ID: 1158995504

View in Genome Browser
Species Human (GRCh38)
Location 18:62914535-62914557
Sequence GGGTACAGTGGGAGGACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 5, 3: 45, 4: 394}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158995504_1158995508 -9 Left 1158995504 18:62914535-62914557 CCAGCAGTCCTCCCACTGTACCC 0: 1
1: 0
2: 5
3: 45
4: 394
Right 1158995508 18:62914549-62914571 ACTGTACCCTTTTGAGTAGCTGG 0: 1
1: 0
2: 6
3: 66
4: 1025
1158995504_1158995509 -8 Left 1158995504 18:62914535-62914557 CCAGCAGTCCTCCCACTGTACCC 0: 1
1: 0
2: 5
3: 45
4: 394
Right 1158995509 18:62914550-62914572 CTGTACCCTTTTGAGTAGCTGGG 0: 1
1: 0
2: 9
3: 173
4: 2652
1158995504_1158995512 0 Left 1158995504 18:62914535-62914557 CCAGCAGTCCTCCCACTGTACCC 0: 1
1: 0
2: 5
3: 45
4: 394
Right 1158995512 18:62914558-62914580 TTTTGAGTAGCTGGGACTATAGG 0: 15
1: 649
2: 9708
3: 72767
4: 198742

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158995504 Original CRISPR GGGTACAGTGGGAGGACTGC TGG (reversed) Intronic
900525757 1:3127815-3127837 GGGGACAGTGGGAGGCGGGCAGG + Intronic
901344521 1:8527944-8527966 AGGTACAGTGAGAGGATTCCGGG - Intronic
901626925 1:10629884-10629906 GGGTGCAGAGGGAGGACCGCCGG + Exonic
902214332 1:14924721-14924743 GGGTGCAGCGGGAGGCGTGCGGG + Intronic
902981861 1:20129206-20129228 GGGTCCAGTGGGAGGGGAGCAGG - Intergenic
903740830 1:25557427-25557449 GGGTACAGTGGTGGGGCTGCAGG + Intronic
904749621 1:32733433-32733455 GGCTGAAGTGGGAGGACTGCTGG - Intergenic
905053280 1:35071567-35071589 GGCTGAGGTGGGAGGACTGCTGG - Intronic
905242886 1:36592572-36592594 GGAGACTGTGGGAGGATTGCTGG + Intergenic
906193989 1:43918217-43918239 GGCTGAGGTGGGAGGACTGCCGG - Intronic
906619706 1:47265885-47265907 GGCTAAGGTGGGAGGATTGCTGG - Intronic
907835154 1:58101851-58101873 GTGTGGAGAGGGAGGACTGCTGG - Intronic
909004298 1:70256919-70256941 GGGGACAGTGGAACAACTGCAGG + Intergenic
911048555 1:93649871-93649893 GGGTAGAGTGGGTAGAGTGCTGG - Intronic
912247961 1:107980471-107980493 GGGGACAGTGTGAGGACCGGAGG - Intergenic
912386361 1:109273056-109273078 GGGGCCAGTGGGAGGACAGTGGG + Intronic
912435746 1:109659921-109659943 GAGTGCAGTGAGAGGCCTGCAGG + Intronic
912437686 1:109673326-109673348 GAGTGCAGTGAGAGGCCTGCAGG + Intronic
912440168 1:109691675-109691697 GAGTGCAGTGAGAGGGCTGCAGG + Intronic
912443485 1:109716052-109716074 GAGTGCAGTGAGAGGCCTGCAGG + Intronic
912975344 1:114324363-114324385 ATGCCCAGTGGGAGGACTGCTGG - Intergenic
913135900 1:115888835-115888857 GTGTAGAATGGGAAGACTGCAGG - Intergenic
914914569 1:151811221-151811243 GGGTACAGAGGAGGGAGTGCGGG - Intronic
916544042 1:165785338-165785360 GGGTGAAGTGGGAGGATAGCTGG - Intronic
917106850 1:171500997-171501019 GGCTGAGGTGGGAGGACTGCTGG - Intronic
919583836 1:199410747-199410769 GGGCACATTTGGAGAACTGCTGG - Intergenic
922348448 1:224716616-224716638 GGGTACAGTGTGGGGACCGTGGG + Intronic
922455275 1:225769214-225769236 GGGAACTGTGGGAGGACAGATGG - Intergenic
923808682 1:237288642-237288664 GGGCACAGTGGGAGTACGACTGG - Intronic
924861295 1:247925193-247925215 GGGTACCCCGGGAGGACTTCAGG + Intergenic
924894191 1:248317860-248317882 GGGCACAGTGGGAGTACGGCTGG + Intergenic
1062879660 10:967694-967716 GGCAACAGAGGGAGGAATGCCGG + Intergenic
1064583028 10:16813070-16813092 GGCTGCGGTGGGAGGATTGCTGG - Intronic
1066316007 10:34246984-34247006 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1067909377 10:50330382-50330404 GGCTGCAGTGGGAGGATCGCCGG + Intronic
1068106974 10:52630769-52630791 GGGCACAGTGGGAAGGCGGCTGG - Intergenic
1068514332 10:58007225-58007247 TGGTACAGGAGAAGGACTGCAGG - Intergenic
1070570944 10:77638698-77638720 GGGTACACTGGGAGGACGGCGGG + Intergenic
1072367449 10:94727512-94727534 GGCTGAAGTGGGAGGATTGCTGG + Intronic
1073195232 10:101684981-101685003 GGGTAAAGTGGGTTGACAGCTGG - Intronic
1073220403 10:101867595-101867617 GGTCAAGGTGGGAGGACTGCTGG + Intronic
1073837141 10:107457157-107457179 GGCTGAGGTGGGAGGACTGCCGG + Intergenic
1075414396 10:122251597-122251619 GGCTAAGGTGGGAGGACTGCTGG + Intronic
1076463988 10:130665984-130666006 GGCAACAGGGGGAGGAATGCTGG + Intergenic
1076807399 10:132865951-132865973 GTGCACAGTGGAGGGACTGCGGG - Intronic
1076856344 10:133117183-133117205 TGGTCCAGAGCGAGGACTGCTGG + Intronic
1077266875 11:1655268-1655290 AGGGACAGTGGGGGCACTGCGGG + Intergenic
1077307337 11:1874159-1874181 GGGGACAGTGGGAGCAGTGTCGG + Intronic
1078646215 11:13143178-13143200 GGCCACAGTGGCAGGTCTGCTGG + Intergenic
1079117380 11:17648802-17648824 GGACACAGTGGGAGTACAGCAGG - Intergenic
1079406413 11:20150718-20150740 GGGTGAGGTGGGAGGATTGCCGG + Intergenic
1080450762 11:32377022-32377044 GGGTCCAGTAGGAGAAATGCAGG + Intergenic
1080898733 11:36467557-36467579 GGGAACAGTGGGAGCATGGCAGG - Intergenic
1081951611 11:47049084-47049106 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1083346858 11:61999875-61999897 GGCTGAAGTGGGAGGATTGCTGG + Intergenic
1083948694 11:65941574-65941596 GGAGAGAGTGGGAGGACGGCCGG + Intergenic
1084494873 11:69497941-69497963 AGGTATAGGTGGAGGACTGCAGG + Intergenic
1084494956 11:69498241-69498263 AGGTATAGGTGGAGGACTGCAGG + Intergenic
1084495006 11:69498441-69498463 AGGTATAGGTGGAGGACTGCAGG + Intergenic
1084495058 11:69498641-69498663 AGGTATAGGTGGAGGACTGCAGG + Intergenic
1084548057 11:69824187-69824209 GGGGATAGAGGGAGGAGTGCCGG + Intergenic
1084780122 11:71402543-71402565 GGGGACAGTGGGGAGACAGCAGG + Intergenic
1085275540 11:75296540-75296562 AGGGACACTGGGAGGACTGATGG - Intronic
1085361138 11:75888232-75888254 GGCTGTGGTGGGAGGACTGCCGG - Intronic
1089838617 11:121394032-121394054 GGGGACACAGGAAGGACTGCAGG - Intergenic
1090071084 11:123545217-123545239 GGGTGAAGTGGGAGGACTGCAGG + Intronic
1091504337 12:1051616-1051638 GGCTAAGGTGGGAGGATTGCTGG + Intronic
1091738883 12:2945746-2945768 GGCTAAGGTGGGAGGATTGCTGG + Intergenic
1091885160 12:4011679-4011701 GGGTACCGTGGGAAGTTTGCTGG + Intergenic
1091948371 12:4569694-4569716 GGCTGAAGTGGGAGGATTGCTGG - Intronic
1095797613 12:46237545-46237567 TGGTACAGAGGGAGGTCTGTTGG - Intronic
1096499147 12:52054900-52054922 GGGGCCGGTGGGAGGACTGAAGG - Exonic
1096613637 12:52819163-52819185 GGGTGCAGGGGGAGGTCAGCAGG - Intergenic
1097281731 12:57848808-57848830 AGTTGCAGTGGGAGGAATGCAGG + Intergenic
1097401287 12:59131165-59131187 GGGTACAGAGGGAGGAAAGGAGG + Intergenic
1097870846 12:64601050-64601072 GGCCACAGTAGGAGGACTGCTGG + Intergenic
1098263657 12:68697023-68697045 GGGAACAGTGGCAGGAGTGGAGG + Intronic
1100695556 12:97089027-97089049 GGGTAGGGTGGGAGGAGTGAGGG - Intergenic
1101958926 12:109233715-109233737 GGGTAGAGAGGGAGGGCTGAGGG - Intronic
1102179049 12:110898044-110898066 GGCCAAAGTGGGAGGATTGCTGG + Intronic
1102302593 12:111781524-111781546 GGCTACAGTGTGAGGACAGCTGG - Intronic
1102463615 12:113115258-113115280 GGGTCCACTGGGAGGACAGGAGG + Exonic
1103076413 12:117986331-117986353 GGGTACAGTGAGAAGATGGCTGG + Intergenic
1103128391 12:118445127-118445149 GGTTACAGTGAGAGAACAGCTGG + Intergenic
1103696729 12:122821548-122821570 GGCTGAAGTGGGAGGACCGCTGG - Intronic
1104567234 12:129896068-129896090 GGCTAAGGTGGGAGGATTGCTGG - Intronic
1104681014 12:130751975-130751997 GGGTGGGGTGGGAGGACTGAAGG - Intergenic
1104811488 12:131622594-131622616 GGGTAGAGGGGTAGGACTGACGG - Intergenic
1105962464 13:25354575-25354597 GGGTGAGGTGGGAGGACTGCTGG + Intergenic
1107442154 13:40437614-40437636 GGCTAAGGTGGGAGGATTGCTGG + Intergenic
1107871787 13:44753308-44753330 GGGCACAGTGGGAGGTTAGCAGG + Intergenic
1108432869 13:50371827-50371849 GAGTAGAGTGGGAGGAATGAAGG + Intronic
1110281975 13:73704508-73704530 GGATAAACTGGGAGGATTGCTGG - Intronic
1111530854 13:89536314-89536336 GGCTAAAGTGGGAGGATTGCTGG - Intergenic
1112004773 13:95244913-95244935 GGGTACAGTTGGTGGAGAGCTGG - Intronic
1112333931 13:98498710-98498732 GTGTACAGTGGGGAGACGGCAGG - Intronic
1112786593 13:102957972-102957994 GGCTGAAGTGGGAGGATTGCTGG + Intergenic
1113513774 13:110875069-110875091 GGCCACAGTGAGAGAACTGCTGG - Intergenic
1113616624 13:111685082-111685104 AGATGCAGTGAGAGGACTGCGGG - Intergenic
1113622154 13:111770353-111770375 AGATGCAGTGAGAGGACTGCGGG - Intergenic
1113655716 13:112067027-112067049 GGGGACAGCGGGAGGAGCGCGGG - Intergenic
1114353011 14:21875052-21875074 GGCTACAGTGAGAGAACTGTTGG + Intergenic
1114635396 14:24184235-24184257 GGGTCCAGTGGGAAGACAGGAGG + Intronic
1115389884 14:32842442-32842464 GGCCAAAGTGGGAGGATTGCTGG + Intergenic
1115502985 14:34065664-34065686 GGGTATGGTGGGAGGACTCAGGG - Intronic
1115545416 14:34461943-34461965 GGGTGCAGGGGGAGGTCTGGGGG - Intronic
1115849386 14:37577402-37577424 GGCTGAAGTGGGAGGATTGCTGG - Intergenic
1116669107 14:47818010-47818032 GGGTACTAGGGGAGGGCTGCCGG - Intergenic
1117415385 14:55490801-55490823 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1120127419 14:80762391-80762413 GGTTACAGTGTGATGACTGAAGG - Intronic
1120790822 14:88580092-88580114 GGCTGAAGTGGGAGGATTGCTGG + Intronic
1120968400 14:90187427-90187449 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1121541834 14:94733660-94733682 GGGTGCAGTGGCAGGCCTGACGG + Intergenic
1121884256 14:97528540-97528562 GGGTACAGGGGCAGGAATGGAGG + Intergenic
1122507088 14:102238590-102238612 GGGTACTGAGGTTGGACTGCAGG - Intronic
1122566413 14:102660487-102660509 GGCTAAGGTGGGAGGATTGCTGG - Intronic
1122859262 14:104575215-104575237 GGCTTCAGTGGGGCGACTGCAGG - Intronic
1123899196 15:24859122-24859144 GGGTACAGGGGCAGGACTTGGGG + Intronic
1124192026 15:27587856-27587878 AGGTACAGTGGAAGGGCTTCAGG + Intergenic
1125569506 15:40705043-40705065 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1127949034 15:63786159-63786181 GGTTAAAGTGGGAGGACTGCTGG + Intronic
1128249168 15:66152725-66152747 GGCCACAGTGGGAGGACAGCAGG - Intronic
1128459874 15:67859019-67859041 GGGGTCAGTGGGAGTGCTGCTGG + Intergenic
1128756977 15:70189838-70189860 TGGTACAGGAGGAAGACTGCAGG - Intergenic
1129917285 15:79284617-79284639 GGGCTCAGTGGGAGGAATTCTGG + Intergenic
1131117315 15:89803318-89803340 GGGCACAGTGAGAGCACAGCTGG + Intronic
1133607296 16:7400330-7400352 GGGTTCAGTGGGAGGAGAGAGGG - Intronic
1133768163 16:8852084-8852106 GGCTGAAGTGGGAGGATTGCTGG - Intergenic
1135417263 16:22278104-22278126 GGTTAAAATGGGAGGATTGCTGG + Intronic
1135669805 16:24365607-24365629 GGGTACAGAGGGAGTCCTTCCGG - Intergenic
1135690005 16:24528772-24528794 GGCTGCAGTGGGATGATTGCTGG - Intergenic
1136220405 16:28824094-28824116 GGGATGACTGGGAGGACTGCGGG + Intronic
1136232639 16:28895761-28895783 GGCTAAGGTGTGAGGACTGCTGG + Intronic
1136240293 16:28939087-28939109 GTGGGCAGGGGGAGGACTGCTGG + Intronic
1136516715 16:30772966-30772988 GGGAACACTTGGAGGACTCCTGG + Intronic
1136559298 16:31029434-31029456 GGGAGGAGTGGGTGGACTGCCGG - Intergenic
1137248863 16:46728618-46728640 GGCTACAGTGGGAGGATCACTGG + Intronic
1137275717 16:46932138-46932160 GGCCAAAGTGGGAGGATTGCTGG + Intergenic
1137787287 16:51150114-51150136 GGGTACAAAGGGAGGACACCTGG - Intronic
1138450262 16:57089694-57089716 GTGCACAGTGGGAGGCCTGAAGG - Intergenic
1138588815 16:57988214-57988236 GGGGACAGTGTGGGGACTCCTGG + Intergenic
1141847805 16:86622718-86622740 GGCTGAAGTGGGAGGACTGCTGG + Intergenic
1142759325 17:2034181-2034203 GTGATCAGTGGGAGGTCTGCCGG + Intronic
1143163675 17:4886960-4886982 GGGGGCAATGGGAGGACAGCGGG - Intronic
1143544447 17:7588241-7588263 GGCTATCATGGGAGGACTGCAGG + Exonic
1143786573 17:9260220-9260242 GGCTGTGGTGGGAGGACTGCTGG + Intronic
1145105249 17:20110070-20110092 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1145179120 17:20729756-20729778 GGGTGAGGTGGGAGGACTGCTGG - Intergenic
1146235464 17:31156776-31156798 AGGTACAGAGGGAGGACAGCTGG - Intronic
1146397291 17:32479008-32479030 GGCTCATGTGGGAGGACTGCTGG - Intronic
1146852601 17:36236005-36236027 GGGTGAGGTGGGAGGATTGCTGG + Intronic
1146868511 17:36359877-36359899 GGGTGAGGTGGGAGGATTGCTGG + Intronic
1147071385 17:37960501-37960523 GGGTGAGGTGGGAGGATTGCTGG + Intergenic
1147082912 17:38040027-38040049 GGGTGAGGTGGGAGGATTGCTGG + Intronic
1147098855 17:38163998-38164020 GGGTGAGGTGGGAGGATTGCTGG + Intergenic
1147604163 17:41764615-41764637 AGGTACTGTGGGAGGACTGGGGG - Intronic
1147707178 17:42434147-42434169 GGGCACAGAGAGAGGACTGATGG + Intergenic
1148010688 17:44478412-44478434 GGCTGAAGTGGGAGCACTGCTGG + Intronic
1148484873 17:47984232-47984254 GGGCACAGGGGGTGGACCGCTGG - Intergenic
1148646518 17:49222545-49222567 GGGTACAGTGTCACCACTGCAGG - Exonic
1148771894 17:50072190-50072212 GGGTGCTGGGGGAGGAGTGCTGG - Intronic
1149838778 17:59939380-59939402 GGGTGAGGTGGGAGGATTGCTGG - Intronic
1149950639 17:60981069-60981091 GGGGGAAGTGGGAGGACTGCTGG - Intronic
1149985152 17:61341628-61341650 GGGTTCTGTGGAGGGACTGCTGG - Intronic
1150017443 17:61572685-61572707 GATTGCAGTGGGAGGATTGCTGG - Intergenic
1150080389 17:62233040-62233062 GGGTGAGGTGGGAGGATTGCTGG + Intergenic
1151322365 17:73359603-73359625 GGGTGCAGGGGGCGGTCTGCAGG - Intronic
1151341854 17:73476850-73476872 GGGTACAGAGGGCGGCCTGGGGG - Intronic
1152930985 17:83109760-83109782 GTGGCCAGTGGGAGGCCTGCTGG - Intergenic
1153438496 18:5091361-5091383 GGCTGACGTGGGAGGACTGCTGG - Intergenic
1155236411 18:23823935-23823957 GGCTGAAGTGGGAGGATTGCTGG + Intronic
1156301673 18:35841689-35841711 GGGAACATGGAGAGGACTGCAGG - Intergenic
1156570672 18:38249160-38249182 GGGGACAGTGGGAAGACTGTGGG - Intergenic
1156871584 18:41951896-41951918 GGCTAAGGTGGGAGGATTGCTGG + Intergenic
1158995504 18:62914535-62914557 GGGTACAGTGGGAGGACTGCTGG - Intronic
1159662091 18:71110267-71110289 GGGAACAGTGGCAGGACTGACGG - Intergenic
1160064252 18:75560385-75560407 GGCTAAAGTGGGAGAACTGAAGG + Intergenic
1160844206 19:1159485-1159507 GGGGACAGTGGGGGGACAGGGGG + Intronic
1160844221 19:1159533-1159555 GGGGACAGTGGGGGGACAGCAGG + Intronic
1160844236 19:1159583-1159605 GGGGACAGTGGAGGGACAGCAGG + Intronic
1160844250 19:1159614-1159636 GGGGGCAGTGGGGGGACAGCGGG + Intronic
1160844311 19:1159781-1159803 GGGGACAGTGGGGGAACAGCGGG + Intronic
1160844321 19:1159803-1159825 GGGGACAGTGGGGGGACAGGAGG + Intronic
1160936169 19:1596248-1596270 GGCCACAGTGAGAGGATTGCTGG - Intergenic
1161851841 19:6741172-6741194 GGGAGCGGTGGGAGGGCTGCGGG + Intronic
1162015233 19:7841888-7841910 TGGCACAGTGGGAGGGGTGCAGG + Intronic
1162273904 19:9638113-9638135 GAGTACAGTTGGAGGAGTGTGGG + Intronic
1162343407 19:10105902-10105924 GGGTACCCGGGGAGGACAGCTGG + Intergenic
1162729038 19:12706569-12706591 GGGTACAGGAGGCGGCCTGCAGG - Exonic
1164485811 19:28654884-28654906 GGGCACAGTGGAATGACGGCAGG - Intergenic
1164536184 19:29087941-29087963 GGGTGCAGTGGGGGGCCTGGAGG + Intergenic
1164953476 19:32359961-32359983 GGCTGAGGTGGGAGGACTGCCGG - Intronic
1165039593 19:33059693-33059715 GGGTACAGGGGGAGAAGGGCAGG - Intronic
1165074052 19:33270903-33270925 GGCTGCATTGGGAGGATTGCTGG + Intergenic
1165563912 19:36706754-36706776 GGCTACGGTGGGAGGATTGCTGG - Intronic
1167206252 19:48104682-48104704 GGGCTCAGGCGGAGGACTGCGGG - Exonic
1167833027 19:52042446-52042468 GGGTGAGGTGGGAGGATTGCTGG + Intronic
1168109696 19:54185291-54185313 GGTCATAGTGGGAGGACTGCTGG - Intronic
1168665087 19:58198940-58198962 GGGTGAAGTGGGAGAATTGCTGG + Intronic
926076832 2:9949711-9949733 GGGCACAGAGGAGGGACTGCTGG + Intergenic
926268634 2:11347584-11347606 GGCTGAAGTGGGAGGACTGCTGG - Intronic
926619960 2:15038658-15038680 GTGAACAGTAGGAGGACTTCTGG + Intergenic
926761081 2:16279764-16279786 GGGTACAGATGCTGGACTGCTGG - Intergenic
927146048 2:20167412-20167434 GGATACAGAGGGAGGCCTGAGGG - Intergenic
927471297 2:23379581-23379603 GGCTACAGGGGGAGCACAGCAGG - Intergenic
927515139 2:23667872-23667894 AGGAACAGAGGGAGGACGGCGGG - Intronic
928316053 2:30247054-30247076 GGCTGAGGTGGGAGGACTGCTGG - Intronic
929187366 2:39109096-39109118 GGCTAAGGTGGGAGGATTGCTGG + Intronic
929410889 2:41696564-41696586 GGGTACAGAAGGAGGCCAGCAGG - Intergenic
929459351 2:42090701-42090723 GGAGACACTGGGAGGAGTGCAGG + Intergenic
929555302 2:42922089-42922111 GGGTGCAGAGGCAGGATTGCAGG - Intergenic
929745435 2:44652714-44652736 GGGTCTAGTGGGAGGAGTGTGGG + Intronic
931207190 2:60159383-60159405 GGGGACAGTGGCAGGGCTGGTGG - Intergenic
931278363 2:60764515-60764537 GGGGAGGTTGGGAGGACTGCTGG - Intronic
932283017 2:70510903-70510925 GGCCAAAGTGGGAGGACTGCTGG + Intronic
933249070 2:80008286-80008308 GAGCACAGTGGGGTGACTGCGGG - Intronic
933986796 2:87598784-87598806 GGATAAAGTGGGAGGATTGCTGG + Intergenic
933993044 2:87647329-87647351 GGGTAGACTGGGAGGAGTGGAGG + Intergenic
934727311 2:96631943-96631965 GGCTAAGGTGGGAGGACTGCTGG + Intronic
934859893 2:97755709-97755731 GGGCACAGAGGGAAGACAGCAGG - Intergenic
934859898 2:97755731-97755753 GGGCACAGAGGGAAGACAGCAGG - Intergenic
935290705 2:101608579-101608601 GGCCACAGTGGGTGGATTGCTGG - Intergenic
935368476 2:102319922-102319944 GGCTGAGGTGGGAGGACTGCTGG - Intronic
936307047 2:111352025-111352047 GGATAAAGTGGGAGGATTGCTGG - Intergenic
936525692 2:113240158-113240180 GGTTGCAGTGGGGGGCCTGCAGG - Intronic
936725703 2:115312615-115312637 TGGTGCAGTTGGAGCACTGCAGG - Intronic
937034156 2:118766775-118766797 GGCTACAGAGGCAGGTCTGCAGG + Intergenic
937243660 2:120478340-120478362 GGGCACAGTGGGAGGCCTTTGGG + Intergenic
938101024 2:128498330-128498352 GGGTGCAGGGGGAGGAGTGAGGG + Intergenic
938240515 2:129739238-129739260 GGGAACCTTGGGAGGAATGCCGG - Intergenic
938374747 2:130798071-130798093 GGGGACGCTGGGCGGACTGCGGG - Intergenic
938552698 2:132395582-132395604 GGGTACAGTGGGAAGTGTTCAGG - Intergenic
938552730 2:132395742-132395764 GGGTACAGTGGGGGGTGTTCAGG - Intergenic
938790249 2:134669952-134669974 GGTTACAGTTGGAGGGTTGCTGG - Intronic
938988962 2:136608374-136608396 GGCTACAGTGGGAGAACAGGAGG + Intergenic
939449036 2:142348924-142348946 GGCTCAAGTGGGAGGATTGCTGG - Intergenic
940747520 2:157585246-157585268 ATGAACAGTGGGAGGACAGCAGG - Intronic
941985132 2:171503182-171503204 GGCTAAGGTGGGAGGATTGCTGG - Intergenic
943519042 2:188924508-188924530 GGCTGAAGTGGGAGGATTGCTGG + Intergenic
943621436 2:190152086-190152108 GGCTAAAGTGGGAGGATCGCTGG + Intronic
945452806 2:210013410-210013432 AGGTGAGGTGGGAGGACTGCTGG - Intronic
946488658 2:220126207-220126229 GGAGACAGGAGGAGGACTGCAGG + Intergenic
947791874 2:232873296-232873318 GTGTACAGTGGGAGGAGGCCAGG + Intronic
948107706 2:235428379-235428401 GGGACCAGTGGGAGTGCTGCTGG - Intergenic
948147254 2:235716936-235716958 GGGGACAGTGCCAGGGCTGCTGG - Intronic
948477196 2:238227707-238227729 GGGGACAGCAGGAGGACAGCCGG - Exonic
948999889 2:241607212-241607234 GGGTGCAGTGACAGGACAGCAGG + Intronic
1169232897 20:3904343-3904365 GGCCAAAGTGGGAGGATTGCTGG + Intronic
1169509234 20:6245643-6245665 TGGTCCACTGGGAGAACTGCAGG - Intergenic
1170730623 20:18971935-18971957 GGGGACAGTGCCAGGGCTGCAGG - Intergenic
1170757528 20:19217672-19217694 TGGCTCAGTGTGAGGACTGCTGG + Intronic
1171989053 20:31681538-31681560 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1172147919 20:32770033-32770055 GGCTGCAGTGGGAGGACTGCTGG - Intronic
1172173607 20:32959561-32959583 TGGGAGAGTGGCAGGACTGCTGG + Intronic
1172635472 20:36406976-36406998 GGGGACAGCGGGAAGCCTGCAGG + Intronic
1173149357 20:40552364-40552386 AGGTAAAGTGGCAGGAATGCAGG + Intergenic
1173231679 20:41203638-41203660 GGGTACAGGAGGGGGACTTCTGG - Exonic
1174365845 20:50055765-50055787 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1174496522 20:50948104-50948126 AGGTACAGGTGGAAGACTGCAGG + Intronic
1175132735 20:56801730-56801752 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1175910839 20:62404813-62404835 GGGTACGGCAGGAGGACTGCAGG + Intronic
1177092755 21:16790074-16790096 GGTCACGGTGGAAGGACTGCTGG - Intergenic
1179818652 21:43923736-43923758 GGGTACAGAGTGAGGCCTGGGGG + Intronic
1179907790 21:44433225-44433247 GGGGACAGTGAGATGACAGCAGG + Intronic
1180660695 22:17464598-17464620 GGCTGCAGAGGGAGGACTGCTGG - Intronic
1180954375 22:19735094-19735116 GAGAACATGGGGAGGACTGCAGG - Intergenic
1181912263 22:26248064-26248086 GGGTGCATTTGGAGGATTGCAGG + Intronic
1181962906 22:26635879-26635901 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1182537854 22:31019299-31019321 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1182575711 22:31271608-31271630 AGGGGCAGTGGGAGGAATGCTGG - Intronic
1182618624 22:31605464-31605486 GGGGCATGTGGGAGGACTGCTGG - Intronic
1182676271 22:32042285-32042307 GGGTTCAGAGGGAGGGCTGTGGG - Intergenic
1184148804 22:42626976-42626998 TGGTAGAGTGGGAAGAATGCTGG - Intronic
1184248642 22:43248238-43248260 GAGTACAGTGGGAGGGAAGCTGG + Intronic
1184273675 22:43398707-43398729 GGGTGCAGAGGAAGGAGTGCGGG - Intergenic
1184334898 22:43847428-43847450 GAGACCAGTGGGAGGAGTGCTGG - Intronic
950896349 3:16455070-16455092 GGCTGCAGTGGGAGGGTTGCTGG - Intronic
952421836 3:33139200-33139222 GGCTAAAGTGGGAGGATTGCTGG + Intronic
953512776 3:43559653-43559675 GAGTACAGGGGATGGACTGCTGG + Intronic
953813548 3:46134464-46134486 GGGTGAAGTGGGAGGATTTCTGG - Intergenic
953950416 3:47185177-47185199 GGTTGAAGTGGGAGGACTGCTGG - Intergenic
953973964 3:47368843-47368865 GGCCAAGGTGGGAGGACTGCTGG - Intergenic
954127255 3:48538853-48538875 TGGTACAGGGGGAGGCCTGGAGG + Intronic
954431382 3:50472645-50472667 GGGTCCAGGGGGAGCAATGCTGG - Intronic
955152040 3:56376994-56377016 GGATACTGTGGGAGCACTGAAGG - Intronic
955506953 3:59641894-59641916 GGGTACAGAAGGTGGAGTGCTGG + Intergenic
956982908 3:74660593-74660615 GGCTGAAGTGGGAGGATTGCTGG - Intergenic
958574431 3:95929636-95929658 GGGAAAAATGGGATGACTGCAGG - Intergenic
959472896 3:106774070-106774092 GGGTACTGTGGGAGCACCGTAGG - Intergenic
960095150 3:113682086-113682108 GGCAGAAGTGGGAGGACTGCTGG + Intronic
960426807 3:117518581-117518603 GGGTACGGTGGGAGGGTTGGAGG + Intergenic
961708861 3:128811225-128811247 GGCTATGGTGGGAAGACTGCTGG - Intronic
961854888 3:129860303-129860325 GGCTGAGGTGGGAGGACTGCTGG - Intronic
961938575 3:130612596-130612618 GGGTTTCATGGGAGGACTGCAGG + Intronic
963896250 3:150688017-150688039 GGCTAAGGTGGGAGGATTGCTGG + Intronic
964212066 3:154239676-154239698 GGGTACAGTGGAAGGGGTTCAGG + Intronic
966007029 3:175026930-175026952 AGGGACAGAGGGAAGACTGCAGG - Intronic
966242760 3:177773125-177773147 TGGTAGAGAGGGAGGATTGCTGG + Intergenic
966597278 3:181736081-181736103 GTGTTCAGTGTGAGGACTGCAGG - Intergenic
967875855 3:194268084-194268106 GGGGCCTGTGGGAGGACAGCTGG - Intergenic
968055463 3:195688275-195688297 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
968100329 3:195960322-195960344 GGTTGAGGTGGGAGGACTGCTGG + Intergenic
968256479 3:197277896-197277918 GGCTGAGGTGGGAGGACTGCTGG + Intronic
969406496 4:6996591-6996613 GGGTGGCGTGGGCGGACTGCAGG + Intronic
969613967 4:8241755-8241777 GGGTACATGGGGAGGGCTGAGGG - Intronic
969683986 4:8659180-8659202 GGGTGAGGTGGGAGGATTGCTGG + Intergenic
970131025 4:12871363-12871385 GCCCACAGTGGGAGGACTGAGGG - Intergenic
971177385 4:24293328-24293350 GGGTAAGGGGGGAGGAGTGCAGG - Intergenic
971569742 4:28196039-28196061 GAGTGAAGTGGGAGAACTGCTGG + Intergenic
972169918 4:36333582-36333604 AGGTGCAGTGGGATCACTGCTGG + Intronic
972644629 4:40955675-40955697 GGCTGAAGTGGGAGGACTGCTGG + Intronic
973678713 4:53293429-53293451 GGGTACATTTGCAGGAATGCAGG - Intronic
977572336 4:98641766-98641788 GGGGACAGTGGGAGTCCTGGTGG - Intronic
979360217 4:119754236-119754258 GGCTAAGGTGGGAGGACTGCTGG + Intergenic
979523134 4:121691041-121691063 GGGTAAAGTGTGGGGACTCCAGG - Intronic
981899125 4:149841635-149841657 GGTTACAGTGGGAAGATTGTGGG - Intergenic
982052769 4:151518920-151518942 GGATAAAGTGGGAGAACTGGAGG - Intronic
983115981 4:163816865-163816887 GGGTGCAGTGGGGGCACAGCGGG - Intronic
983587814 4:169375040-169375062 GCGCACAGTGTGAGGACTGCAGG - Intergenic
983613364 4:169674849-169674871 GGCTGAAGTGGAAGGACTGCTGG - Intronic
983787655 4:171753972-171753994 GGCTGAGGTGGGAGGACTGCCGG + Intergenic
985714199 5:1446369-1446391 GGGTACACGGGGAGGAACGCCGG - Intergenic
985726030 5:1516069-1516091 GGACACAGAGGGAGGGCTGCTGG + Intronic
985861158 5:2471611-2471633 GGGGACAGTGGAAGGAAGGCAGG + Intergenic
986537491 5:8805911-8805933 GGGTAAAGTGGGAGGGATGCAGG - Intergenic
987138815 5:14924733-14924755 GGCCAAAGTGGGAGGATTGCTGG - Intergenic
989369383 5:40690237-40690259 GGCTACAGCAGGAGGATTGCTGG + Intronic
990738775 5:58891344-58891366 CGGTACAGAGGGAGGATTTCAGG + Intergenic
991638675 5:68732249-68732271 GGGGACAGTGTGAGGATTGATGG + Intergenic
991699101 5:69300633-69300655 GGGTAGAGTGGTAGGACAGAAGG + Intronic
991699407 5:69303118-69303140 GGTTGAAGTGGGAGGATTGCTGG - Intronic
997517259 5:134499226-134499248 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
997997985 5:138601998-138602020 GGCTGAAGTGAGAGGACTGCTGG - Intergenic
998029982 5:138858225-138858247 GGCTGAGGTGGGAGGACTGCTGG - Intronic
998131732 5:139654892-139654914 GGGTAGCGTGGGAGGGCTGGGGG + Intronic
998460152 5:142304091-142304113 GGTTAAAGAGGGAGGACTGTTGG - Intergenic
999460809 5:151756571-151756593 GGCTGAAGTGGGAGGATTGCTGG - Intronic
999723929 5:154419352-154419374 GGGTTCAGAGGGTGGACCGCAGG - Exonic
1001453933 5:171846601-171846623 GGATGTAGTGGGAGGTCTGCAGG - Intergenic
1001817575 5:174682948-174682970 GGTTAAAGCGGGAGGATTGCTGG + Intergenic
1001865903 5:175105253-175105275 GGGTCAAGTGGGAAGTCTGCAGG + Intergenic
1002112344 5:176926534-176926556 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1003386471 6:5672382-5672404 TGGTACAGTGGGAGGAACACTGG - Intronic
1003517096 6:6826533-6826555 GGCTGCAGTGAGAGGCCTGCAGG - Intergenic
1004556939 6:16707407-16707429 CAGTAGAGTGGGAGGACTGGTGG - Intronic
1006067368 6:31471712-31471734 GGGCACAGCGGGAAGACTTCTGG + Intergenic
1006439826 6:34047112-34047134 GGGGCCACTGGGAGGACTGAGGG + Intronic
1006650874 6:35550360-35550382 GGCTGAAGTGGGAGGATTGCAGG + Intergenic
1007446129 6:41907509-41907531 GGGTCCTCTGGGAGGGCTGCGGG - Intronic
1007688646 6:43683125-43683147 GGGGCCAGTGGGATGACTTCAGG - Intronic
1008652513 6:53577422-53577444 GGCTAAAGTGGGAGGATTGCTGG + Intronic
1010472485 6:76245088-76245110 GAGGATAGTGGGAGGACTGTAGG - Intergenic
1010495641 6:76531859-76531881 GAGTACAGTGAGTGGACTTCTGG + Intergenic
1010992214 6:82492355-82492377 GGTTACAGGGGGTGGACTGGAGG - Intergenic
1011564210 6:88657720-88657742 GGGCACAGTGGGAGGAAGACTGG + Intronic
1013188350 6:107781544-107781566 GGCTGAAGTGGGAGGATTGCTGG + Intronic
1013601888 6:111712754-111712776 GGCTACAGGAGGAGGACTCCTGG + Intronic
1013754210 6:113441813-113441835 GGGAACCGAGGGAGGACTGGGGG + Intergenic
1014926288 6:127274883-127274905 GAGTCCAGTGGTATGACTGCAGG - Intronic
1015516856 6:134091076-134091098 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1015821604 6:137267041-137267063 GGGTGCAGTGGGAGGAGTTCAGG - Intergenic
1016250889 6:142040864-142040886 TGGTACAGTGGGAGGAATCTTGG + Intergenic
1017506434 6:155072794-155072816 GGGCACAGAGGGAGGAGTTCAGG + Intronic
1017594737 6:156016202-156016224 GGGGACAGTGGCAGGGTTGCTGG + Intergenic
1017656949 6:156638891-156638913 GGCCAAGGTGGGAGGACTGCTGG + Intergenic
1017678910 6:156843871-156843893 GGATGCAGTGTGAGGAGTGCTGG + Intronic
1018466034 6:164046096-164046118 GGCCAAAGTGGGAGGATTGCTGG - Intergenic
1019596238 7:1859703-1859725 GGGAACAGAGGGAGCCCTGCAGG - Intronic
1019629081 7:2036958-2036980 GGGAGCTGTGGGAGGAGTGCTGG - Intronic
1019639707 7:2096899-2096921 AGGTACAGTGGCAGACCTGCTGG - Intronic
1019759038 7:2795393-2795415 GGCCAAAGAGGGAGGACTGCTGG + Intronic
1020102432 7:5401850-5401872 GGCCAAAGTGGGAGGACCGCCGG + Intronic
1020204909 7:6106663-6106685 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1020419387 7:7984159-7984181 GGCTAAAATGGGAGGATTGCTGG - Intronic
1021874886 7:25039124-25039146 GGTTGAGGTGGGAGGACTGCTGG + Intergenic
1021971890 7:25973131-25973153 GGCTAAGGTGGGAGGACTACTGG + Intergenic
1023364258 7:39447414-39447436 GGGCATAGTGGAAGGAGTGCTGG + Intronic
1026678730 7:72449477-72449499 GGGCACAGAGGGAGGTTTGCTGG - Intergenic
1027233730 7:76286064-76286086 GGGCACAGTGGGTGGACAGGAGG - Exonic
1028450450 7:90976454-90976476 GGCTGAGGTGGGAGGACTGCTGG - Intronic
1028519718 7:91716603-91716625 GGCCAAAGTGAGAGGACTGCTGG + Intronic
1029071482 7:97902618-97902640 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1029090954 7:98048051-98048073 GGCTGAAGTGGGAGGACTGCTGG - Intergenic
1029632511 7:101761909-101761931 AGTTACAGTGGGATAACTGCAGG + Intergenic
1029684835 7:102139902-102139924 GGCTCAGGTGGGAGGACTGCTGG - Intronic
1032187807 7:129742428-129742450 GGGCAGAGTCGGAAGACTGCTGG - Intronic
1035026834 7:155831721-155831743 GAGTGCAGTGGGAGGAGCGCGGG + Intergenic
1035578923 8:727859-727881 GGGTGCAGTGAGACGAATGCAGG + Intronic
1036888042 8:12574650-12574672 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1037550896 8:19970352-19970374 GGGAAATGTAGGAGGACTGCTGG - Intergenic
1037776109 8:21836713-21836735 GGGTAAAGTGAGAGGGCTGCCGG - Intergenic
1039983463 8:42428480-42428502 GGAAACAGTGGGAGGATAGCAGG + Intronic
1040307228 8:46218415-46218437 GGGTAAACTGGGAGAACTGCAGG - Intergenic
1040308900 8:46226495-46226517 GGGTAGCGTGGGAGGGCTGCAGG + Intergenic
1040315680 8:46259655-46259677 GGGTAGTGTGGGAGGGCTGCAGG + Intergenic
1041079620 8:54203734-54203756 GGCTTAAGTGGGAGGATTGCTGG + Intergenic
1042543850 8:69933404-69933426 GGCTGAGGTGGGAGGACTGCTGG + Intergenic
1042751164 8:72159325-72159347 GGGCACAGTGTGAGGAGTGCAGG - Intergenic
1043564055 8:81528178-81528200 GGCTAAGGTGGGAGGATTGCTGG - Intronic
1045279115 8:100734192-100734214 GGCTGAAGTGGGAGGATTGCTGG - Intergenic
1047074760 8:121388622-121388644 AGGTACATTGGCAGGGCTGCTGG - Intergenic
1047327733 8:123855592-123855614 GGGTCCAGTGGGAAGACAGCCGG - Intronic
1049054032 8:140220858-140220880 GTGTAGAGCAGGAGGACTGCAGG - Intronic
1049219532 8:141422560-141422582 GGGTCCCCTGGGAGGCCTGCAGG + Intronic
1049475289 8:142794403-142794425 GGGTAAGGAGTGAGGACTGCAGG - Intergenic
1049598595 8:143496694-143496716 GGGAAAAGTGTGAGGACTGAGGG - Intronic
1049663539 8:143831518-143831540 GGCTAAGGTGGGAGGATTGCTGG + Intergenic
1050479296 9:6073364-6073386 GGGTCCAGCGGCAGGACTCCAGG + Intergenic
1052315783 9:27115396-27115418 GGCTGAAGTGGGAGGATTGCTGG + Intronic
1052779471 9:32765781-32765803 GGGTAGAGTGGAAGGAATACTGG - Intergenic
1052862569 9:33446000-33446022 GGGCTCAGTGGGAGGACTAACGG + Intronic
1055041559 9:71879053-71879075 GGCTGGAGTGGGAGGACTGCTGG + Intronic
1055415057 9:76072775-76072797 GCTTACAGTGGGAGGACTTGGGG - Intronic
1057032057 9:91783564-91783586 GGGTGAAGTGGGAGGACTGCCGG - Intronic
1057925914 9:99148729-99148751 GGCTGAAGTGGGAGGATTGCTGG + Intronic
1059052241 9:110938771-110938793 GGCTGAAGTGGGAGAACTGCTGG + Intronic
1059554728 9:115268184-115268206 GGGTAAAGTGGGAATCCTGCAGG - Intronic
1060452518 9:123756536-123756558 GGGCACAGGAGGATGACTGCTGG - Intronic
1060991929 9:127854394-127854416 GTGTCCAGTGGCAGGGCTGCGGG + Exonic
1061122090 9:128649586-128649608 GGCTAAGGTGGGAGAACTGCTGG + Intronic
1061132000 9:128713518-128713540 GGGTACACTGGCGGGACTGGCGG + Exonic
1061378981 9:130242982-130243004 AGGTGCAGAGGAAGGACTGCAGG + Intergenic
1061716366 9:132520900-132520922 GGGTAGGGATGGAGGACTGCGGG - Intronic
1062235483 9:135505868-135505890 GGGGCCAGTGGGAGGACAACAGG - Intergenic
1062271941 9:135713846-135713868 AGGTAGAGTGGGAGGACCCCTGG - Intronic
1062315511 9:135965195-135965217 GGGTACAGCGGGAGCCCAGCAGG + Intergenic
1062554204 9:137106657-137106679 TGGTAGAGTGAGATGACTGCTGG + Intronic
1062599512 9:137313599-137313621 GGGCCCAGAGGGAGGAGTGCAGG - Intronic
1062628392 9:137453151-137453173 GCGTGCAGTGGGAGCTCTGCAGG + Exonic
1203434121 Un_GL000195v1:121418-121440 GCCTACAGTCTGAGGACTGCAGG + Intergenic
1185821411 X:3208443-3208465 GGCTGAAGTGGGAGGATTGCTGG + Intergenic
1186299810 X:8187939-8187961 GGGGTCAGTGGGAGAACAGCAGG + Intergenic
1186465357 X:9780508-9780530 GGCTAAAGTGGGAGGATCGCTGG - Intronic
1186752033 X:12631255-12631277 GAGTACAGTGGTAGGCCTGAAGG - Intronic
1187322370 X:18251208-18251230 GGCTGAGGTGGGAGGACTGCTGG + Intronic
1190090812 X:47435678-47435700 GGCTGAGGTGGGAGGACTGCTGG - Intergenic
1190937130 X:55007371-55007393 GGGGTCAGTGGGAGGACCCCGGG - Exonic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1194257666 X:91653989-91654011 GGCTAGAGTAGGAGGACGGCTGG + Intergenic
1195065272 X:101233882-101233904 GGGTACAGCGAGAGGTCTGAGGG + Intronic
1197346071 X:125326753-125326775 GGGTAGAGTGGAAGGTCTGGGGG + Intergenic
1197944850 X:131827857-131827879 GGGGTCAGGGGGAGGACTGAAGG - Intergenic
1200042416 X:153379755-153379777 GGGCACAGTGGGAGGCCTGGGGG + Intergenic
1200576323 Y:4892935-4892957 GGCTAGAGTAGGAGGACGGCTGG + Intergenic