ID: 1158986837

View in Genome Browser
Species Human (GRCh38)
Location 18:62826573-62826595
Sequence GCCACTATGCTAGATGCTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 188}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158986837 Original CRISPR GCCACTATGCTAGATGCTAG AGG (reversed) Intronic
903017444 1:20370159-20370181 GCCCCCATGCTAGAGGCTGGGGG + Intergenic
903397045 1:23009605-23009627 GCCACTGTGTTAGGTGCTACGGG + Intergenic
903494378 1:23755336-23755358 GGCACTATGCTAGTTGCTTTTGG - Intronic
903553860 1:24179237-24179259 GCCACCATGCTTGGTCCTAGAGG + Intronic
903948967 1:26982992-26983014 GCCACTGTGCAAGGTGCTAGAGG - Intergenic
904206989 1:28861866-28861888 CCCACTATGCTAAATGCTTTAGG + Intronic
904928961 1:34071236-34071258 GCCAGTCTGCAAGATGCTAGGGG + Intronic
905222588 1:36459042-36459064 GGCACTATGCTAGAAGCAACTGG + Intronic
905451765 1:38061646-38061668 GGCACTATCCTAGATGCCAGTGG + Intergenic
906579590 1:46925469-46925491 GACACTATGCTAGCTGCAGGAGG - Intergenic
906604132 1:47153418-47153440 GACACTATGCTAGCTGCAGGAGG + Intergenic
906969361 1:50494750-50494772 GATAGTATGCTAGATGCTATAGG - Intronic
908069981 1:60449639-60449661 GGCACTGTGCTAGATCCTTGGGG - Intergenic
908755442 1:67465171-67465193 GACACTGTGCTAGATGCTGGGGG - Intergenic
908767067 1:67563832-67563854 GGCACTCTGCTAGGTGCTTGGGG - Intergenic
908884583 1:68773703-68773725 GTCACTATGTTGGATCCTAGGGG - Intergenic
910275689 1:85446733-85446755 GACACTAAGCCATATGCTAGAGG - Intronic
911398992 1:97350953-97350975 GCCACTATGTTTGATGCAATTGG + Intronic
912562157 1:110558772-110558794 GGCACTGTACTAGATGCTATGGG - Intergenic
912795033 1:112688190-112688212 GACACTATGCTGGATGCTAGGGG - Intronic
913374241 1:118133164-118133186 GCCACTGTTCTAGTTGCTGGAGG - Intronic
913567867 1:120091108-120091130 GGCACTGAGCTAGATTCTAGGGG + Intergenic
913587089 1:120286439-120286461 GCTACTGTGCTAGATTCTGGTGG + Intergenic
913621096 1:120611931-120611953 GCTACTGTGCTAGATTCTGGTGG - Intergenic
914288617 1:146251817-146251839 GGCACTGAGCTAGATTCTAGGGG + Intergenic
914549652 1:148702561-148702583 GGCACTGAGCTAGATTCTAGGGG + Intergenic
914569104 1:148898324-148898346 GCTACTGTGCTAGATTCTGGTGG + Intronic
914603723 1:149231932-149231954 GCTACTGTGCTAGATTCTGGTGG - Intergenic
914617030 1:149369155-149369177 GGCACTGAGCTAGATTCTAGGGG - Intergenic
916242717 1:162656201-162656223 GACCCTGTGCTAGATGCTAGAGG - Intronic
917694563 1:177508625-177508647 GGGACTATGCAAGGTGCTAGAGG - Intergenic
919856622 1:201710608-201710630 GTCACCATGCTTGATGCTAGTGG + Intronic
920003668 1:202816752-202816774 AACACTATGCTAGGTGCTAGGGG - Intergenic
920472487 1:206243506-206243528 GCCCCTATGCTAGAGCCAAGAGG + Intronic
920833252 1:209484236-209484258 GACACCATGCTAGGTGCTAAGGG + Intergenic
921680447 1:218024832-218024854 GGCACTATGCTAGGTCCTGGAGG - Intergenic
922501994 1:226104106-226104128 GACACAATCCTAGATGGTAGAGG - Intergenic
923830171 1:237546834-237546856 GTCACTATTCTAGGTGCTGGGGG + Intronic
924380864 1:243463127-243463149 GACACTGTGCTGGATGCTATGGG + Intronic
1063820479 10:9829294-9829316 GACACTATGCTAGGTACTGGGGG - Intergenic
1063887289 10:10592762-10592784 GCCACTCTGCTAGAGGTTGGGGG + Intergenic
1067907702 10:50310844-50310866 GGCACTATGCTACATGCCTGAGG - Intronic
1068252767 10:54465416-54465438 ACTAGTATGCTAGATGCCAGAGG - Intronic
1069885837 10:71623042-71623064 GCCACTGTGCTAGGTCCTGGGGG + Intronic
1070220552 10:74438554-74438576 GGCACTATGCTGGTTGCCAGAGG - Intronic
1072005623 10:91243994-91244016 GGCACTATTCTAGGTGCTTGAGG + Intronic
1075126017 10:119699531-119699553 ACCACTATTCCAGATGATAGTGG - Intergenic
1078684458 11:13515224-13515246 GGCACTAAGCTATATGATAGTGG + Intergenic
1079899325 11:26161640-26161662 TCCACAATGAGAGATGCTAGAGG + Intergenic
1081029902 11:38066692-38066714 GCCACTATTATAGATTATAGAGG - Intergenic
1081771624 11:45653742-45653764 GGCACTGTTCTAGATGCTATGGG + Intronic
1082763144 11:57145743-57145765 GCCAGTTTGCTAGATGGGAGGGG + Intergenic
1083027672 11:59564269-59564291 GCCAATATGCTAGCTGATATGGG - Intergenic
1084918560 11:72450328-72450350 GCCACCATGTTGGGTGCTAGGGG + Intergenic
1086172099 11:83848260-83848282 GGCACTAGACTAGATGCTAGAGG - Intronic
1086863331 11:91950632-91950654 GGCACTATGCTAGAAGGTAATGG + Intergenic
1088358457 11:108967330-108967352 GCCACTGTGCTGGATGCTTTTGG + Intergenic
1088771331 11:113038554-113038576 TCTACTATGCTGGATGCTAAGGG - Intronic
1089396523 11:118139529-118139551 GGCACTGTGCCAGATGCTATAGG - Intronic
1089644936 11:119872743-119872765 GGCACTATGCTGGGTGCTGGGGG - Intergenic
1090539008 11:127679633-127679655 GCCACCAGGCTAGATCCCAGTGG - Intergenic
1090787718 11:130064931-130064953 ACCACTATGCTAGATTGTGGAGG + Intergenic
1091022884 11:132116623-132116645 GGCACTATGCTAGGTCCTTGAGG - Intronic
1091189272 11:133676657-133676679 GGCACTGTGCTAGATCCTGGGGG - Intergenic
1092113432 12:5981099-5981121 GGCACTGTGCTAGGTGCTATGGG - Intronic
1095436034 12:42188823-42188845 GGCACTGTGCTAAATGCAAGAGG + Intronic
1096580831 12:52583895-52583917 GCCACTATGCTAGGCCCAAGGGG + Intergenic
1097958866 12:65513219-65513241 GCCACAATGTGAGATACTAGGGG - Intergenic
1098362446 12:69667807-69667829 GGTTCTATGCCAGATGCTAGAGG - Intronic
1098533230 12:71565610-71565632 GGCATTATACTAGATGCTGGGGG - Intronic
1101380325 12:104208634-104208656 GCCACTATTCTAGTTGCCACAGG - Intergenic
1102564165 12:113783679-113783701 GACACTACGCTACATGCTCGGGG + Intergenic
1105630431 13:22158284-22158306 GCCATTATGGTATATGCAAGTGG + Intergenic
1106203528 13:27566395-27566417 GGCACTATACTAGTTGCTGGTGG - Intronic
1107389813 13:39952359-39952381 GTCACTATGATAAATGCTAATGG + Intergenic
1110968931 13:81737002-81737024 GCCACTGTGCTACATACTAGGGG + Intergenic
1111880821 13:93954884-93954906 CCCACTATGCTAGAAGGTGGTGG - Intronic
1117177966 14:53164639-53164661 GGCCCTGTGCTAGATGCTGGAGG - Intergenic
1118196236 14:63629148-63629170 GGCACTCTTCTAGGTGCTAGAGG + Intronic
1118287377 14:64488336-64488358 TGCACTATACTAGATGCCAGCGG + Intronic
1118624554 14:67645943-67645965 GGCAGTCTGCCAGATGCTAGGGG + Intronic
1120762538 14:88298537-88298559 TCCACTATGCCAGTGGCTAGTGG + Intronic
1124816128 15:32994630-32994652 GGCACTGTGCTAGGTGCTCGAGG - Intronic
1125748940 15:42015589-42015611 GGCCCTATGCTAGATGCTGGGGG + Intronic
1126026191 15:44448263-44448285 GCCTGTGTGCTGGATGCTAGAGG + Intronic
1126474172 15:49048866-49048888 GGTACTATGCTAAATACTAGAGG + Intergenic
1128296452 15:66524710-66524732 GGTACTATGCTAGATGGTAAGGG - Intronic
1130149089 15:81297768-81297790 GGCCCTGTGCTAGATGCTGGGGG + Intronic
1130714916 15:86324123-86324145 GGCACTGGGCTAGATACTAGGGG + Intronic
1131760616 15:95618682-95618704 GGCACTGTGCTAGGCGCTAGGGG + Intergenic
1131909519 15:97181979-97182001 GTCACTATGCTTTAGGCTAGAGG + Intergenic
1133733745 16:8597904-8597926 GGCAATATGCTAGATACTATAGG + Intergenic
1134793406 16:17012002-17012024 GCCTCTATTCTAGATTCTGGAGG + Intergenic
1137664982 16:50244850-50244872 GCCACCATGCTTGATGCCCGGGG + Intergenic
1138261498 16:55626683-55626705 GGCACTGTGCTAGCAGCTAGGGG + Intergenic
1140319846 16:73939580-73939602 GCCACTATGGTAGATGGTTATGG + Intergenic
1146146022 17:30417291-30417313 GGCACTATTCTAGGTGCTTGGGG - Intronic
1147923596 17:43933294-43933316 GGCACTGTGCTAGATGCTGGAGG + Intergenic
1148194871 17:45706090-45706112 GACAGTATCCTAGATGCTAAGGG + Intergenic
1153833633 18:8944912-8944934 GTCACTGTGCTAGAGGCTAGAGG + Intergenic
1154309570 18:13256656-13256678 GCCAGATTGCTGGATGCTAGTGG - Intronic
1157159850 18:45303899-45303921 GACTCTGTGCTAGATGCTGGAGG - Intronic
1158590657 18:58776058-58776080 GGCACTGTGCTAGCTGGTAGGGG + Intergenic
1158986837 18:62826573-62826595 GCCACTATGCTAGATGCTAGAGG - Intronic
1165063820 19:33217939-33217961 GCCCCTCTGCTAGATGAGAGAGG - Intronic
1167869496 19:52355966-52355988 GCCCCTCTCCTAGAAGCTAGTGG + Intronic
926299729 2:11593814-11593836 GCCACTGTTCTAGAGGCTGGGGG + Intronic
928592998 2:32836268-32836290 GGCACTATGCTAGATGCTTAGGG + Intergenic
931597618 2:63967113-63967135 GGCCCTATGCTAGGTGTTAGAGG - Intronic
933349170 2:81131157-81131179 AACACTTTGCTAGATGCTATGGG - Intergenic
938940539 2:136165803-136165825 AAAACTATGCTAGATACTAGGGG + Intergenic
940736384 2:157457493-157457515 GCCACTCTTCTAGGTGCTAGAGG - Intronic
943617140 2:190105903-190105925 GGAAATGTGCTAGATGCTAGAGG - Intronic
946319174 2:218939763-218939785 GCCACTCTCCTAGATCCTGGTGG - Intergenic
946870793 2:224082987-224083009 GGCATTATGCTAGTTGCTGGTGG + Intergenic
947199020 2:227598353-227598375 GCCACTAACCTAGATGCAGGTGG + Intergenic
948146058 2:235708993-235709015 GACACTCAGCTAGATGCCAGTGG - Intronic
1169712498 20:8580659-8580681 GGCACTATGATAGGTGCTGGGGG + Intronic
1169870410 20:10242543-10242565 GCCACTATAACAGATGCTGGAGG - Intronic
1173555557 20:43963111-43963133 GCCACCATTCTAGATGGTAGAGG + Intronic
1174503507 20:51002439-51002461 GGCCCTATGCGAGATGCTGGGGG + Intergenic
1174880618 20:54275280-54275302 GCCAATGAGCTAGATGGTAGGGG - Intergenic
1178205426 21:30458624-30458646 GGCACCATGCTGGATGCTATGGG - Intergenic
1180522211 22:16219856-16219878 GCCTCGATGGTAGATGGTAGGGG - Intergenic
1184102256 22:42347041-42347063 TGCACTCTTCTAGATGCTAGCGG - Intergenic
949735015 3:7161744-7161766 AGCACTATTCTAGATCCTAGGGG + Intronic
951688115 3:25367272-25367294 GCCATTATGCTGGGTGCCAGAGG - Intronic
953867754 3:46599038-46599060 GTCAATATGCCAGAAGCTAGGGG - Intronic
957323589 3:78663746-78663768 GGCACTATGCTATATACTATGGG - Intronic
961732168 3:128973702-128973724 ACCCCATTGCTAGATGCTAGTGG - Intronic
962781827 3:138726369-138726391 GCAACTATGCTAAACACTAGGGG + Intronic
965630331 3:170726282-170726304 TGCACTGTGCTAGATGCTTGAGG + Intronic
967220998 3:187248036-187248058 GGCACTGTGCTAGGTCCTAGGGG - Intronic
967427759 3:189346990-189347012 GCCACTATGTGACATCCTAGGGG + Intergenic
970606220 4:17684583-17684605 GCCTCTGAGCTGGATGCTAGAGG - Intronic
972299636 4:37772626-37772648 GGCACTGTGCTAGGTGCTAATGG + Intergenic
973801586 4:54483690-54483712 GTCACTGTGCTAGGTGCTTGGGG + Intergenic
974682851 4:65186001-65186023 GGCACTATTCTAGATGCTGGGGG + Intergenic
975170470 4:71226917-71226939 GTGACTATGCTTGATACTAGAGG + Intronic
975395731 4:73870911-73870933 GCCACTGTGATAGAGGCTGGCGG + Exonic
975659136 4:76671122-76671144 GCCACTTTCCTAGATGCTTGAGG + Intronic
976276335 4:83282888-83282910 GCCACTAAGATAGAAGCCAGAGG + Intronic
976298184 4:83493001-83493023 GGCACTGTGCTAGTTGCTGGAGG + Intronic
979783028 4:124680249-124680271 GGCACTATGCTAGGTTCTAGGGG - Intronic
981566826 4:146110650-146110672 GCTTCTATGCTGGATGCTATGGG + Intergenic
981809307 4:148755420-148755442 GACACAATCCTAGATGCTATGGG - Intergenic
981930827 4:150187658-150187680 GGCACTATTCTAGGTGCTACAGG - Intronic
982378109 4:154716925-154716947 AGCACTATGCTAGATGCTAGGGG - Intronic
983268910 4:165538264-165538286 GGCACTATGCAAGTTGCTAGGGG + Intergenic
984683059 4:182633316-182633338 GCCACTCTGATAGATGTCAGAGG + Intronic
985259709 4:188103785-188103807 GGGACTATGCAAGGTGCTAGGGG - Intronic
986094056 5:4538429-4538451 ACTATTATGCTAGATGCTATAGG - Intergenic
987000322 5:13653767-13653789 TACACTGTTCTAGATGCTAGGGG + Intergenic
988479042 5:31614095-31614117 GGCACTGTGCTAGAAACTAGGGG - Intergenic
988674248 5:33414957-33414979 GCCATTCTTCTAGATGCTAAGGG + Intergenic
989142056 5:38211173-38211195 GCCACTGTCCTAGGTGCTGGAGG - Intergenic
992542960 5:77782529-77782551 GGCATTAAGCTTGATGCTAGGGG - Intronic
993886931 5:93425860-93425882 GACATTGTGCTAGATGCTGGTGG - Intergenic
997725151 5:136114061-136114083 GACACTATGCCAGGTGCTAAGGG - Intergenic
998232629 5:140370990-140371012 ACCTGGATGCTAGATGCTAGAGG + Intronic
1000408977 5:160918160-160918182 GACACTATGTTAGGTGCTAAGGG + Intergenic
1000650217 5:163808341-163808363 GCCTCTATCCTAGTTTCTAGTGG - Intergenic
1001419035 5:171573025-171573047 GACACTGTGCTTGGTGCTAGAGG - Intergenic
1003016251 6:2469742-2469764 TCTACTCTGCTAGATTCTAGGGG + Intergenic
1003429015 6:6022105-6022127 GCCCCTGTGCTAGATTCTAGAGG - Intergenic
1005662942 6:28019011-28019033 GACACTGTGCTAAATGCTGGGGG - Intergenic
1007081311 6:39106840-39106862 GCCCCTGTGCCAGATGCTAATGG + Intronic
1010619742 6:78060047-78060069 GCCCATTTGCTAGATGCTTGTGG + Intergenic
1011361578 6:86531113-86531135 GCTACTATGATAGATGTTAGTGG + Intergenic
1011509511 6:88085036-88085058 GCCACTTTGCCAGATACTAGGGG + Intergenic
1013552111 6:111217944-111217966 GGCACTGTGCTATGTGCTAGAGG - Intronic
1013639384 6:112058442-112058464 GGCACTGTGCTAGGTGCTGGTGG + Intronic
1014741216 6:125149538-125149560 GGGACTGTGCTAGATGCTAAGGG - Intronic
1014777082 6:125523603-125523625 GGCACTATGCCAGACACTAGAGG - Intergenic
1016188374 6:141226889-141226911 GCCACAATCTTAGATACTAGGGG + Intergenic
1016261176 6:142172688-142172710 GGCACTATGCTAAATACTTGGGG + Intronic
1018216669 6:161534713-161534735 GGCTCTCTGCTAGATGCTACAGG - Intronic
1019300012 7:298119-298141 GCCCCTTGGCAAGATGCTAGGGG + Intergenic
1020145210 7:5637143-5637165 CCCACTGTGCTAGCTGCCAGGGG + Intronic
1021601145 7:22364836-22364858 GCCACTGTATTAGATGCGAGAGG - Intergenic
1021636438 7:22698787-22698809 GGCACTGTTCTAGATGCTAGGGG + Intergenic
1023451046 7:40285669-40285691 GCCACAATGCTTGATGCAGGTGG - Intronic
1027245263 7:76362750-76362772 GGCTCTATGCCAGATGCTGGAGG + Intergenic
1032022490 7:128416729-128416751 GGCACTGTGCTAGGTGTTAGAGG + Intergenic
1037081248 8:14789155-14789177 GGCACTATGCACGATGCTTGGGG + Intronic
1038444714 8:27595330-27595352 GCCACTATCCTATTTTCTAGTGG + Intergenic
1038655049 8:29443016-29443038 CCCACGATGTTAGATGTTAGCGG - Intergenic
1042391197 8:68237336-68237358 GCCACTATCCTAGTTGCTAACGG + Intergenic
1045184422 8:99822561-99822583 GCTACTTTGTTAGGTGCTAGAGG - Intronic
1045229371 8:100287341-100287363 GGCACTATGCTAGGTGTTAAAGG - Intronic
1046183732 8:110686276-110686298 GCCACTGTGCTAGGTGCTGTGGG + Intergenic
1046858989 8:119069049-119069071 GGCATCATGTTAGATGCTAGGGG + Intronic
1046859005 8:119069249-119069271 GGCACCATGCTAGATGATATGGG + Intronic
1047309000 8:123676625-123676647 GGCACTGTGCTAGATGCTGAGGG - Intergenic
1048384534 8:133899260-133899282 ACCACTGCGCTAGCTGCTAGAGG - Intergenic
1048384537 8:133899304-133899326 GGCACTGCGCTAGCTGCTAGAGG - Intergenic
1048887979 8:138923841-138923863 GCAATTTTGCTAGATGCTATGGG - Intergenic
1050420776 9:5463164-5463186 GACATCATGCTAGGTGCTAGGGG - Intronic
1050556523 9:6794161-6794183 GACACTATGCCAGGTGCTAGAGG + Intronic
1053390740 9:37734000-37734022 ACCCCTGTGATAGATGCTAGGGG + Intronic
1056128663 9:83563109-83563131 GACTCTATCCTAGATGCCAGAGG - Intergenic
1057770393 9:97962297-97962319 GCCATTCTGCTTGGTGCTAGGGG - Intergenic
1059902914 9:118948303-118948325 GCCTCTCTCCTAGATGCTGGTGG + Intergenic
1060946185 9:127570361-127570383 GGCCCTCTGCTAGATGCTGGGGG + Intronic
1061396514 9:130346674-130346696 GGCACTGTGCTAGAGGCTGGCGG + Intronic
1062702534 9:137914869-137914891 GGCACTGTTCTAGGTGCTAGAGG + Intronic
1185833954 X:3328383-3328405 ACCACCATGCTAGAGGATAGTGG + Intronic
1186983876 X:14989317-14989339 GCCTCTATCCTAGTTTCTAGTGG - Intergenic
1187107614 X:16260480-16260502 GGCACTGTGCTGGATGCTATGGG + Intergenic
1187946947 X:24435391-24435413 AGCACTATGCTAGGTGCTGGAGG - Intergenic
1191857624 X:65639956-65639978 GGTGCTGTGCTAGATGCTAGGGG + Intronic
1194694696 X:97031624-97031646 GGCACTGTGCTGAATGCTAGGGG + Intronic
1195512153 X:105728417-105728439 AGCACCATGCTAGTTGCTAGTGG + Intronic
1195922537 X:109998043-109998065 GCCACTCTGCTAGGTGCTGTGGG + Intergenic
1197259833 X:124306056-124306078 GGTACTATGCTAGGTGCTAGGGG + Intronic
1198155474 X:133955562-133955584 GGCACTGTGCTACATGCTGGAGG + Intronic
1199800192 X:151242973-151242995 GGCACTATGCAAGATGCTGACGG - Intergenic