ID: 1158996287

View in Genome Browser
Species Human (GRCh38)
Location 18:62923494-62923516
Sequence CAGGATTATGTGAAGGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158996287 Original CRISPR CAGGATTATGTGAAGGGGGT GGG Intronic
904121051 1:28197984-28198006 CAGGGTTATGAGAATGGGCTGGG + Intergenic
905119797 1:35672861-35672883 CAGGATCATCAGAAGGAGGTGGG - Intergenic
906829037 1:49012371-49012393 CAGAATTATGAGCAGGTGGTTGG + Intronic
907118824 1:51991102-51991124 CAGGGATATGTTAAGGCGGTGGG - Intergenic
912811434 1:112798159-112798181 CAGGAATATGTGATGGGGAGTGG + Intergenic
913206692 1:116545506-116545528 CAGGATTCAGTGATGAGGGTGGG + Intronic
921149518 1:212388371-212388393 CAGGATTTTGTGAGGGAGGTAGG - Intronic
921624430 1:217362610-217362632 CTGGATTATGTATAAGGGGTTGG - Intergenic
922024604 1:221738977-221738999 GAGGACTATGTGAAGTGGCTGGG + Exonic
923014891 1:230119262-230119284 CAGGTTTTTGTGAAGGGAGCTGG + Intronic
1066447165 10:35493664-35493686 CAAGATTATGTGGAGAGTGTTGG - Intronic
1069950572 10:72015655-72015677 GAGGATGGTGTGAAGGGGGATGG - Intergenic
1070130317 10:73651277-73651299 CAGCATTATGGGAAGGGAGGGGG + Intronic
1070628501 10:78067918-78067940 CAGAATCATTGGAAGGGGGTGGG + Intergenic
1070906051 10:80074152-80074174 CAGGATTATAGGATGGGGGAAGG - Intergenic
1073054568 10:100690851-100690873 CAGGAGGATGTGAAGGAGGAAGG + Intergenic
1074640033 10:115369351-115369373 TAGGATTCTGTGAAGGCGATGGG + Intronic
1074881728 10:117664944-117664966 CAGGATTAAGTGGAGGGAGAGGG - Intergenic
1075274203 10:121078843-121078865 CAGGAATGTGCGAAGGGGGCAGG - Intergenic
1079407392 11:20158580-20158602 AAGGAGTATGAGAAGGGGTTTGG + Intronic
1081747057 11:45480767-45480789 CAGGATGATGGGAAGGTGGTGGG + Intergenic
1085529545 11:77183339-77183361 CAGGAGTGTCTGAAGAGGGTGGG + Intronic
1086008581 11:82070064-82070086 TAGGAGTATGTGTATGGGGTGGG - Intergenic
1087048082 11:93860982-93861004 CAGGATAATTTGAAGTGGGGAGG - Intergenic
1087203721 11:95372322-95372344 CAGGAGGATGTGAAGGAGGAGGG + Intergenic
1088517647 11:110656143-110656165 TAGGACTATGTGGAGGGGGTGGG + Intronic
1090109003 11:123884566-123884588 CAGGATTAAGTTAAGGAGGAAGG + Exonic
1090778393 11:129984882-129984904 CTGGATAATGAGAAGGAGGTAGG - Intronic
1091412392 12:252759-252781 CATGAATATGGGAAGGGGCTTGG - Intronic
1091998693 12:5015956-5015978 CAGGGTTCTGTGAACGCGGTGGG + Intergenic
1093080347 12:14803368-14803390 CAGGACTACGAGAAGCGGGTAGG + Exonic
1093390157 12:18608890-18608912 TTGGATTCTGTGCAGGGGGTGGG + Intronic
1096916570 12:55039790-55039812 CAGGATTTGGTGAGGGGGGAAGG - Intergenic
1097713901 12:62944790-62944812 CAGGAATATGAGAAAAGGGTAGG - Intergenic
1099071606 12:78051169-78051191 CAGCATTGTGTGAAGAGGGGAGG + Intronic
1101761140 12:107660074-107660096 CAGCATTATGGGATGGGGGTGGG + Intergenic
1102735882 12:115159051-115159073 CAGGAAGATGTCAAGGGGGAAGG - Intergenic
1102836703 12:116069277-116069299 CAGTGATATGTGAAGGGAGTTGG - Intronic
1106084397 13:26527286-26527308 CAGCATGGTGTGCAGGGGGTCGG - Intergenic
1107903664 13:45042977-45042999 CAGGATGATGTATAGTGGGTTGG + Intergenic
1107968982 13:45623045-45623067 CAGGATCTTGGGAGGGGGGTGGG + Intergenic
1109267685 13:60219924-60219946 GATTATTAAGTGAAGGGGGTGGG + Intergenic
1115840430 14:37463282-37463304 CATGATTAAGTTACGGGGGTGGG - Intronic
1118608128 14:67518036-67518058 CAGAATTGTGGGAAGGGGTTGGG + Intronic
1121238423 14:92410617-92410639 GCGGATTATGTAAAGGGTGTGGG - Intronic
1122210247 14:100168675-100168697 CAGGGGTATGTGTTGGGGGTGGG - Intergenic
1122571261 14:102704012-102704034 CTAGATTATATGAAGGGAGTGGG - Intronic
1125609380 15:40960411-40960433 CAGGATTTTGCCAAGAGGGTGGG + Intergenic
1131614676 15:94003956-94003978 CAGCATTGTGTGAAGGGGAGGGG - Intergenic
1131828478 15:96339047-96339069 GAGGATTAGGTGAATGGGGGTGG - Exonic
1133736999 16:8623403-8623425 CAGTTTTTTTTGAAGGGGGTGGG - Intronic
1135719345 16:24801878-24801900 CAGGATTAGATGAAGAGAGTGGG + Intronic
1135849164 16:25946998-25947020 TTGGATTATGTGAAGGGTTTGGG + Intronic
1135933307 16:26757770-26757792 CTGGCTTAGGTGATGGGGGTTGG + Intergenic
1135936680 16:26786375-26786397 ATAGATTATGTGAAGGGGGAAGG + Intergenic
1136075192 16:27812313-27812335 CAGGAGGATATGAAGAGGGTTGG + Intronic
1136136131 16:28258117-28258139 GAGGAGTATGGGAAGAGGGTGGG - Intergenic
1140739684 16:77930181-77930203 AAGGAATATGTGTTGGGGGTGGG - Intronic
1141562647 16:84879769-84879791 CAGGATTATGGGAAGGAAGAAGG - Intronic
1143224210 17:5286856-5286878 CAGGAGAAAGGGAAGGGGGTGGG + Intronic
1143588335 17:7863730-7863752 CAGGAGTAGGAGTAGGGGGTTGG - Intronic
1144005297 17:11094226-11094248 CAGAACCATTTGAAGGGGGTTGG - Intergenic
1145834007 17:27940152-27940174 CAGGTGTCTGTGAAGGGGGAAGG + Intergenic
1146373468 17:32279699-32279721 CACGCTTATGTGCACGGGGTGGG + Intronic
1146628101 17:34449210-34449232 CATGATTTTGTGTAGGGTGTAGG - Intergenic
1147032032 17:37646297-37646319 GAGAATTATGAGATGGGGGTGGG + Intergenic
1147568418 17:41551955-41551977 CAGCATGAGGTGAAGAGGGTGGG + Intergenic
1148739087 17:49881745-49881767 CAGGATTTAGAGAAGGGGCTTGG - Intergenic
1148765716 17:50037262-50037284 CAGGAATAGGAGAAGGAGGTGGG + Intergenic
1151866050 17:76803712-76803734 CAGGATAATTTGGTGGGGGTGGG - Intergenic
1154411760 18:14145607-14145629 CAGGATTTTGGGGAGGGGGCAGG - Intergenic
1158996287 18:62923494-62923516 CAGGATTATGTGAAGGGGGTGGG + Intronic
1159083786 18:63764218-63764240 TAGGATTATGTGAGGGCAGTGGG + Intronic
1160164437 18:76497113-76497135 CAGTTTTATGTGGAGGGGTTTGG - Exonic
1160782553 19:884308-884330 CAGGATTTTGTGCCGGAGGTGGG + Intronic
1160886401 19:1351004-1351026 CTGGCTTGTGTGAAGGGGGCTGG + Intergenic
1162445530 19:10720074-10720096 CAGGCTTCTGGGACGGGGGTGGG + Intronic
1163191676 19:15681348-15681370 CAGGATTTTGTGAAGTGTCTAGG + Intronic
1164891067 19:31824057-31824079 CAGGATACTGGGATGGGGGTGGG + Intergenic
1165431258 19:35774778-35774800 CGGCATTATGTGAGCGGGGTCGG + Intronic
1165956433 19:39504451-39504473 TAGGATTAGGTGATGGGGATGGG + Intronic
1166803842 19:45473372-45473394 GAGGATTAAGGGACGGGGGTGGG + Exonic
1167018318 19:46856387-46856409 AAGGATTTTGTAAAGAGGGTGGG - Intergenic
1167201362 19:48067717-48067739 CTGGAGTAGGGGAAGGGGGTGGG - Intronic
1168570079 19:57459372-57459394 CTGGAATATGTCAAAGGGGTCGG - Intronic
926148438 2:10411270-10411292 CAGGACAATGGGAAGGAGGTGGG + Intronic
929983483 2:46702022-46702044 TAAGATCATGTGAAGGGGCTGGG - Intronic
937133057 2:119527709-119527731 AAGGACTATGTGCAGAGGGTAGG + Intergenic
937661384 2:124433560-124433582 GGTGATTATGTGGAGGGGGTGGG - Intronic
937765221 2:125653091-125653113 CAGCATCATGTGCAGGGGTTGGG - Intergenic
938542562 2:132296633-132296655 CAGGATGATGTGGAGGTTGTGGG - Intergenic
940525535 2:154808821-154808843 CAGGAGAAGGTGAAGGAGGTGGG + Intronic
941878241 2:170456445-170456467 GAGGATTAAGAGATGGGGGTTGG + Intronic
941962788 2:171270023-171270045 CAGGATGAAGTGCTGGGGGTGGG + Intergenic
945722047 2:213429358-213429380 CAGCATTGTGGGAAGGTGGTGGG - Intronic
946914130 2:224498735-224498757 CAGGATTATGTGAATTGTGGTGG + Intronic
948934155 2:241151335-241151357 CTGCCTTATGTGAAAGGGGTAGG + Intronic
1168821011 20:773931-773953 CAGGAGAATGTGGAGGGGGGCGG - Intergenic
1172557739 20:35857075-35857097 CAGGGTTTTTTGCAGGGGGTGGG + Intronic
1175643874 20:60654617-60654639 CAGGACTATGTGGAGTGGGCAGG + Intergenic
1177143937 21:17387275-17387297 CAGTAATATGTGAAGGCAGTAGG - Intergenic
1181533184 22:23528714-23528736 CAGGATGTTTTGGAGGGGGTCGG - Intergenic
1183069780 22:35387903-35387925 CTGGATTTTCTGAAGGGGGAGGG - Intronic
1183492132 22:38122331-38122353 CAGGACAATGTCCAGGGGGTTGG + Intronic
1184394691 22:44226212-44226234 CAGGAGAAAGTGAAGGGGGGTGG - Intergenic
1184475116 22:44716129-44716151 CAGGAGTGTGTGCTGGGGGTGGG + Intronic
949705604 3:6813463-6813485 TAGGACTATGAGAAGGTGGTAGG - Intronic
950008343 3:9705228-9705250 CAGGGTTGTGTGGAAGGGGTCGG - Intronic
951145484 3:19221342-19221364 CAGAATTGTGTGAATGGGGAAGG + Intronic
952042948 3:29281847-29281869 CAGGAAGAAGTGATGGGGGTGGG - Intronic
957606671 3:82408075-82408097 CAGTAGAATGTGAAAGGGGTTGG + Intergenic
958578341 3:95983007-95983029 CACTTTTATGTGAAGGGGATAGG + Intergenic
960126866 3:114008495-114008517 CAGCATTATGTGGAGGGTGGAGG + Intronic
965453011 3:168861701-168861723 CAGGGTAATGTGAAGGGGATTGG + Intergenic
966860231 3:184227645-184227667 CAGGATGAGGGGCAGGGGGTGGG - Intronic
967800644 3:193655058-193655080 AAGCATTATCTGAAGGGAGTAGG + Intronic
969716320 4:8869982-8870004 CAAGTCTACGTGAAGGGGGTGGG + Intronic
971076404 4:23154027-23154049 CAGGACTATTTGAAGAGGGCAGG - Intergenic
975324383 4:73043029-73043051 CAGGATAATGTCAAGAGGGGAGG - Intergenic
976930160 4:90557091-90557113 CTAGATTATTTCAAGGGGGTGGG - Intronic
977595536 4:98875269-98875291 CAGTATTTTGGGAAGGTGGTTGG + Intronic
981296269 4:143135523-143135545 CATGATTATTCAAAGGGGGTGGG + Intergenic
982264941 4:153529764-153529786 ACAGGTTATGTGAAGGGGGTAGG - Intronic
983527782 4:168777821-168777843 CAGCATTGAATGAAGGGGGTGGG - Intronic
985064458 4:186106545-186106567 CAGGATTTTTTGGAGGGAGTAGG - Intronic
986784909 5:11105247-11105269 CAGGATTATCTGAAGGAGGTTGG - Intronic
987016429 5:13824811-13824833 CAGGATTACCTGAAGGAGGAAGG + Intronic
987581979 5:19805682-19805704 CAGGACTATTTGAAGGTGGTTGG - Intronic
989087877 5:37695157-37695179 CAGGAGTAAGAGAAGGGGGAGGG + Intronic
990553263 5:56905113-56905135 CAGGATAATGAGAAGAGAGTGGG - Intergenic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
997531046 5:134581503-134581525 CAGGATGGTGTGAAGGGGCAAGG - Exonic
997629717 5:135357540-135357562 CAGTATTATTTGAAGGAGTTAGG - Intronic
998985435 5:147751516-147751538 AAGGGTTATGTGAAGGGGGTGGG - Intronic
999151150 5:149427096-149427118 CAGGAATGTCTGAAGGGGATGGG - Intergenic
1000284171 5:159812273-159812295 TAGGATTTTGGGAAAGGGGTGGG - Intergenic
1001185413 5:169567001-169567023 CAGGAATAGGTGAAGGTGGAAGG - Intergenic
1001551327 5:172604103-172604125 AAGGCTTAGGTGAACGGGGTGGG + Intergenic
1002058311 5:176610914-176610936 CAGGGAAATGTGGAGGGGGTGGG - Intergenic
1003142227 6:3481196-3481218 CCAGATTTTGTGAAGGTGGTGGG - Intergenic
1004256713 6:14071255-14071277 CATGCTTATGTGCTGGGGGTGGG + Intergenic
1004966789 6:20861055-20861077 CAGGCTTCAGTGATGGGGGTAGG + Intronic
1006642037 6:35494610-35494632 CAGCTTTCTGTGAAGGGGCTAGG - Intronic
1006917460 6:37603594-37603616 CAGGAGTTAGTGAAGGGGGATGG - Intergenic
1007273947 6:40659992-40660014 CAGGATGATGTGAAAAGGATCGG - Intergenic
1007655598 6:43449399-43449421 CTGGAATATGGGAATGGGGTAGG - Intronic
1008788425 6:55198444-55198466 CAGGATTTTGTGTAGGGTGAGGG - Intronic
1009991092 6:70843686-70843708 CAGTATTAAGTCATGGGGGTGGG + Intronic
1010761934 6:79733596-79733618 CATGATTATGTCAAGGGTGTGGG + Intergenic
1012874545 6:104711153-104711175 CAGGCATATGTGAAGGAGGCAGG - Intergenic
1013173807 6:107660607-107660629 CAGCCTTATGTGAATGGGGTGGG + Intergenic
1014700341 6:124679142-124679164 CAGGATTATTTTTTGGGGGTGGG - Intronic
1017286963 6:152686397-152686419 CAGGCTTATGTGTTGGGGGGGGG + Intergenic
1017859472 6:158382061-158382083 CAGGAGTATGGGGAGGAGGTAGG + Intronic
1018661089 6:166087848-166087870 CAGGGGTGTGTGTAGGGGGTGGG + Intergenic
1020081964 7:5291064-5291086 CAGGAGTCAGTGCAGGGGGTGGG + Intronic
1022098354 7:27154733-27154755 CTGGAGTAGGTGATGGGGGTGGG + Exonic
1022816839 7:33922128-33922150 CAGAATTCTGTGAAGGTGATGGG - Intronic
1024249264 7:47494114-47494136 CAGGATTTTGTGAACAGGGGTGG - Intronic
1024531121 7:50393422-50393444 CAGGATGACATGAAGGGGGAAGG + Intronic
1026802828 7:73410819-73410841 AAGGCTTCTGTGCAGGGGGTGGG + Intergenic
1027029091 7:74875138-74875160 AAGGCTTCTGTGCAGGGGGTGGG + Intergenic
1027100759 7:75374644-75374666 AAGGCTTCTGTGCAGGGGGTGGG - Intergenic
1027947218 7:84763199-84763221 TAGGTTAATGTGAAGGTGGTAGG - Intergenic
1028122065 7:87067145-87067167 AAGTATGATGTGCAGGGGGTTGG + Intergenic
1030058872 7:105607320-105607342 CAGGATTGTGTGCAGGGAGAGGG - Exonic
1030872562 7:114775046-114775068 CAGGTTGACGTGAAGGTGGTGGG + Intergenic
1031394893 7:121261716-121261738 CAGGTTTATGTGCAGGGGTGGGG - Intronic
1031634996 7:124091795-124091817 CAGGATAATCTGAAGGTGGGAGG - Intergenic
1031810185 7:126357869-126357891 CAGGATTAAGTGAAGAGTGGAGG - Intergenic
1033051211 7:138006022-138006044 GAGGATTATGTGAAGGGGAGAGG + Intronic
1034588033 7:152113541-152113563 AAGTACTAGGTGAAGGGGGTGGG - Intronic
1035789356 8:2289612-2289634 CAGGATTATGGGAGGGGCCTGGG + Intergenic
1035803449 8:2432093-2432115 CAGGATTATGGGAGGGGCCTGGG - Intergenic
1037782709 8:21881697-21881719 CAGCAGTAGGGGAAGGGGGTGGG - Intergenic
1039287495 8:36058273-36058295 CAGTTTTCTGGGAAGGGGGTGGG + Intergenic
1042325973 8:67528284-67528306 CAGGCAAATGTGAAGGGAGTGGG + Intronic
1044531918 8:93316828-93316850 CAGGATTCTGTGAAGGGGTAAGG + Intergenic
1044951735 8:97441947-97441969 CAGGATTAATAAAAGGGGGTTGG + Intergenic
1048050531 8:130811889-130811911 CATTATTATGTGAATGGGTTTGG - Intronic
1048700519 8:137083463-137083485 TAGGATCTTGTGATGGGGGTAGG + Intergenic
1049653504 8:143787748-143787770 CAGGATGAGGGGAAGGAGGTGGG - Intergenic
1051491566 9:17672634-17672656 CTGTATTGGGTGAAGGGGGTGGG - Intronic
1051882518 9:21854428-21854450 CAGGATTATGTGAATGAGAAAGG + Intronic
1052517901 9:29507403-29507425 CAGGATTCTGTGGAGGGTGGTGG - Intergenic
1052746000 9:32441635-32441657 AAGGATTTTAGGAAGGGGGTTGG + Intronic
1056705368 9:88948057-88948079 CAGAATTAAGTGAAGGAGGTAGG + Intergenic
1057318099 9:93984559-93984581 CAGGATTATAAGAAAGGGGGAGG + Intergenic
1059722602 9:116975802-116975824 CAAGATTTTGTGGAGGTGGTGGG + Intronic
1060022859 9:120147196-120147218 CATGTGTATGTGTAGGGGGTAGG - Intergenic
1062123320 9:134846123-134846145 CAGGATTTTAAGAAAGGGGTGGG - Intergenic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1194884878 X:99301715-99301737 CAGGGTTATGTGATGGAGGATGG + Intergenic
1196873461 X:120135492-120135514 CAGGCTTCTGTGAAGGAGCTGGG + Intergenic
1197255261 X:124256482-124256504 CAGCTTTATGTCAAGGGAGTAGG + Intronic
1197327481 X:125111447-125111469 CAGGGTTATTTCAAGGGTGTTGG + Intergenic
1198039716 X:132838148-132838170 CAGGATCTGGTGAAGTGGGTGGG - Intronic