4: 445}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158985831_1158985837 7 Left 1158985831 18:62815583-62815605 CCTCACGACAGGGCAGCTGGCTT 0: 1
1: 3
2: 86
3: 207
4: 445
Right 1158985837 18:62815613-62815635 GGGAGTGATCCTAGAGAGAGAGG 0: 1
1: 0
2: 0
3: 27
4: 245
1158985831_1158985838 11 Left 1158985831 18:62815583-62815605 CCTCACGACAGGGCAGCTGGCTT 0: 1
1: 3
2: 86
3: 207
4: 445
Right 1158985838 18:62815617-62815639 GTGATCCTAGAGAGAGAGGAAGG 0: 1
1: 0
2: 5
3: 61
4: 398
1158985831_1158985839 14 Left 1158985831 18:62815583-62815605 CCTCACGACAGGGCAGCTGGCTT 0: 1
1: 3
2: 86
3: 207
4: 445
Right 1158985839 18:62815620-62815642 ATCCTAGAGAGAGAGGAAGGAGG 0: 1
1: 0
2: 6
3: 65
4: 625

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158985831 Original CRISPR AAGCCAGCTGCCCTGTCGTG AGG (reversed) Intronic
902060627 1:13639188-13639210 AAGTCAGCTGCCATGTTGTGAGG + Intergenic
902198103 1:14813359-14813381 AACGCAGCTGCCATGTTGTGAGG + Intronic
902272102 1:15312040-15312062 AAGCCAACCGCCATGTTGTGAGG - Intronic
902661169 1:17904978-17905000 AAGCCAGGTGCCATGTCATGAGG + Intergenic
903276449 1:22224961-22224983 AAGCCAGCTGCCATGTCATGAGG + Intergenic
903443745 1:23407516-23407538 AAGCCAAGTGCCCTGAGGTGGGG - Intronic
903785009 1:25854867-25854889 AAGCCAGCTGTCATGTTGTGAGG - Intronic
904795949 1:33056578-33056600 AAGCCAGGTGCCGTGTTGTGAGG + Intronic
905650104 1:39650588-39650610 AAGCCAACAGCCATGTCATGAGG + Intergenic
905872212 1:41411478-41411500 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
906290412 1:44616085-44616107 AAGTCAGCTGCCATGTCATAGGG - Intronic
906548102 1:46636839-46636861 AAGTCAGTTGCCATGTAGTGAGG + Intronic
906560168 1:46750746-46750768 AACCCAGCTGCCATGCCGTAAGG + Intergenic
907498178 1:54859149-54859171 AAGCCAGCTGCTTTGTCATGAGG + Intronic
907574433 1:55513387-55513409 AAGCCAGCTACCATGTTGTGAGG + Intergenic
907575470 1:55522025-55522047 AAGCCAGCTGCCATGTTGTGGGG + Intergenic
907950857 1:59182351-59182373 AAGCCAGCCACCATGTTGTGAGG + Intergenic
908832184 1:68190533-68190555 AAGCCCGCTGCCATGTTGCGAGG + Intronic
909873781 1:80778544-80778566 AAGGCAGCTGCTCTGTGCTGGGG - Intergenic
910122416 1:83804966-83804988 AAGCCAGCTGCCACTTTGTGAGG - Intergenic
910427310 1:87130488-87130510 CAGACAGGTGGCCTGTCGTGTGG + Intronic
910755377 1:90684511-90684533 AAGCCAGCTTGCATGTCGTGCGG - Intergenic
910924659 1:92386063-92386085 AAGCCACATGCCATGTTGTGAGG - Intronic
911305899 1:96231909-96231931 AAGCCAACTGCCGTGTGGTAAGG + Intergenic
911512927 1:98829080-98829102 AAGCCAGCTGCCATGTTATGTGG + Intergenic
911816681 1:102360991-102361013 AAGCCAGCTACCATGTCCTGAGG - Intergenic
912211682 1:107563687-107563709 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
912416333 1:109510267-109510289 AAGCCAGCTGCGCAGGAGTGAGG + Intergenic
912416498 1:109511700-109511722 AAGTCAGCTACCGTGTTGTGAGG - Intergenic
912428346 1:109613931-109613953 ATCCCAGCTGCCCTTTCCTGGGG + Exonic
912493648 1:110077314-110077336 AAGCCAGCTACCAGGTGGTGGGG - Intergenic
912598157 1:110900274-110900296 AAGCCAGCTTCCATGTCATAAGG - Intergenic
912940543 1:114040926-114040948 AAGCCAACTGCCATGTCATGAGG + Intergenic
912977831 1:114346192-114346214 AAGTCACCTGCCCTGCAGTGGGG + Intergenic
913083426 1:115411632-115411654 AAGCCAGGTGCCATGTTGTGAGG + Intergenic
913233521 1:116761487-116761509 AAGCTAGCTGCCATATTGTGAGG - Intronic
914441924 1:147715277-147715299 AAGCCAGCTGCCATGTCATGAGG - Intergenic
914856543 1:151355907-151355929 AACCCAGCTACCATGTTGTGAGG + Intergenic
915359742 1:155278567-155278589 AAGACAGCAGCCCTGTCCTTGGG + Intronic
915507764 1:156368285-156368307 CAGCCTGCTTCCCTGTGGTGTGG + Intergenic
916237985 1:162609577-162609599 AAGCCAGCTTCCTTGTCATGAGG - Intergenic
916317062 1:163460909-163460931 AAGCCAGCTGCCATGTGGTGAGG - Intergenic
916847904 1:168671974-168671996 AAGCCAGCTACTATGTTGTGAGG - Intergenic
917476661 1:175374759-175374781 AAGGCAGGTGCCCTGTGGAGTGG + Intronic
917514385 1:175695208-175695230 AAGCCAGCTGCCACATCATGAGG + Intronic
917794681 1:178524452-178524474 AAGCCGGCTGCCATGTTGTAAGG + Intronic
918103390 1:181396144-181396166 AAGCCAGATGCTATGTCATGAGG - Intergenic
918144491 1:181743508-181743530 AAGTCAGCTGCCTTGTAGGGAGG + Intronic
918533329 1:185547219-185547241 AAGCCAGATGACATGTCATGAGG - Intergenic
919346479 1:196386048-196386070 AAGCCAGCTGCCACATCATGAGG + Intronic
920254472 1:204645003-204645025 AAGCCCTCTGCCCTGCCCTGTGG - Intronic
921773824 1:219073968-219073990 AAACCAGCTTTCCTGTCCTGTGG - Intergenic
922128499 1:222753775-222753797 AAGCCATCTGCCATGTTATGAGG + Intergenic
922506785 1:226130934-226130956 AAGCCAGCTGCCATATTGTGAGG + Intergenic
923630218 1:235644804-235644826 GAGCCATCTGCCCTGCCCTGCGG - Intronic
1063607832 10:7538584-7538606 AATCCAGCCGCCATGTTGTGAGG - Intergenic
1064182553 10:13131194-13131216 AAGCCAGCTGCCATGACATGAGG - Intronic
1064315464 10:14251326-14251348 AGGCCAGCTGCTATGTCATGAGG + Intronic
1064366892 10:14716434-14716456 AAGCCAGCTGCCATGTCATGAGG - Intronic
1064432430 10:15282830-15282852 AGGCCACCTGTCCTGTTGTGTGG + Intronic
1064491863 10:15866573-15866595 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1066431265 10:35354088-35354110 AAGCCAGCTGCCCTATGGAGAGG - Intronic
1066752575 10:38673456-38673478 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1066964457 10:42249580-42249602 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
1067211425 10:44262812-44262834 AAGCCAGCTGCCATAAAGTGAGG - Intergenic
1068757572 10:60671757-60671779 AATCCAGCAGCCATGTTGTGAGG + Intronic
1068908464 10:62352596-62352618 AAGCTAGCTGCCATGTCATGAGG - Intergenic
1069959552 10:72071761-72071783 AAGGCAGCCGCCATGTTGTGAGG + Intronic
1070313481 10:75290417-75290439 AATCCAGCTGCCATGGTGTGAGG - Intergenic
1070872904 10:79773330-79773352 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1071152447 10:82651489-82651511 AAGCCATCTGCCATGTCATAAGG + Intronic
1071639827 10:87295481-87295503 AAGCCAGCTGCCATGCCGTGAGG - Intergenic
1071655407 10:87442471-87442493 AAGCCAGCTGCCATGCCGTGAGG + Intergenic
1071753130 10:88503984-88504006 AAGCCAACTGCCATGTCTTGAGG + Intronic
1071771658 10:88735628-88735650 AAGCCATATGCCCTGGCATGGGG + Intronic
1071910301 10:90224186-90224208 AAGCCAGCTGCCATATTGTAGGG + Intergenic
1071944610 10:90628858-90628880 CAGCCAGCTGCCTTGCCCTGTGG - Intergenic
1072176116 10:92923607-92923629 AAGCCAGCTGCCATGTCATGAGG - Intronic
1072281263 10:93867680-93867702 AAGCCAGCTTCCTTGTCATGAGG + Intergenic
1072333087 10:94372515-94372537 AAGCCTGCTGCTTTGTCATGAGG - Intergenic
1072686877 10:97542729-97542751 AACCCAGCTGCCCTGCCCAGAGG - Intronic
1072722758 10:97791049-97791071 AAGCCAGCTCCCATGTCGTGAGG - Intergenic
1072855687 10:98943671-98943693 AAGCCAGCTGTCATATCATGAGG + Intronic
1073257095 10:102159660-102159682 AAGCTAGCTGTCATGTCATGAGG - Intronic
1073442554 10:103561131-103561153 AAGCCAGCTGCCACGGTGTGGGG - Intronic
1073475476 10:103749798-103749820 AAGCCAGCTTCCATGTTGTAAGG + Intronic
1074224079 10:111466620-111466642 AACCCAGCTGCCAAGTCATGAGG + Intergenic
1075252022 10:120887738-120887760 AGGCCAGTTGTCATGTCGTGAGG - Intronic
1075527726 10:123200315-123200337 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1075809455 10:125214394-125214416 AAGCCAGCTGTCATGTCATGAGG - Intergenic
1075941446 10:126393735-126393757 CAACCAGCTGCCATGTCGTGAGG + Intergenic
1077269583 11:1669209-1669231 AAGACACCTGCCCTGCTGTGGGG + Intergenic
1077281126 11:1746740-1746762 AATGCAGCTGCCCTGCCGGGTGG - Intronic
1077354338 11:2108241-2108263 AAGCTGGCTGCCATGTTGTGAGG - Intergenic
1077365773 11:2161020-2161042 AGGCCAGGTGCCCTGCCTTGGGG + Exonic
1077494016 11:2876959-2876981 AACCCAGCTGCCATGCCATGAGG + Intergenic
1078256203 11:9661301-9661323 AAGCCAGCTGACGTGTTGTAAGG + Intergenic
1078368475 11:10725716-10725738 AAGCCGGCTGCCATGTTGTGAGG - Intergenic
1078391822 11:10941522-10941544 AAGTCAGCTGCTGTGTCATGAGG + Intergenic
1078828651 11:14956350-14956372 AAGCCAGATGCCATGTCAAGAGG - Intronic
1079246350 11:18755114-18755136 GAACCAGCTGCCCTGCAGTGTGG + Intronic
1079450746 11:20598159-20598181 CAGCCAGCTGCCCTTTAGAGGGG + Intergenic
1081436598 11:43033999-43034021 CAGCCCCCTGCCCTGTGGTGTGG - Intergenic
1081545634 11:44069714-44069736 AAGCCAGCTACCATGCCATGAGG - Intronic
1083157527 11:60833808-60833830 AACTCACCTGCCATGTCGTGAGG - Intergenic
1083493503 11:63030578-63030600 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1083981246 11:66172432-66172454 ATGCCGGCTGCCATGTCATGAGG + Intronic
1084199550 11:67546433-67546455 AAGCCAGCTGCCATGTCATGAGG + Intergenic
1084728172 11:70955630-70955652 CAGCCTGCTGCCCTGTCCTATGG - Intronic
1084971935 11:72776854-72776876 AACCCAGGTGGCCTGTGGTGTGG + Intronic
1085392691 11:76190466-76190488 GAGCCTGCTGCCCTGGCCTGTGG + Intronic
1085536632 11:77224495-77224517 AAGTAAGCTGCCATGTTGTGAGG + Intronic
1085729872 11:78988173-78988195 AAACCAGCTGCCATGTTGTGAGG + Intronic
1086858014 11:91890133-91890155 AAAGCAGCTGCCATGTTGTGAGG + Intergenic
1086980676 11:93195056-93195078 AAGCCAGCTGTCATGTTGTGAGG - Intronic
1087611497 11:100439399-100439421 AAGCCAGCTGCTGTGTTGTGAGG - Intergenic
1087939727 11:104080837-104080859 AAACCAGCTGCCATGTCATGAGG + Intronic
1088568653 11:111199401-111199423 AAGCCAGCTGCCCTGTTATGAGG + Intergenic
1089355707 11:117851327-117851349 AAGCTAGCTGCCATGTCTTAAGG + Intronic
1090019614 11:123116062-123116084 AAGCCAGCTGCCGTGTGGTGAGG - Intronic
1090040595 11:123287594-123287616 CAGCCATCTGCCATGTCATGAGG - Intergenic
1090520343 11:127472737-127472759 AAGTCAGCTGCCGTGTAATGAGG + Intergenic
1090964529 11:131586447-131586469 GAGCCAGCTGCCATGTTGTGAGG + Intronic
1090964695 11:131588259-131588281 TGGCCAGCTGCCATGTTGTGAGG - Intronic
1091234014 11:134007557-134007579 AAGCCAGCTACCATGTCCTGAGG - Intergenic
1091501308 12:1020696-1020718 AATCCAGCTGCCATGTCGTGAGG - Intronic
1092251018 12:6896970-6896992 AAGCCAGCTGCCATGTTATGAGG + Intronic
1092283832 12:7117168-7117190 AAGCCAGCTGCTATGCCGCGAGG - Intergenic
1092337794 12:7649143-7649165 AAGCCAACTGCCATGTCCTGAGG + Intergenic
1092911731 12:13151663-13151685 AAGCCAGCGGCCATCTTGTGAGG - Intergenic
1093096057 12:14973529-14973551 CAGCCACCTGCCCTGCCCTGTGG - Intronic
1093167239 12:15818077-15818099 AACCCAACTGCCATGTTGTGAGG - Intronic
1093178120 12:15936037-15936059 AAGCCAGCTGCCATGTCATAAGG - Intronic
1093310982 12:17584474-17584496 AAACCAACTGCCATGTCATGAGG + Intergenic
1093511670 12:19936473-19936495 TAGCCAGCTGCCATGTTGTGAGG + Intergenic
1094048168 12:26190319-26190341 AAGCCAGCCACCATGTTGTGAGG + Intronic
1094091444 12:26654730-26654752 AAGCCAGGTACCATGTCATGAGG + Intronic
1094092436 12:26665580-26665602 AAGCAAGCTGCCTTGTCTTGAGG + Intronic
1095577051 12:43752299-43752321 AAGCCAGCTGCTATGCTGTGAGG - Intronic
1095833838 12:46615904-46615926 AAGGGAGCTGCCATGTCCTGAGG - Intergenic
1096511639 12:52133166-52133188 CAGCCAGCTGCCATATCATGAGG + Intergenic
1097548579 12:61037107-61037129 AAGCCAGCTGCGCTGTCATAAGG - Intergenic
1097959307 12:65516991-65517013 AAGCCAGCTGCCATGCTGTAAGG + Intergenic
1097970432 12:65627493-65627515 AAGCCAGCTGCCATGTTATAAGG - Intergenic
1098021324 12:66159293-66159315 AAGTCAGCTGCCATGTCATGAGG + Intronic
1098493042 12:71104526-71104548 AAGCCAGCTACCTTGCTGTGAGG - Intronic
1098974075 12:76883957-76883979 AAGCCAGCTGCCATGTCAGGAGG + Intergenic
1099084455 12:78227890-78227912 AAGCTAGCTGCCATGTTGTGAGG + Intergenic
1100198699 12:92275873-92275895 AAACCAGCTACCATGTCTTGAGG + Intergenic
1100200270 12:92290662-92290684 AAGCCAGCTGTCATGTTTTGAGG + Intergenic
1100218912 12:92482731-92482753 AAGACAGCTGCCATGTTGAGAGG + Intergenic
1101150952 12:101881973-101881995 AAGGGATCTGCCCTGTCCTGGGG - Intronic
1101857623 12:108457011-108457033 AAGTCAGCCGCCATGTCATGAGG + Intergenic
1101864327 12:108508939-108508961 AAGCCAGCTGCCATGTTGAGAGG + Intergenic
1101912133 12:108867929-108867951 AATCCAGCTACCATGTCATGGGG + Intronic
1102165128 12:110799993-110800015 AATCCAGCTGCCATGTTGTGAGG + Intergenic
1102630839 12:114278081-114278103 AAGCCAGCTGCCATGTCATTGGG - Intergenic
1102710087 12:114918224-114918246 AAACCAGCTGCCATGTGGTGAGG + Intergenic
1102774010 12:115503065-115503087 AAGCCAGCTGCCATATTGTGAGG + Intergenic
1102775767 12:115517533-115517555 AAGCCTGCTGCCATATTGTGAGG + Intergenic
1102881500 12:116488492-116488514 AAGCCAGCTGCCATGTTGTAAGG - Intergenic
1103202342 12:119098101-119098123 AAGCCAGCCGCCATGTTGTGAGG + Intronic
1104274840 12:127317168-127317190 AAGCCAGGTGCCCTCTCAAGAGG + Intergenic
1104442121 12:128802280-128802302 CTGTCAGCTGCCCTGTCGGGAGG - Intronic
1105022025 12:132823118-132823140 AAGGCAGCTGCCTTGGAGTGGGG + Intronic
1105313968 13:19239752-19239774 AAGCCAGCTGCTATGCGGTGCGG - Intergenic
1105335059 13:19459776-19459798 AAGCCAGCTGTGCTGTGTTGTGG + Intronic
1105627744 13:22129632-22129654 AACCCAGCTGCCATGTTGTGAGG - Intergenic
1105753727 13:23445708-23445730 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1105859864 13:24399612-24399634 AAGCCAGCTGTGCTGTGTTGTGG - Intergenic
1105986135 13:25569542-25569564 AAGCAAGCTTCCTTGTCCTGGGG - Intronic
1106212331 13:27661462-27661484 AAATCAGCTGCCCTGTCCTGTGG + Intronic
1106509744 13:30402595-30402617 AAGCCAGCTACCCTGTCCCATGG - Intergenic
1107306459 13:39025516-39025538 AAGCCAGCTGCCATGTCATGAGG + Intronic
1108966848 13:56317982-56318004 AAGCCAGTTGCAGTGTTGTGAGG + Intergenic
1109110526 13:58313382-58313404 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1109304011 13:60618867-60618889 AAGCCAGCTGCCAGGTCATGAGG - Intergenic
1109795403 13:67305657-67305679 AAGCCAGCTGCCATGTCATGAGG + Intergenic
1110647620 13:77906548-77906570 AGGCCAGCTGCCATGTCATGAGG + Intronic
1110729558 13:78864575-78864597 AAGTCAGCTGCTATGTCATGAGG - Intergenic
1111593717 13:90384000-90384022 AAGCCAGCTGTCATTTTGTGAGG - Intergenic
1111692146 13:91578053-91578075 AAGCCAGCTGCCATGTTGTAAGG + Intronic
1112241211 13:97683432-97683454 AAGCAAGCTGCCATGTCATGAGG + Intergenic
1112731431 13:102367363-102367385 AAGCCAGCTGCCATCAGGTGGGG - Intronic
1112788649 13:102979688-102979710 AAGCCAGCTGCCAAGTCATGAGG - Intergenic
1113412470 13:110102268-110102290 AAGCCACCTGCCATGTCATGAGG + Intergenic
1113529667 13:111013121-111013143 AATCCAGCTGCCATGCCGTAAGG - Intergenic
1114457007 14:22862007-22862029 AAGCCAGCTGCCATGTTATGAGG + Intergenic
1114595680 14:23909732-23909754 AAGCCAGCTACCATGTTGTGAGG - Intergenic
1114677872 14:24457157-24457179 AAGCCAGCTGCCATGTCATAAGG - Intergenic
1115555856 14:34544632-34544654 ACGCAGGCTGCCGTGTCGTGAGG - Intergenic
1115558052 14:34558455-34558477 ACGCAGGCTGCCGTGTCGTGAGG + Intergenic
1117049885 14:51849255-51849277 AAACCAGGTGCCATGTTGTGAGG - Intronic
1117802184 14:59455722-59455744 AACCCAACTGCCATGTTGTGAGG - Intronic
1118169306 14:63370900-63370922 AACCCAGCTGCCATGCTGTGAGG + Intergenic
1118243541 14:64084992-64085014 AAGCCAGCTGCCATGGTGTGAGG - Intronic
1118305596 14:64652412-64652434 AAGTCAGCTGCCATGTTGTGAGG - Intergenic
1118734788 14:68693526-68693548 AAGCCATCTGTGATGTCGTGAGG - Intronic
1118776926 14:68979111-68979133 ACGGCTGCTGCCCTGGCGTGGGG + Exonic
1118860745 14:69661162-69661184 AAGGAAACTGCCCTGGCGTGTGG + Intronic
1119157725 14:72426964-72426986 AATCCAGCTGCCCTGCTGTGAGG + Intronic
1119551517 14:75517392-75517414 GAGCCAGTTGCCATGTCATGGGG + Intergenic
1119586119 14:75837291-75837313 AAGTCAGTTGCCATGTCATGAGG - Intronic
1120145097 14:80970616-80970638 ATGCCAGCTTCCCTGCCATGTGG - Intronic
1121434334 14:93909139-93909161 AAGCCAGCTGCCATGTTGTGGGG - Intergenic
1121656929 14:95604070-95604092 CAGAAAGCTGCCATGTCGTGAGG + Intergenic
1122814317 14:104304833-104304855 AAGCCTGCAGCCCTTTGGTGAGG + Intergenic
1124456728 15:29849992-29850014 AAGCCAGATGCTCTGTCATGAGG + Intronic
1124627032 15:31313865-31313887 AAGCCAGCTGCCATGTTATGAGG + Intergenic
1125275005 15:37979973-37979995 AAGACAGCTGCACTGTGTTGGGG + Intergenic
1125294982 15:38192704-38192726 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1125445741 15:39754109-39754131 AAGTCAGCTACCATGTTGTGAGG + Intronic
1125693707 15:41617727-41617749 AAGCTAGCTGCCATGTTGTAAGG + Intergenic
1125730763 15:41891677-41891699 AAGCCAGGTGCCTTGAGGTGGGG + Intronic
1126116558 15:45213116-45213138 AAGCCAGATGCCATGATGTGAGG + Intergenic
1126358293 15:47819247-47819269 AAGCCAGCTGCCATGGAATGAGG + Intergenic
1126380236 15:48038970-48038992 GACCCAGCTGCCATGTTGTGAGG - Intergenic
1126756564 15:51931048-51931070 AAGCCACCTGCCATGCCGTGAGG + Intronic
1127325612 15:57892167-57892189 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1127434992 15:58948678-58948700 AATCCATCTGCCATGTTGTGAGG + Intronic
1127526853 15:59801701-59801723 AGGCCAGTTGCCATGTCTTGAGG + Intergenic
1127582886 15:60353780-60353802 AAGCCGGCTGCCATGTTGTGAGG + Intronic
1127787990 15:62373036-62373058 AAACCAGCTGCCATGTTGTGAGG + Intergenic
1127865034 15:63025633-63025655 AAGCCAGCCACCATGTCATGTGG + Intergenic
1128244395 15:66123334-66123356 AAGCCAGATGCCCTGATATGGGG + Intronic
1128566761 15:68705881-68705903 AAGCCAGTTAACCTGTCTTGAGG - Intronic
1129162638 15:73755112-73755134 AATCCAGCTGCCCTGGGTTGGGG + Intergenic
1129766405 15:78171995-78172017 AAGCCGGCTGCCATGTTGTGAGG + Intronic
1130271680 15:82454134-82454156 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130464028 15:84181521-84181543 AAGCCAGTTGCCATGTGATGAGG - Intronic
1130474829 15:84255451-84255473 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130482245 15:84369507-84369529 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130488656 15:84413312-84413334 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1130500239 15:84492020-84492042 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1130507794 15:84562499-84562521 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1130586324 15:85186153-85186175 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1130978957 15:88799511-88799533 AAGCCAGCTGCCATGTCATGAGG + Intergenic
1131117459 15:89803864-89803886 AAGCCAGCTGCCCAGGGGTCTGG - Intronic
1131194667 15:90346014-90346036 AAGCCAGCTGACACGTTGTGAGG + Intergenic
1131563828 15:93467623-93467645 AAGCCACCTGCCATGTTGTGAGG - Intergenic
1132027167 15:98413304-98413326 AAGCCAGCTGCCATGTCATAAGG + Intergenic
1132156543 15:99499764-99499786 AAGCTGGCTGCCATGTTGTGAGG + Intergenic
1132388639 15:101421559-101421581 AAGCCAGCTACCATGTTATGGGG + Intronic
1132428126 15:101737812-101737834 AAGCCAGTTGCCATGTGATGAGG + Intronic
1132654925 16:1037757-1037779 AAGCCAGCAGCCATGTCGGGAGG + Intergenic
1132693878 16:1193592-1193614 ATGCCAGCTGCCTTGGCGGGAGG + Intronic
1133154420 16:3862763-3862785 AAGCTGGCTGCTCTGCCGTGGGG - Intronic
1134064164 16:11216441-11216463 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1134157506 16:11855573-11855595 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1134435878 16:14256531-14256553 AAGCCAGCTGTCATGCCATGTGG + Intronic
1134572162 16:15300412-15300434 AAGCCAGCTGCCATGTTTTGAGG - Intergenic
1134730219 16:16455636-16455658 AAGCCAGCTGCCATGTTTTGAGG + Intergenic
1134789158 16:16972895-16972917 AAGCCAGATTCCATGTCATGAGG + Intergenic
1134937212 16:18256263-18256285 AAGCCAGCTGCCATGTTTTGAGG - Intergenic
1135036726 16:19084763-19084785 AAGCTAGCTGTCATGTCATGAGG + Intergenic
1135038684 16:19100357-19100379 AAGACAGCTGTCCTGTTGTGAGG - Intergenic
1135358820 16:21793585-21793607 CAGCCAGATGCTCTGTCATGAGG + Intergenic
1135457376 16:22610021-22610043 CAGCCAGATGCTCTGTCATGAGG + Intergenic
1135652916 16:24222480-24222502 AAGCCAGCTGCCATGTCCAGAGG - Intergenic
1135860688 16:26053021-26053043 ACGCTAGGTGCCCTGTCCTGTGG - Intronic
1136104583 16:28020757-28020779 AAGCCAGCTGCCATGTTGTGAGG + Intronic
1136730148 16:32403575-32403597 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
1137877895 16:52014730-52014752 AAGGCAGCTGCTCTTTGGTGGGG - Intronic
1138524651 16:57595828-57595850 AAGCTAGCTGCCATGTCATGAGG - Intergenic
1139271683 16:65689676-65689698 AAGCCAGCTGCCATGTTGTAAGG - Intergenic
1139396154 16:66640798-66640820 AAACCAGCTGCCATGTCTTGAGG + Intronic
1140831632 16:78756943-78756965 AAGCCAGCTGCCATGTTGGGAGG + Intronic
1141625421 16:85258890-85258912 CCGCCAGCTGCCCTGCCGCGTGG + Intergenic
1141663014 16:85451907-85451929 AAGCCAGGTGGCCTGTTATGAGG - Intergenic
1141816430 16:86412869-86412891 AATCCAGCTGCCATGTTGTGAGG + Intergenic
1142010388 16:87710984-87711006 AAGCCAGTTGCCCTGGGCTGAGG - Intronic
1202996253 16_KI270728v1_random:113733-113755 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1203022940 16_KI270728v1_random:426075-426097 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1142514806 17:420689-420711 AAGCCAGCTGCAGTGTTGTGTGG + Intronic
1142643033 17:1295651-1295673 AAGCCAGCTTGCCTGGTGTGAGG + Intronic
1143306233 17:5949009-5949031 AAGCCAGCTCCCATGTCGCAAGG - Intronic
1143354876 17:6319465-6319487 AAGTCAGCTGCCATGCCATGAGG - Intergenic
1143907162 17:10218137-10218159 AAGCCAGCTGCCATGTCATAAGG - Intergenic
1143978975 17:10851551-10851573 AAGCAAGCTGCCACGTTGTGAGG - Intergenic
1144389066 17:14776893-14776915 AAACCAGCTGTCATGTCATGAGG + Intergenic
1144580836 17:16458380-16458402 AAGCCAGCTGCCATGATGTGAGG + Intronic
1144793896 17:17878185-17878207 AAGCCAGGTCCCCTGGAGTGTGG + Intronic
1146138717 17:30345993-30346015 AAGTCAGCTGCCATGTTGTGAGG + Intergenic
1146508773 17:33427945-33427967 AAGCCAGCAGCCATGTTGTCAGG + Intronic
1146686233 17:34843326-34843348 AAGCCAGCCGCCATGTTGTGAGG + Intergenic
1147017333 17:37502763-37502785 AACCCAGCTGCCATGCTGTGAGG - Intronic
1147242552 17:39100055-39100077 AAGCCAGCTGCCATATCATGGGG + Intronic
1147573860 17:41587586-41587608 AGGCCACCTGCCCTATGGTGTGG - Intergenic
1147972988 17:44229784-44229806 AAGCCAGCCATCCTGTCTTGGGG + Intergenic
1148191149 17:45679520-45679542 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1148226264 17:45899896-45899918 AAACCAGCTGCCCCGTCATATGG - Intronic
1148357300 17:46984001-46984023 AAGCCAGCCGCCATGTCATGAGG - Intronic
1148681206 17:49474596-49474618 AAGCCAGCTGCTATGTTGTAAGG + Intronic
1149207177 17:54261756-54261778 GAGTCAGCTGCCATGTCATGAGG - Intergenic
1149343971 17:55715777-55715799 AAGCCATCTACCATGTCCTGAGG - Intergenic
1149422719 17:56526823-56526845 AAGCCAGCTGCCATGTCCTAGGG + Intergenic
1149487037 17:57050555-57050577 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1149511607 17:57246716-57246738 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1150431239 17:65119155-65119177 AAGTCAGCTGCCATGTTGTGAGG + Intergenic
1150458660 17:65328768-65328790 AAGCCAGTTGCCATGGTGTGAGG + Intergenic
1150475232 17:65470041-65470063 AGGCCAGCCGCCATGTCATGAGG + Intergenic
1150966457 17:69974771-69974793 AAACCAGCTGCCAGGTCTTGAGG - Intergenic
1151432673 17:74074723-74074745 AACCCAGCTGCCATGTTGTGAGG + Intergenic
1151647333 17:75442176-75442198 AAGCCAGAAGCCATGTCCTGAGG + Intronic
1151833902 17:76571019-76571041 AAGTTAGCTGCCATGTCGTGAGG + Intronic
1152016589 17:77755070-77755092 AAGTCGGCTGCCATGTTGTGAGG + Intergenic
1152300444 17:79492430-79492452 AAGTCAGCCGCCCTGTCATGAGG + Intronic
1152368765 17:79872078-79872100 AAGGCAGCTGTGCTGTGGTGGGG - Intergenic
1153337556 18:3940113-3940135 AAGCCAGCAGCCATGTTGTAAGG + Intronic
1153543211 18:6179523-6179545 AAGACATCTGCCCTGCTGTGGGG + Intronic
1153562452 18:6384792-6384814 AAGCCAGCTGCCATGTTATGAGG + Intronic
1153710851 18:7797278-7797300 AAGCCTCCTGTCCTGTCCTGAGG + Intronic
1154120705 18:11650078-11650100 AAACCAGCTGCCATGCTGTGAGG + Intergenic
1155210095 18:23593109-23593131 AAGCCAGCTGCCAAGTCCTGAGG - Intergenic
1155240922 18:23862940-23862962 AAGCCAGCTGTCATGTCATGAGG - Intronic
1155258112 18:24015352-24015374 AAGCCAGCTGCCCTGCAGAGAGG - Intronic
1155367124 18:25059679-25059701 GAGCCCGATGCCCAGTCGTGTGG + Intergenic
1155622396 18:27794692-27794714 ATGCCAGGTCCCCTGTAGTGTGG - Intergenic
1155768793 18:29671840-29671862 AAGACAGCTGCTCTGTGCTGTGG - Intergenic
1157219563 18:45817710-45817732 AAGCCAGCTGACATGTCATGAGG - Intergenic
1157845243 18:50998121-50998143 AAATCAGCTGCCATGTCATGAGG - Intronic
1158071946 18:53481034-53481056 AAGCCAGGTGTCATGTCTTGGGG - Intronic
1158895665 18:61910390-61910412 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1158985831 18:62815583-62815605 AAGCCAGCTGCCCTGTCGTGAGG - Intronic
1159758734 18:72398312-72398334 AAGTCAGCTGCCCTGTTGTGAGG + Intergenic
1160102877 18:75939404-75939426 AAGCCAGCTGCCATGTCAGGAGG - Intergenic
1161005350 19:1932968-1932990 AACCCAGCTGCCATCTTGTGAGG - Intergenic
1161025723 19:2035859-2035881 AACACAGCTGCCATGTTGTGAGG + Intergenic
1161143169 19:2660854-2660876 AAGCCAGCTGCCATGTTGTGGGG + Intronic
1161349550 19:3784379-3784401 AGGCCAGCTCCCCTGGCTTGGGG + Exonic
1162345658 19:10116705-10116727 AAACCCGCTGCACTGTCGTGCGG + Intronic
1162495252 19:11019822-11019844 AAGACAGCTGCCCTGTGTAGGGG + Intronic
1164632838 19:29773010-29773032 AAGTCAGCTGCCCTGACGCCGGG - Intergenic
1164757600 19:30702081-30702103 AAGCCAGCTGCCCACAAGTGTGG + Intronic
1164870933 19:31642137-31642159 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1165115695 19:33527255-33527277 GTGCCAGCTGCCATGTCCTGGGG - Intergenic
1166431313 19:42730233-42730255 AGGCCAGCTGCTCTGTCTTAGGG + Intronic
1166434436 19:42755443-42755465 AGGCCAGCTGCTCTGTCTTAGGG + Intronic
1166934961 19:46326254-46326276 AAGCCAACTGCCATGTTGTGAGG - Intronic
1167170367 19:47827004-47827026 AAGCCAGCCGCCATGTTGTGAGG - Intronic
1167274614 19:48529270-48529292 AAGCTGGCTGCCATGTTGTGAGG - Intergenic
1167478797 19:49716298-49716320 AAGCCAGCCACCATGTCATGAGG + Intergenic
1167774528 19:51545982-51546004 AAGCCAGGAGCCCTGGAGTGAGG + Intergenic
925413558 2:3654191-3654213 AAGCCAGCTGCCTTGTCATAGGG - Intergenic
925645021 2:6027132-6027154 AAGACAGTTGCCCTGTGGAGAGG + Intergenic
927055208 2:19360432-19360454 CAGCCAGAGGCCCTATCGTGTGG - Intergenic
927195838 2:20546148-20546170 AAGCCAGTGGCCATGTTGTGAGG + Intergenic
927387025 2:22546426-22546448 AAGTCAGCTGCTATGTCATGAGG + Intergenic
927852603 2:26509853-26509875 AAGTCAGCTTCCCTGTCTTCTGG + Intronic
928124921 2:28608662-28608684 CAGCCAGCTGCCCTGGGGTTAGG - Intronic
928279369 2:29930577-29930599 AAGCCAGTTGCCATGTTGTAAGG + Intergenic
928399618 2:30968474-30968496 AAGCCAGCTGCCATGCTGTGGGG + Intronic
929027470 2:37618416-37618438 ATCCCAGCTGCCATGTTGTGAGG - Intergenic
929089859 2:38204570-38204592 AAGCTAGCTCCCATGTCGTGAGG - Intergenic
929191697 2:39146312-39146334 AAGCTAGCTGCCATGTCATGAGG - Intergenic
929563900 2:42972971-42972993 AAGACACCTGCCATGCCGTGAGG - Intergenic
929569015 2:43008188-43008210 AAGCCAGCTGCCATGTCATAAGG - Intergenic
929929505 2:46241468-46241490 AAGCCAACTACCATGTTGTGAGG - Intergenic
930208621 2:48613733-48613755 AAGCCAGCTGTCATGTCATGAGG - Intronic
930996767 2:57728919-57728941 AAGCCAGCTGCTTTGTCATAAGG - Intergenic
931130997 2:59335683-59335705 AAGCCAGCTGCCATGTCATGAGG + Intergenic
931318159 2:61151675-61151697 AAGCCAGTTGCCATGTTGTAAGG - Intronic
931384644 2:61787185-61787207 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
931455705 2:62408281-62408303 AAGCCAGCTGCTGTGTTGTAAGG + Intergenic
932562891 2:72888090-72888112 AAGGCACCTGCCTTGCCGTGGGG - Intronic
933379783 2:81527858-81527880 AAGCCAGCTTCCATGTCTTGAGG + Intergenic
933484023 2:82896150-82896172 AAGACAGCTGCACTGTGCTGGGG - Intergenic
933780949 2:85800785-85800807 AAACCAGCTGCCATGTCATGAGG + Intergenic
933993548 2:87650955-87650977 ATGGCAGCTGCCCTGTGGAGAGG + Intergenic
934070036 2:88375326-88375348 AAGCTTGCTGCCATGTCATGAGG - Intergenic
934186454 2:89681628-89681650 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
934315563 2:91915602-91915624 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
934607912 2:95711985-95712007 AAGCCAGCTTCCCTGTGGTGAGG - Intergenic
935420076 2:102858163-102858185 AAACCTGCTGCCATGTTGTGAGG - Intergenic
935482395 2:103608594-103608616 AAGCCAGCTGTCCTGTCATGAGG + Intergenic
935813595 2:106825265-106825287 AAGCCAGCTGCCATGTTGTGAGG + Intronic
935862075 2:107342642-107342664 AAGCGAGCTGCCATGTCATCAGG - Intergenic
936300315 2:111299928-111299950 ATGGCAGCTGCCCTGTGGAGAGG - Intergenic
936389995 2:112063285-112063307 AAGCCAGCTGCCATGTCGTGAGG + Intronic
936429773 2:112452218-112452240 AAGCCAGTTGCTATGTTGTGAGG - Intergenic
936541256 2:113353873-113353895 AAGCCAGCTTCCCTGTGGTGAGG - Intergenic
937275892 2:120683872-120683894 AAGGGAGCTGCCCTGTGGTGGGG - Intergenic
938723441 2:134086258-134086280 AACCCAGCAGCCATGTTGTGAGG + Intergenic
939334629 2:140809850-140809872 AAGCCAGCTGACATGTTATGAGG - Intronic
939964389 2:148596277-148596299 AAGCCAGCTGTCATGTCATGAGG - Intergenic
940132303 2:150396224-150396246 CAGCAAGCTTCCCTGTGGTGAGG - Intergenic
941426240 2:165348859-165348881 AAGCCAGCTGCCATATCATAAGG - Intronic
942191230 2:173472447-173472469 AGCCCAGCTGCCATGTCATGAGG - Intergenic
942252093 2:174055759-174055781 AAGCCAGATGCCATGTTATGAGG + Intergenic
942847357 2:180442735-180442757 AAGCCAATTGCCATGTTGTGAGG + Intergenic
942907571 2:181202319-181202341 AAGCCAGCTGCCCTGTTGTGAGG + Intergenic
943281875 2:185945326-185945348 AAGCCAGCTACCATGTTGTGAGG + Intergenic
943333096 2:186584199-186584221 AAGCCAGCTGCCATGTTATGAGG - Intergenic
943602358 2:189937341-189937363 AAGCCAGCTGACATGTTGTGAGG + Intronic
943724923 2:191243819-191243841 AACCCAGCTGCCATATTGTGAGG - Intergenic
944471181 2:200055254-200055276 AAGGCAGCTGCACTGTGCTGGGG - Intergenic
944530705 2:200665112-200665134 AAGCCAGTTGTCTTGTCCTGAGG - Intronic
945858974 2:215099167-215099189 AAGCCAGCCACTCTGTCTTGAGG + Intronic
945863503 2:215150693-215150715 AAGTCAGCTACCCTGTTGTAAGG + Intergenic
945932579 2:215870281-215870303 AAGCCAGCTACCATGACTTGAGG + Intergenic
946383139 2:219362769-219362791 AAGCCAGCTGCTGTGTCATGAGG - Intergenic
946961987 2:224995109-224995131 AAGCCAGCTGCCATGTCATGAGG - Intronic
947613988 2:231542943-231542965 AACCAAGCTGCCATGTTGTGAGG + Intergenic
947773487 2:232689378-232689400 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
948290655 2:236821880-236821902 AAGCCAGCCGCCATGTTGTGAGG + Intergenic
1168769190 20:403692-403714 CAGCCAGCTGCCATGTTGCGAGG + Intergenic
1168828014 20:827041-827063 AAGCCAGCTGCCATGTCCTGAGG + Intergenic
1169034575 20:2439014-2439036 AACCCAGCTACCATGTTGTGAGG - Intergenic
1169058614 20:2643826-2643848 AAACCAGCAGCCATGTTGTGAGG - Intergenic
1169315307 20:4585494-4585516 AAGCCAGCTGCCATGTCGTAAGG - Intergenic
1169410150 20:5361930-5361952 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1169504642 20:6196074-6196096 GAGCCAGCTGCCATGTCATGAGG + Intergenic
1169836919 20:9890633-9890655 GAGCCAGCTACCATGTTGTGAGG + Intergenic
1169938668 20:10913105-10913127 AAGCCAGCTGCCATGTCAAGAGG + Intergenic
1170073537 20:12394888-12394910 AAGCCAGCTGTCATGTCATGAGG + Intergenic
1170284847 20:14695587-14695609 AAACCAGCTACCATGTTGTGAGG + Intronic
1170394999 20:15916289-15916311 AAGCCAGCTGCCATCTCATGAGG - Intronic
1170417886 20:16163992-16164014 AACCCAGCTGCCATGCTGTGAGG + Intergenic
1170607994 20:17888067-17888089 GAGTCAGCTGCCATGTTGTGAGG + Intergenic
1170837769 20:19899705-19899727 AAGCCATCTGCCATGTCCTAAGG - Intronic
1171040619 20:21759103-21759125 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1171041025 20:21763696-21763718 ACGCCAGGTGCCCTGTCTTGTGG + Intergenic
1171311517 20:24148886-24148908 AACCCAGCTGCCATGCTGTGAGG - Intergenic
1171365540 20:24620507-24620529 AAGCCAGCTGCCGTGTTGTGAGG - Intronic
1172179219 20:32990600-32990622 AGGCCAGCTGCCATGTTGAGAGG + Intronic
1172219267 20:33261635-33261657 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1172309795 20:33908723-33908745 AAGCCAGTCCCCCTGTCCTGGGG + Intergenic
1172315205 20:33948674-33948696 AACCCAGCTGCCATGCTGTGAGG + Intergenic
1172356262 20:34282235-34282257 AAGCCAGATGCCATCTCCTGAGG + Intronic
1172486901 20:35303899-35303921 AAGCCAGCTGGCGGGCCGTGCGG + Exonic
1172892050 20:38272503-38272525 AAGCCAGCTGCCATTTTGTTAGG + Intronic
1173184008 20:40826080-40826102 AAGCCTGCTGCCATGTCATGAGG - Intergenic
1173186713 20:40845893-40845915 AAGTCAGCTGCCATATTGTGAGG - Intergenic
1173289147 20:41699169-41699191 AAGCCAGGTGCCATGTCATTAGG + Intergenic
1173306436 20:41855081-41855103 AAGCCTGCTGCCATGTCATGGGG + Intergenic
1174011532 20:47453670-47453692 GAGCCAGCTTCCATGTCATGAGG - Intergenic
1174042772 20:47711509-47711531 CAGCCAGATGGCCCGTCGTGGGG - Intronic
1174580659 20:51569256-51569278 AAGCTGGCTGCCGTGTTGTGAGG + Intergenic
1175154724 20:56962780-56962802 AAGCCAGCTGCCATGTTGTAAGG + Intergenic
1175157785 20:56983958-56983980 AAGCTAGCTGCCATGTTGTGAGG + Intergenic
1175386942 20:58603281-58603303 AAGCCAGCAGCCATGTCGTAAGG - Intergenic
1175386953 20:58603351-58603373 AAGCCAGCAGCCATGTCGTAAGG - Intergenic
1177783123 21:25640480-25640502 TAGCCAGCTGCTCTGTCCTCAGG + Intronic
1178322898 21:31619255-31619277 AAGCCAGCTGCCATGTTGCAAGG + Intergenic
1178425756 21:32477630-32477652 AAGCCAGCTGCCGTGTTGTAAGG - Intronic
1178475810 21:32936045-32936067 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1178682195 21:34681662-34681684 AAGCCAGATGCCATGTTGTGGGG - Intronic
1178838665 21:36120631-36120653 AAGCCAGCTGCAGTGTCTTGAGG + Intergenic
1179717248 21:43295761-43295783 AATCCAGCCGCCATGTTGTGAGG - Intergenic
1180542333 22:16461487-16461509 AAGCCAGCTGCCATGTCCTGAGG - Intergenic
1181378344 22:22478738-22478760 AAGCCAGCTGACATGTCATGAGG + Intergenic
1181440255 22:22932010-22932032 AGGCCAGCTGCACTGGGGTGAGG - Intergenic
1181768441 22:25109010-25109032 AAGCCAGCCGCCATGTTGTGAGG - Intronic
1181821360 22:25478205-25478227 AAGCCAGCTGCCATGTCGTGGGG + Intergenic
1182021856 22:27088359-27088381 AAACCAACTGCCATGTTGTGAGG - Intergenic
1182039237 22:27223606-27223628 AAGCCAGATGCCATGTCATGAGG - Intergenic
1182061706 22:27403076-27403098 AACCCAGCTGCCATGTTGTGAGG + Intergenic
1182087642 22:27572449-27572471 AAGCCAGCTGCCATTTTGTGAGG + Intergenic
1182469349 22:30538454-30538476 AAGCCAACTGCCATGTTGTGAGG + Intronic
1182497544 22:30720466-30720488 AAGCCAGCTGTCATGTTGTGAGG - Intronic
1182542675 22:31053169-31053191 AAGCCTGCTGCCATGTTGTGAGG - Intergenic
1182729149 22:32473813-32473835 AAGCCAGCTGCCATGTCATGGGG + Intergenic
1184056243 22:42052114-42052136 AAGCCATCTGCACTGACTTGGGG - Intronic
1184183658 22:42848996-42849018 AAGCCAGGTGCCATGTCTTGAGG + Intronic
1184420353 22:44378546-44378568 AATCCAGCAGCCATGTTGTGAGG + Intergenic
1184620872 22:45675523-45675545 AAGCCAGCTGCCATGTCATGAGG + Intronic
1185290067 22:50019543-50019565 AAGCCAGCTGCCATGTTGTGAGG + Intronic
949524379 3:4888821-4888843 AAGCCAGCTGCCATGTTACGAGG + Intergenic
949818582 3:8089926-8089948 AAGCCAGCTGCCATGTCCCAAGG + Intergenic
950213577 3:11141622-11141644 AAGCCAGCTGCCATGTTGTGAGG - Intronic
950228311 3:11254344-11254366 AAGGCAGCTTGCCTGTTGTGGGG - Intronic
950291375 3:11787116-11787138 AACCCAGCCGCCATGTTGTGAGG - Intergenic
950587417 3:13904417-13904439 AAGGCAGCTGTGCTGTCCTGTGG - Intergenic
950768404 3:15291315-15291337 GGGTCAGCTGCCCTGTCTTGGGG - Intronic
950901542 3:16502627-16502649 AAGCCAGCTGCCATGTTGTGAGG + Intronic
951018192 3:17752698-17752720 AAGCAAGCTGCTGTGTGGTGAGG - Intronic
951243346 3:20312521-20312543 CAGCCAGCTGCCATGTTATGAGG - Intergenic
951387714 3:22062782-22062804 ATGCCAGCTGCCATGCAGTGAGG + Intronic
951470481 3:23051185-23051207 AAGCCAGCTGCCATGCTGTGAGG + Intergenic
951598080 3:24340031-24340053 AAGCCATCTGACCTGAGGTGAGG + Intronic
951632190 3:24734465-24734487 AAGCCAGCTGTCATGTGGTAAGG - Intergenic
952102996 3:30036440-30036462 AAGCCAGCTGCCATGTTCTGAGG - Intergenic
952288212 3:31988671-31988693 AAGCCAGCTGCCATGACATAAGG + Exonic
952792544 3:37211720-37211742 AAACCAGCTGCCATATTGTGAGG - Intergenic
952815229 3:37441882-37441904 ACACCAGCCGCCATGTCGTGAGG - Intergenic
953499473 3:43419138-43419160 AAGCTAGCTGCCATGTTGTGAGG - Intronic
954902973 3:54035652-54035674 AGTCCAGCTTCCCTGTCTTGTGG + Intergenic
955143666 3:56294542-56294564 AAGCAAGCTGCCATGTGGAGAGG - Intronic
955666860 3:61358551-61358573 AAGCCAGCTGCCCTATGAAGAGG + Intergenic
955698712 3:61662305-61662327 AAGCCACCTGCCATGTTGTGAGG + Intronic
955931150 3:64058115-64058137 AAGCCACCTGCCATGTTGTGAGG - Intergenic
955990630 3:64623315-64623337 AAGCCAGCTGCCATGTTGTGAGG + Intronic
956307370 3:67840588-67840610 AAGCCAACTGCCATGTCATGAGG + Intergenic
956358412 3:68419095-68419117 AAGCCAGCTACCACGTTGTGAGG - Intronic
956699240 3:71944242-71944264 AAGGCAGCTGCCATGTTGTGAGG - Intergenic
956700378 3:71953557-71953579 AAGCCAGCTGCCATGGTGTGAGG + Intergenic
956714645 3:72067929-72067951 AAGCCAGCTGCCATGTCATGAGG + Intergenic
956765375 3:72480359-72480381 AAGCCAGCTGCCATGTCATGAGG + Intergenic
956767293 3:72494397-72494419 AGGCCAGCTGCCATGTTGTGAGG - Intergenic
956776082 3:72566693-72566715 AAGTCAGCTGCCATGTTCTGAGG - Intergenic
956836208 3:73098197-73098219 ACCCCAGCTGCCATGTTGTGAGG + Intergenic
957275844 3:78090527-78090549 AATCCAGCTGCCATGCTGTGAGG - Intergenic
959434768 3:106300931-106300953 AAGACGGCTGCCATGTCATGAGG - Intergenic
959685954 3:109146657-109146679 AAGTCAGCTGCCATGTCGTGAGG - Intergenic
960674938 3:120184635-120184657 AAACCAGCTGTCCTGTTCTGAGG + Intronic
961139402 3:124543078-124543100 AAGCCAGCCACCGTGTCGTGAGG - Intronic
961238197 3:125386773-125386795 AAGCAAGCTCCCATGTTGTGAGG - Intergenic
961243149 3:125429798-125429820 AAGCCAGCCTCCATGTTGTGAGG + Intergenic
961656914 3:128447844-128447866 AAGGCAGCTGCCATGTCATGAGG - Intergenic
961696540 3:128709224-128709246 AGGTCAGCTGCCCTGCCTTGAGG + Intergenic
961986488 3:131140249-131140271 AACCCAACTACCCTGTTGTGAGG + Intronic
962088707 3:132220238-132220260 AAGCTAGATGCCATGTCATGAGG + Intronic
963279600 3:143369851-143369873 AAGTCAGCTGCCCTGTTGTGAGG + Intronic
963864224 3:150342930-150342952 AAGCCAGATGCTGTGTTGTGAGG - Intergenic
964027875 3:152099828-152099850 AAACCAGCTGCCATGACATGAGG + Intergenic
964689329 3:159432248-159432270 AAGGCAGCTGCCATGTTGTGAGG - Intronic
965388439 3:168074058-168074080 AAGCCAGCTGCCATGTTATGAGG + Intronic
966629677 3:182058569-182058591 AAGCCAGTTGCCGTGTCATGAGG - Intergenic
966692067 3:182752167-182752189 AAGCTAGCTGCCATGTTATGAGG + Intergenic
967001707 3:185342014-185342036 AAGCCAGCTGCCTTGTCATGAGG + Intronic
967878716 3:194283989-194284011 AAGCCAGTTTCCATGTCATGAGG - Intergenic
967895481 3:194392697-194392719 AAGCCAGCTGCCATGTCATGAGG + Intergenic
967995176 3:195160953-195160975 GAGCCAGCTGCCCTGTGGCTGGG - Intronic
968672768 4:1861005-1861027 CAGCCAGCTGCCAGGTCATGAGG + Intergenic
969301853 4:6301639-6301661 AGGCCAGCTTCTCTGTGGTGGGG + Exonic
969418445 4:7076002-7076024 AAGCCAGATGCCCTGCAGAGAGG + Intergenic
969967158 4:11008797-11008819 AAGCCCGCTGCCATGCTGTGAGG - Intergenic
969971347 4:11051657-11051679 AAGCCAGCTGCCATATCATGAGG + Intergenic
971642375 4:29151919-29151941 AAGCCAGCTGTCATGTTATGAGG - Intergenic
972682269 4:41317808-41317830 AAGCCAGCTGTCATGTTGTGAGG - Intergenic
972731636 4:41800749-41800771 AAGCCAGCTGCCATGTCATGAGG - Intergenic
972992176 4:44834197-44834219 AAGCCAGCTTCCATGCTGTGAGG - Intergenic
976030840 4:80751622-80751644 AAGGCAGCTGTGCTGTTGTGGGG + Intronic
976270060 4:83221577-83221599 AAGCCAGCTGCCACGTCCTAAGG + Intergenic
976620407 4:87121183-87121205 AAGCCAGATTCCCTGAAGTGGGG + Intronic
976778618 4:88734231-88734253 AAGCCAGCTTTCCTTTCGTAGGG - Intronic
977675163 4:99739500-99739522 AAGCCAGCTGCCATGTCATGAGG - Intergenic
977947808 4:102933697-102933719 AAGCCAGCTGCCATGTCCTGAGG - Intronic
978492888 4:109327698-109327720 AAGCCAGCTGCCGTGTCATAAGG - Intergenic
978914292 4:114104953-114104975 AAGCCAGCTGGCCTGGCATGGGG + Intergenic
979607051 4:122649666-122649688 AAGCCAGCCGCCATGTTGTGAGG - Intergenic
980142037 4:128930208-128930230 AAGACAGCTGCCAAGTCATGAGG + Intronic
980694368 4:136336843-136336865 AAGACAGCTGCACTGTGCTGGGG - Intergenic
981866515 4:149426719-149426741 AAGCTAGCTGCCATGTCATGAGG - Intergenic
983288922 4:165776053-165776075 AAGCCAGATGCCATGTTCTGAGG + Intergenic
984186137 4:176545996-176546018 AAGCCAGCTGCCATGCCATGAGG - Intergenic
984541765 4:181047025-181047047 AAGCCAGCAGCCTCGTAGTGAGG - Intergenic
984786794 4:183574568-183574590 AAGCCAGCTGCTATGCAGTGAGG + Intergenic
985663275 5:1168061-1168083 AAGCCGGGGGCCCTGTCCTGTGG - Intergenic
985877376 5:2610186-2610208 AAGCCAGCCGCCATGTCAGGAGG - Intergenic
986247410 5:6022820-6022842 AATCCAGCTGCCATGCTGTGAGG + Intergenic
986646415 5:9920874-9920896 AAGCCAGTTGCCCCCTAGTGGGG - Intergenic
986658050 5:10034635-10034657 AAGAAAGCTGCTCTGTGGTGAGG - Intergenic
986667907 5:10119085-10119107 AACCCAGCAGCCATGTTGTGAGG - Intergenic
987111396 5:14690617-14690639 AAGCCAGCTGCCATGTTGTAAGG - Intronic
989002827 5:36778636-36778658 AAACCAGCTGCCATGTTGTTAGG - Intergenic
989188535 5:38647513-38647535 AAACCAGCTGCCCTGTTATGAGG - Intergenic
989316020 5:40079398-40079420 AAGGCAGTTGCCATATCGTGAGG - Intergenic
989701224 5:44267292-44267314 AAGCCAGCTGACATTTCGTGAGG + Intergenic
990010048 5:50986785-50986807 ACCCCAGCTGCCATGTTGTGAGG + Intergenic
990205095 5:53420188-53420210 AAGCCAGCTGCGATGTCATGAGG - Intergenic
990324145 5:54658089-54658111 AATCCAGCTGTCATGTCATGAGG + Intergenic
990336630 5:54778933-54778955 AAGGCAACTGCCATGTCATGAGG + Intergenic
990736261 5:58866432-58866454 AAGCCAGCTGCTATGTATTGAGG + Intergenic
990884726 5:60578513-60578535 AAGCCAACTGTCATGTCATGAGG + Intergenic
991005085 5:61821032-61821054 CAGCCAGCTGTGCTGTTGTGTGG - Intergenic
994379969 5:99059025-99059047 AAGACAGCTGCCATGTTGTGAGG + Intergenic
994984018 5:106912517-106912539 AAGCTAGCTGCCATGCCATGAGG - Intergenic
995417977 5:111931371-111931393 AAGCTAGCTGTCATGTCATGAGG + Intronic
995460353 5:112396680-112396702 AAGCCAGCTGACCTGTGGTGAGG - Intronic
995465447 5:112446029-112446051 AAGCCAGCTGCCCCTTCAAGAGG - Intergenic
995960510 5:117832679-117832701 AGGCCAGCTGCCATGTCCTGAGG + Intergenic
996503208 5:124239716-124239738 AAGCTAGCTGCCATGTTGTGAGG + Intergenic
998127435 5:139634110-139634132 AAGCCAGCTGCCTCTTCATGGGG + Intergenic
998784650 5:145695736-145695758 AAGCCAGCTGCCATGTTGTGAGG - Intronic
1000768901 5:165326372-165326394 AAGCCATCTGTCATGTCATGAGG - Intergenic
1001081254 5:168669296-168669318 ATGCCAGCTGCCCTGGCGCAAGG + Intronic
1001827640 5:174758748-174758770 CAGCCAGCTGCCATGTTGTGAGG + Intergenic
1001832440 5:174800711-174800733 AAGCCAGGTGCCTTGTGGAGGGG + Intergenic
1002411754 5:179084711-179084733 AAACCAGTTGCCTTATCGTGAGG + Intergenic
1002647805 5:180669814-180669836 GAGCCATCTGCCCTGTGGTCAGG + Intergenic
1003332582 6:5142263-5142285 AACCCAGCCGCCATGTTGTGAGG + Intronic
1003424390 6:5987976-5987998 ACGCCAGCTGCCATGCCATGAGG - Intergenic
1003543364 6:7037668-7037690 AACTCAGCTGCCATGTCGTAAGG + Intergenic
1003593479 6:7455133-7455155 AAGTCAGCTGCCACGTTGTGAGG + Intergenic
1004195487 6:13500506-13500528 AAGCCAGCTGCCATGTCATGGGG + Intergenic
1004780649 6:18904723-18904745 AAGCCAGGTGCCCTGGCATGTGG + Intergenic
1004875053 6:19942922-19942944 AAGCCAGCTGCCATGTGGTGAGG + Intergenic
1004918342 6:20353300-20353322 AATCCAGCGGCCATGTTGTGAGG + Intergenic
1005530963 6:26705358-26705380 AAGAAAGCTCCCCTGACGTGGGG + Intergenic
1005539833 6:26796278-26796300 AAGAAAGCTCCCCTGACGTGGGG - Intergenic
1005693393 6:28328983-28329005 AAGCCACCTGACATGTTGTGAGG + Intronic
1006509048 6:34511929-34511951 AGGGCCGCTGCCCTGTGGTGTGG + Intronic
1006869725 6:37240454-37240476 AAGCCAGTGGCCATGTCATGAGG - Intronic
1007133483 6:39498890-39498912 AAGCCACCTGGCCTTTCCTGTGG + Intronic
1007303964 6:40890309-40890331 AAGGCATCTGCCCTGCCCTGAGG + Intergenic
1007323442 6:41043137-41043159 CAGCCATCTACTCTGTCGTGGGG + Exonic
1007556296 6:42769334-42769356 AAGCTGGCTGCCATGTCATGAGG - Intronic
1007649058 6:43406148-43406170 AAGCCAGTTGCCATATTGTGAGG + Intergenic
1008043849 6:46831841-46831863 TAGGCAGCTGCCCTCTCCTGCGG - Intronic
1008561070 6:52725182-52725204 AAGTTAGCTGCCATGTCCTGAGG + Intergenic
1008823656 6:55664860-55664882 AGGCCAGCTGCCATGTAGTGAGG - Intergenic
1009029823 6:58043299-58043321 AAGCTAGCTGCCATGGCATGAGG - Intergenic
1009205351 6:60794537-60794559 AAGCTAGCTGCCATGGCATGAGG - Intergenic
1010032066 6:71281676-71281698 AAGCCAGTTGCCATGTCATGAGG - Intergenic
1010051641 6:71511460-71511482 AATCCAGCTGCCATATTGTGAGG + Intergenic
1010792578 6:80081527-80081549 AAGCCAGCTGCCAAATTGTGAGG + Intergenic
1011474954 6:87742285-87742307 AAGTCAGCTGCCATGTCACGAGG - Intergenic
1011645853 6:89457133-89457155 AAGCCAGCTGCCATGCCTTGAGG - Intronic
1012296667 6:97532888-97532910 GAGCCAGCTGCCATGTCATGAGG - Intergenic
1012399095 6:98830262-98830284 CAGCCAGCTGCCTTTTTGTGTGG + Intergenic
1012404983 6:98885901-98885923 AAGCCAGCTGCCATGTCATGAGG + Intronic
1012853578 6:104475171-104475193 AAGCCAGCTGCCATTTTGTGAGG - Intergenic
1012957187 6:105583768-105583790 AAGCCAGCTACCATGTGATGAGG + Intergenic
1013429464 6:110042809-110042831 AGGGCAGCTGCCGTATCGTGGGG + Intergenic
1013525021 6:110966090-110966112 AAGCCAGCTGCCATATCAGGAGG - Intronic
1014483311 6:121965823-121965845 AATCCAGCTGCCGTGTCTTGAGG + Intergenic
1015053579 6:128872750-128872772 AAGCCAACTGCCATGTCATAAGG + Intergenic
1015279190 6:131414890-131414912 AAGCCAGCTGCTCTGTTGACAGG + Intergenic
1017037851 6:150282883-150282905 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1017657232 6:156641686-156641708 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1017896851 6:158687333-158687355 AAGCCAGCCGCCATGTCATGAGG - Intronic
1018066325 6:160127193-160127215 AAGACAGCTGGCCTGGTGTGGGG - Intronic
1018647559 6:165962260-165962282 TGGCCAGCTTCCCTGTAGTGGGG - Intronic
1018772617 6:166985195-166985217 AAGCCAGAGGTCATGTCGTGAGG - Intergenic
1019187532 6:170229531-170229553 AAGCCAGCAGCCGTGTCCCGTGG + Intergenic
1019347228 7:537140-537162 ATGCCAGCCGCCATGTTGTGAGG - Intergenic
1019556646 7:1634795-1634817 AACCCAGCTGCCATGATGTGAGG - Intergenic
1019748628 7:2714816-2714838 AAGGCAGCTGCCATACCGTGAGG + Exonic
1019770516 7:2881239-2881261 CAGCCAGCTGCTCTGCAGTGGGG + Intergenic
1019804595 7:3114024-3114046 AAGCCAGCCACCATGTTGTGAGG + Intergenic
1019826658 7:3290107-3290129 AGTCCAGCTGCCATGTTGTGGGG + Intergenic
1020921387 7:14269167-14269189 AAGCCAGCTGCCATGTCATAAGG - Intronic
1021419290 7:20426712-20426734 AAGCCAGCTGCCATGTTTTGAGG + Intergenic
1022167648 7:27785767-27785789 AAGCTAGCTGCCATGCTGTGAGG - Intronic
1022359811 7:29647074-29647096 AAGCCAGCTGTCATGTTGTGAGG + Intergenic
1022368615 7:29749731-29749753 AAGCCAGTTGTCATGTTGTGAGG + Intergenic
1022898695 7:34780058-34780080 AAGCCAGCTACTATGTTGTGAGG - Intronic
1022978588 7:35580895-35580917 AAGCCAGCTGCCATGACATGAGG - Intergenic
1022990392 7:35701542-35701564 AATCCAGCTGCCATGTTTTGAGG - Intergenic
1023112924 7:36832355-36832377 AAGCCAGCTGCTGTGTCCTGAGG + Intergenic
1023595919 7:41829344-41829366 AAGCCAGCTTCCATGTCATGAGG + Intergenic
1024103987 7:46062494-46062516 AAGCCAGCTGCCATGCTGTGAGG - Intergenic
1024251462 7:47508802-47508824 CAGCCAGATGCCATGTTGTGAGG + Intronic
1025261124 7:57417857-57417879 CAGCCAGCAGCCCTGGCTTGGGG + Intergenic
1026429921 7:70335116-70335138 AACTCAGCTTCCCTGACGTGTGG - Intronic
1026980952 7:74526330-74526352 AAGGCAGCTGCCCAGTACTGGGG + Intronic
1028128570 7:87143860-87143882 AAGCCAGCTGCCATGTTGAGAGG + Intergenic
1028428895 7:90723461-90723483 AAGCCGGCTGCCATGCCATGAGG - Intronic
1029243315 7:99180111-99180133 AAGCCAGCTGCCGTGATGTGAGG + Intronic
1029985765 7:104921913-104921935 ATCCCAGCTGCCATGTTGTGAGG - Intergenic
1029985919 7:104923231-104923253 AAGCCAGTCGCCATGTTGTGAGG + Intergenic
1034126041 7:148672338-148672360 AAGTTAGCTGCCATGTTGTGAGG - Intergenic
1034733488 7:153408884-153408906 AAGCCAGCTGCAGTGTCATCAGG + Intergenic
1034865208 7:154635837-154635859 AAGCTGGCTGCCATGTTGTGAGG - Intronic
1036496097 8:9271442-9271464 AGTCCAGCTGGCCTGCCGTGGGG - Intergenic
1036539099 8:9686205-9686227 AACCCAGCTGCCATGTCATAAGG + Intronic
1036660974 8:10708406-10708428 AACCCAACTGCCATGTTGTGAGG - Intronic
1036968080 8:13322952-13322974 AAGCTAGCAGCCATGTCATGAGG + Intronic
1037475615 8:19254026-19254048 AAGCCAGCTGCCAGGTCCTGAGG + Intergenic
1037610843 8:20475004-20475026 AAGCCAGCTGCCATGTCCTCAGG + Intergenic
1037653835 8:20866076-20866098 AAGTCAGCTACCCTCTTGTGAGG + Intergenic
1037769050 8:21788433-21788455 AAGCCAACAGCCCAGTCCTGGGG + Exonic
1038282397 8:26177883-26177905 AAGCCAGCTGCCATGTTGTGAGG - Intergenic
1038561178 8:28581793-28581815 AAGCCAGCTGTCATGTCATGAGG + Intergenic
1039596725 8:38797128-38797150 CAGCCAGCTGCCATGCTGTGAGG - Intronic
1041184433 8:55284575-55284597 AAGCCAGCTGCCATGTCACAAGG - Intronic
1041415491 8:57603388-57603410 AAGCCAACTGCCATGTCATGAGG + Intergenic
1041925306 8:63230119-63230141 AAGCAAGCTGCTCTGTGGAGAGG - Intergenic
1042256532 8:66809918-66809940 AAGCCAGCTGCCTTGGTGTAAGG - Intronic
1043916968 8:85934129-85934151 AAGCTAGCTGCCACGTTGTGAGG - Intergenic
1044225604 8:89714502-89714524 AACCCAACTGCCATGTCCTGAGG - Intergenic
1044485421 8:92747538-92747560 AAGCCAGCTGCCATATTGTGAGG + Intergenic
1044962873 8:97548146-97548168 AAGCCAGCTGCCACATCATGAGG - Intergenic
1045035954 8:98176635-98176657 AAGCCAGCTGCCATCCCATGAGG + Intergenic
1045320165 8:101076447-101076469 AAGCCAGCTGCCATGTTGTGAGG + Intergenic
1045487313 8:102641739-102641761 AAGCCAGTTGTCATGTTGTGAGG - Intergenic
1045597580 8:103673607-103673629 ATGCCAGGTGCCATGTCTTGAGG + Intronic
1047435505 8:124832510-124832532 AAACCAGCTGCCATGTCATAAGG - Intergenic
1047697092 8:127414905-127414927 AATCCAGCTGACATGTTGTGAGG + Exonic
1047891274 8:129313809-129313831 AAGCCAGCTGTCATGATGTGAGG + Intergenic
1048320718 8:133397972-133397994 ATGGCAGCTGCCATGTCATGAGG - Intergenic
1048412746 8:134192339-134192361 ATGCCAGCTGCCATGTTGTGAGG + Intergenic
1048495200 8:134929471-134929493 AAGCCAGCTGCCATGTTGAAAGG + Intergenic
1048536382 8:135299924-135299946 AAGCCAGCTGCCATGTCGCATGG - Intergenic
1048571727 8:135662457-135662479 AAGCCAGATGTCATGTTGTGAGG - Intergenic
1049546775 8:143235739-143235761 AAGCCGGCCGCCATGTTGTGAGG - Intergenic
1050608625 9:7327928-7327950 AAGCCTGCTGCCATGTCTTGAGG + Intergenic
1052246490 9:26341880-26341902 AAGCCAATTGCCATGTAGTGAGG - Intergenic
1055116016 9:72606268-72606290 AAGCCAGCTGCTATGTCATTAGG - Intronic
1055475940 9:76664228-76664250 AAACCAGCTACCCTGTTGTAAGG + Intronic
1055931501 9:81564235-81564257 AAGCCAGTTGCCATTTTGTGAGG - Intergenic
1056660972 9:88543003-88543025 CACCCGGCTGCCCTGTCTTGAGG + Intronic
1056897614 9:90565557-90565579 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1056947569 9:91012977-91012999 AATCCAGCTGCCATATTGTGAGG + Intergenic
1057190719 9:93085859-93085881 ACGCCGGCTGCCATGTTGTGAGG - Intergenic
1057549054 9:96038910-96038932 AAGCCAGCAGCCATGTCATAAGG + Intergenic
1057852187 9:98574375-98574397 ATGCCAGCTGCCTTGTCATGAGG + Intronic
1057884401 9:98819064-98819086 AAGCCGGCTGCCATGTTGTGAGG - Intronic
1058203241 9:102069683-102069705 AAGCCAGCTGCCATGTCAGGAGG + Intergenic
1060914201 9:127375807-127375829 AAGCCAGCTGTGATGTCCTGAGG + Intronic
1061233880 9:129331039-129331061 AAGCCAGCCGCCATATTGTGGGG - Intergenic
1061235659 9:129341373-129341395 AAGCCAGCCCTCCTGACGTGTGG + Intergenic
1061604181 9:131696097-131696119 AGACCAGCTGTCCTGTGGTGAGG - Intronic
1186516213 X:10167618-10167640 AAGCCAACTGCCATGTCGTGGGG + Intronic
1186922296 X:14295424-14295446 AAGCCAACTGCCATGTTGTAAGG + Intergenic
1187179588 X:16931446-16931468 AAGCCAGCTGTCATGTCATGAGG + Intergenic
1187217420 X:17290557-17290579 AAGCCAGCTGCCATATTGTGAGG - Intergenic
1187270857 X:17778089-17778111 AAGTCAGCTGCCATGTCATGTGG + Intergenic
1187562411 X:20415142-20415164 AAGCCAGCTGCCATGTCATAAGG - Intergenic
1187568172 X:20473822-20473844 AAGCCAGTTGCCATATCATGAGG - Intergenic
1187723607 X:22178458-22178480 AAGCCAGCTACTCTGACTTGAGG - Intronic
1187893530 X:23959969-23959991 AAGCTAGCTGCCATGTAGTGAGG - Intergenic
1188803223 X:34557116-34557138 AAGCTGGCTGCCATGTTGTGAGG - Intergenic
1189179985 X:38994661-38994683 AAGCCAGCTGCCATGTCATGAGG - Intergenic
1189300834 X:39951214-39951236 AAGCCAGCGGCCATGTGGTGAGG - Intergenic
1189342476 X:40214970-40214992 AAGCCAGCTGCCATGTTGTTAGG + Intergenic
1189349966 X:40268754-40268776 GAGCCAGCTGCCTTGTCACGAGG - Intergenic
1189352861 X:40289980-40290002 AAGCCAGCTGCCATATTGTGAGG - Intergenic
1189368662 X:40410381-40410403 AAGCCAGCTGCCATATTGTGAGG + Intergenic
1189371000 X:40429208-40429230 AAGCCAGTTGCCATATTGTGAGG + Intergenic
1190132452 X:47761739-47761761 AAGCCAGCTGCCATGTCAGGAGG - Intergenic
1190905953 X:54728586-54728608 AAGCATCCTGCCCTGTCCTGAGG - Intergenic
1191846480 X:65551133-65551155 GAGCCAGTTGCACTGTCCTGGGG + Intergenic
1192017356 X:67346084-67346106 AAGCCAGCTACCCTGTCAGAAGG - Intergenic
1193425659 X:81338007-81338029 AAGGCAGCTGCACTGTGCTGGGG + Intergenic
1193811391 X:86055522-86055544 AAGCCAGCTGCCAGTTCATGAGG + Intergenic
1195671051 X:107470470-107470492 AAGCAAGCTGCTGTGTTGTGAGG - Intergenic
1196802304 X:119554673-119554695 AAGCCAGCTGCCATGTCATGAGG + Intronic
1197148237 X:123192008-123192030 AAGCCAGCTGACCTTTAGTTTGG - Intronic
1197761667 X:130032393-130032415 AAGCCAGCTGCCGTGTCCTGAGG - Intronic
1198620477 X:138503140-138503162 AAGCCAAATGCCATGTCGTCAGG + Intergenic
1199298866 X:146189430-146189452 AAGCCAGCTGCCACGTCTTGAGG + Intergenic
1199577940 X:149332873-149332895 AGGCCAGCTGCCATGTATTGAGG - Intergenic
1200139518 X:153892251-153892273 AAGCCAGGTGCCACATCGTGAGG + Intronic
1201183225 Y:11370424-11370446 AAGCCAGCTGCCATGTTCTGAGG - Intergenic
1201910383 Y:19127821-19127843 AAAGCAGCTTGCCTGTCGTGGGG + Intergenic
1202371184 Y:24197116-24197138 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1202376157 Y:24239425-24239447 AAGCCAGTTGCCATGTGATGAGG + Intergenic
1202494623 Y:25430693-25430715 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1202499600 Y:25473001-25473023 AAGCCAGTTGCCATGTGATGAGG - Intergenic
1202596749 Y:26548357-26548379 AAGCCAGCTGTGCTGTGTTGTGG - Intergenic