ID: 1158996647

View in Genome Browser
Species Human (GRCh38)
Location 18:62927304-62927326
Sequence AAAGATGAACAGATCCATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 223}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158996642_1158996647 3 Left 1158996642 18:62927278-62927300 CCTGATACCCTGAAAATGACTGG 0: 1
1: 0
2: 1
3: 10
4: 149
Right 1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG 0: 1
1: 1
2: 1
3: 15
4: 223
1158996645_1158996647 -4 Left 1158996645 18:62927285-62927307 CCCTGAAAATGACTGGGAAAAAG 0: 1
1: 0
2: 2
3: 48
4: 507
Right 1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG 0: 1
1: 1
2: 1
3: 15
4: 223
1158996646_1158996647 -5 Left 1158996646 18:62927286-62927308 CCTGAAAATGACTGGGAAAAAGA 0: 1
1: 0
2: 3
3: 71
4: 851
Right 1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG 0: 1
1: 1
2: 1
3: 15
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158996647 Original CRISPR AAAGATGAACAGATCCATAT TGG Intronic
900766392 1:4508800-4508822 AAACATGAAACGATCCACATGGG - Intergenic
902423881 1:16303960-16303982 AAATATGAACAATTCCATCTTGG - Intronic
902799708 1:18821608-18821630 AGAGATGACCTGATCCAGATTGG + Intergenic
903373535 1:22852026-22852048 AAACATGAACAACTCCAGATAGG - Intronic
906366630 1:45215546-45215568 AAAGAAGCACAGAGCCAGATAGG - Intronic
909024041 1:70462876-70462898 AAAGTTGCACAGAGCCATGTGGG - Intergenic
909213214 1:72850665-72850687 AAAGATGAACAGACTCTTTTTGG - Intergenic
910682409 1:89881176-89881198 AAAGATGTAAAGAACCATAAAGG - Intronic
911577834 1:99599247-99599269 AGTGATGAACAGACTCATATGGG - Intergenic
913689502 1:121265762-121265784 AGAGATAAACATATCCAAATTGG - Intronic
914381322 1:147118973-147118995 AAAGATGAAGAGATTCATAAAGG - Intergenic
916315451 1:163443402-163443424 AAATGTAAACAGATGCATATAGG + Intergenic
916747250 1:167694067-167694089 AAAGATGAACAATTTCAAATAGG - Intronic
917227214 1:172797166-172797188 AAAGCTGAATAAATCCAAATTGG + Intergenic
918375455 1:183904727-183904749 AAAGATGAAGAAAACCATCTAGG - Intronic
921343625 1:214158952-214158974 AAAGAAGAAAAGATCAATTTTGG + Intergenic
923783466 1:237045514-237045536 AAAGATAAACAGACCCAAGTGGG - Intronic
924144472 1:241059818-241059840 AAAGAGGATCAGTTCCATTTTGG - Intronic
924702155 1:246464806-246464828 AAACATTAACAGATCCATGGGGG - Intronic
924787611 1:247212820-247212842 AATGATAAACAGTACCATATGGG - Intergenic
1063026602 10:2185013-2185035 AAAGATGAACACATCCATATTGG + Intergenic
1064214902 10:13391999-13392021 AGAGATGAACAGATCAGTTTGGG + Intergenic
1064466819 10:15591700-15591722 AATGATAAGCAGAGCCATATAGG - Intronic
1065138328 10:22694993-22695015 AAAGATACACGGATCCAAATGGG - Intronic
1070371806 10:75789427-75789449 AGAGATGACCAGATTCAGATAGG + Intronic
1071286523 10:84152986-84153008 AAACATGACCACATCTATATTGG - Exonic
1072031979 10:91529963-91529985 AAAGGTGACCAGATCTTTATGGG - Intergenic
1073605533 10:104892149-104892171 AAAGATGAACAGACCCTGAATGG - Intronic
1074086518 10:110212007-110212029 AGAGAAGAACAGATCCATAAAGG + Intronic
1077884131 11:6373453-6373475 AAAGATCAAAAGCTCCATTTTGG + Intergenic
1078985514 11:16591839-16591861 AAAGAAAAATAGATCCAAATGGG - Intronic
1079624777 11:22603487-22603509 ATATATGTACAGATCAATATTGG - Intergenic
1079849519 11:25513503-25513525 AAAGATGAAAAGAGTCAAATAGG + Intergenic
1080524733 11:33103781-33103803 AAATATGTACAGATTCATCTGGG + Intronic
1080747896 11:35125595-35125617 AAAGAAGAACATATCCATAGGGG + Intergenic
1081063614 11:38511028-38511050 CAAGATGAAAAGATCTATAGAGG - Intergenic
1082697012 11:56380154-56380176 AAGGATGAAAATATCCATGTTGG - Intergenic
1085646752 11:78228941-78228963 TAAAATGAACAAATCCAGATGGG - Intronic
1086487097 11:87317814-87317836 AAGGATGAACAGATCTATCAGGG + Intronic
1086792033 11:91052670-91052692 CCAGATGAACAGAACCACATAGG + Intergenic
1087583146 11:100084787-100084809 AAAGAGGAACAAAATCATATTGG - Intronic
1087968014 11:104442069-104442091 AAAGATTAAGAGATCCAGAGGGG + Intergenic
1088045961 11:105451808-105451830 AAAAATGAACAGATCCTGAGAGG - Intergenic
1090559519 11:127916216-127916238 ATAGATGAATAGATCAATAGAGG - Intergenic
1093541789 12:20296186-20296208 AAAGATGAACAAAACCAAGTTGG - Intergenic
1093642113 12:21540228-21540250 AAACATGAAGAAATACATATAGG + Intronic
1093739920 12:22673387-22673409 AAAAATGAAAAGTTCCATTTTGG - Intronic
1095903533 12:47353775-47353797 AACGATGAACAGATCAGAATAGG + Intergenic
1096036968 12:48481068-48481090 AAAGATGAAAAGCTTCCTATTGG + Intergenic
1098510019 12:71300746-71300768 AAAGATGGCCATATGCATATGGG + Intronic
1099863244 12:88245893-88245915 ATAGATGAACAGAAAAATATCGG + Intergenic
1099894857 12:88632383-88632405 AAAGATGGAAAGATACATTTTGG + Intergenic
1100591722 12:96035880-96035902 AAAGTTGAACAGAGCCAAAATGG - Intronic
1102623035 12:114211865-114211887 AAAGATGACAAGATACTTATTGG - Intergenic
1105620844 13:22064547-22064569 AAAAATGAATACATCTATATGGG + Intergenic
1106064737 13:26334854-26334876 AAAAATGAACATATCAAAATCGG + Intronic
1106375695 13:29185256-29185278 AAAGATGAACAGAGCCTCAAAGG + Intronic
1106774535 13:32996107-32996129 AAAGATTAACAAATACAAATAGG + Intergenic
1106802070 13:33266373-33266395 AAAGATGAATAGATAAACATGGG - Intronic
1107091031 13:36480008-36480030 GAAGATGTAAATATCCATATAGG + Intergenic
1108079424 13:46719388-46719410 AAACATTTACAGATCCATAATGG + Intronic
1110244469 13:73306183-73306205 AGAGATGAAGAGTTCCATTTTGG - Intergenic
1110718682 13:78737250-78737272 ACAGAAGAGCACATCCATATGGG + Intergenic
1111019863 13:82435516-82435538 AAGGAAGAATAGATACATATGGG - Intergenic
1111235015 13:85398476-85398498 AAAGAGCAACAAATCCATAAGGG - Intergenic
1112728171 13:102329040-102329062 GAGGATGTACAGAACCATATGGG - Intronic
1113986783 13:114323921-114323943 GAAAATGTACAAATCCATATGGG + Exonic
1113989058 13:114344480-114344502 TAAGGTGAACAGATTCTTATTGG + Intergenic
1115163969 14:30427450-30427472 AAAGATGAAAAGATCATTCTGGG + Intergenic
1115467411 14:33730902-33730924 AAAAATGAAAAGATTCATTTAGG + Intronic
1116610309 14:47061512-47061534 AAAGATGACAACATCCAGATTGG - Exonic
1117343473 14:54810801-54810823 ACAGATGAACTGATACATAGTGG + Intergenic
1118231561 14:63955798-63955820 AAAAATGAACAGAAGCATTTTGG - Intronic
1119075249 14:71631548-71631570 AAAGATAAAAAGTTTCATATTGG - Intronic
1121391081 14:93575309-93575331 AAAGATGAACACAGCGAGATGGG - Intronic
1124090213 15:26592330-26592352 CAAGATCACCACATCCATATTGG + Intronic
1125073673 15:35587555-35587577 AAAGATGAAAAGAATCTTATAGG - Intergenic
1125081986 15:35685517-35685539 AAAGATGTACAGATACCTACAGG + Intergenic
1125700527 15:41678891-41678913 AAAGATAAACATAAACATATAGG - Intronic
1126157485 15:45578828-45578850 AAATATGAACACATTCATATAGG - Intergenic
1127563507 15:60163870-60163892 ATAGATGAAGAGATCCATGAAGG + Intergenic
1129633364 15:77287767-77287789 AAAGATGAACAGCTCGGTTTGGG - Intronic
1132334263 15:101034769-101034791 AAACCTGAACAGATCAATAATGG - Intronic
1133500345 16:6360117-6360139 AAACAAGAACAGATGCATACTGG - Intronic
1136900676 16:34034360-34034382 ATAGATGCACAGTTCCACATGGG + Intergenic
1136940075 16:34515370-34515392 ATAGATGCACAGTTCCACATGGG - Intergenic
1136959744 16:34833196-34833218 ATAGATGCACAGTTCCACATGGG + Intergenic
1138986549 16:62335762-62335784 AAAGATGAAAACATACAAATTGG + Intergenic
1139898086 16:70304336-70304358 AAAGATGAACAGATGAACCTCGG - Intronic
1146862836 17:36319688-36319710 AAAAATAAACAGAACCATAGTGG + Intronic
1147093165 17:38123771-38123793 AAAAATAAACAGAACCATAGTGG + Intergenic
1147104042 17:38196717-38196739 AAAAATAAACAGAACCATAGTGG - Intergenic
1148335106 17:46835755-46835777 AATGAGGAACAGATCCAGCTGGG + Intronic
1148425445 17:47591688-47591710 AAAAATAAACAGAACCATAGTGG + Intronic
1149053133 17:52330457-52330479 ACAGGTGAACAGAGCAATATTGG - Intergenic
1152497744 17:80686029-80686051 AAAAATGAACAGCACCAGATGGG - Intronic
1154477960 18:14784560-14784582 AAAGATGAATAGTTCAATATTGG + Intronic
1155710867 18:28877504-28877526 AAAGAGGAACAGGTACATACAGG - Intergenic
1156926114 18:42582025-42582047 ACAAATGAACAGATAGATATGGG + Intergenic
1158996647 18:62927304-62927326 AAAGATGAACAGATCCATATTGG + Intronic
1160092069 18:75836899-75836921 AGAGATGAACAGATCTATTGGGG - Intergenic
1162535296 19:11260070-11260092 ATGGATGAACAGATGAATATAGG + Intronic
1167954544 19:53054098-53054120 AAAGCTGAACAGAAACATCTTGG + Intergenic
1168556074 19:57341009-57341031 AAAGTTGTACAGAGCCATGTGGG - Intergenic
1168607665 19:57772656-57772678 ACAGATGAAGAGATGCATAAGGG + Intronic
1168727707 19:58597281-58597303 TAAGATGAATAGATTCTTATTGG + Intergenic
933422119 2:82062024-82062046 ACAGATGAAGAGATGCATACGGG + Intergenic
934150098 2:89138241-89138263 AAAGATGAGAGGATCCAAATGGG - Intergenic
936233780 2:110726010-110726032 AAGGATGCACAGATCCACAGTGG - Intergenic
937788051 2:125925429-125925451 AAAGATGAACAGATGAATTCCGG + Intergenic
938762538 2:134438862-134438884 AGAGATGAAAAGAAACATATTGG - Intronic
939543028 2:143516906-143516928 AAAAATGCACATTTCCATATTGG + Intronic
940378434 2:152985601-152985623 AAACATGAACAGTTCCAAAAGGG - Intergenic
940425819 2:153531134-153531156 AAAAATGAACTGATACAGATGGG - Intergenic
946637521 2:221746023-221746045 GTAGATAAACAGATACATATTGG - Intergenic
948750680 2:240130877-240130899 AGAGATGAACAGAATCATCTAGG + Intronic
1168730156 20:70416-70438 GAAGATGAGCAAATCCAAATAGG + Intergenic
1170918458 20:20652294-20652316 AAAGATGAACAGGTGCAGTTTGG - Intronic
1172601495 20:36186729-36186751 AAAGATGTTCAGATCAATATGGG + Intronic
1175548294 20:59795522-59795544 AAAAATGAACAGAGAAATATTGG - Intronic
1177714661 21:24823366-24823388 TAATATGAACAGTTCGATATTGG + Intergenic
1177960260 21:27656537-27656559 AAAGATGAACAGAGACTTAGGGG - Intergenic
1178896213 21:36560781-36560803 AAGGAAGATCAGATCCATTTTGG - Intronic
1179900480 21:44390879-44390901 GCAGATGAACAGGTGCATATTGG - Intronic
1180736399 22:18021099-18021121 AAAGATGAACTGATATACATGGG + Intronic
1183212415 22:36459044-36459066 AAAAATGACCATATCCTTATAGG + Intergenic
1183412255 22:37661759-37661781 AAAGGTGAACAGCTCCATCCTGG + Intronic
950753672 3:15154053-15154075 AAAGTTGAACAGAACCACAAAGG + Intergenic
951455795 3:22890846-22890868 AAAGATAAACAGATCCAAAGAGG + Intergenic
957849248 3:85784693-85784715 ATAGATGCAAAAATCCATATCGG - Intronic
957938235 3:86970852-86970874 AAAGATCAATGGGTCCATATTGG - Intronic
958485043 3:94694553-94694575 AAAGATGAACAAAGCAAGATTGG + Intergenic
959273153 3:104240283-104240305 AATGATGAAGAGGTCAATATGGG - Intergenic
959467785 3:106710526-106710548 AAAGATGAACCTATCCATGTTGG - Intergenic
959791104 3:110362629-110362651 AGAGATGAAGAGAAGCATATTGG + Intergenic
960184889 3:114626175-114626197 AGAGATGCACAGATGTATATGGG + Intronic
960337728 3:116438897-116438919 AAAGATGAACAAATTCAAACGGG - Intronic
960596242 3:119410586-119410608 AAAGATGAAGAGATTCATATGGG + Intronic
960871357 3:122253013-122253035 AAAGATCAACAGCTGGATATAGG - Intronic
962109021 3:132422659-132422681 AAAGATGATCATAACCATGTTGG - Intronic
963224723 3:142850785-142850807 GAAGATGAACAGAATAATATGGG + Intronic
963702554 3:148644387-148644409 ATAGATGCTCAGATCTATATAGG + Intergenic
963724950 3:148909332-148909354 AAAGAGGCACAAATGCATATGGG + Intergenic
965950039 3:174297837-174297859 AAAGATGAAGAGATTCACAAGGG - Intergenic
968373245 4:14745-14767 CAAGGTGAACAGATTCTTATTGG - Intergenic
970057903 4:11996009-11996031 AAAGATGAGAAGAGCCATCTAGG - Intergenic
970104443 4:12565008-12565030 AGAGATGAATAGATACACATGGG + Intergenic
970390630 4:15607802-15607824 AATGATAATCAGATCCATTTTGG - Intronic
972122124 4:35716734-35716756 AAACCTGAACAGATCAATAATGG + Intergenic
972164434 4:36265381-36265403 AAAGATCAACATAGCCATCTGGG - Intergenic
972462101 4:39314383-39314405 AAAGATAATCAGAGCCATAGTGG - Intronic
975687877 4:76935749-76935771 AAAGGTGATCAGATCCAGTTTGG + Intergenic
976548421 4:86365000-86365022 AAAAAAGAACAGATACATATTGG + Intronic
978607186 4:110493600-110493622 AAAGTTGAACAGAACCTAATGGG + Intronic
979287679 4:118944454-118944476 ATAAATGGACATATCCATATTGG + Intronic
980682520 4:136182460-136182482 AAAAATGAAATGATACATATGGG + Intergenic
981200961 4:141979040-141979062 AAAGATGACGAGACCCATCTGGG + Intergenic
983609419 4:169626223-169626245 ACAGATGAACAGATGCATAGGGG + Intronic
985462149 4:190117823-190117845 CAAGGTGAACAGATTCTTATTGG + Intergenic
985870061 5:2547275-2547297 AAAGATGAATAAAAGCATATGGG - Intergenic
986008677 5:3691399-3691421 AAGGATGAACAGATACAATTAGG + Intergenic
986428257 5:7655841-7655863 AAAGGTGATCAGATGCAGATGGG - Intronic
987166266 5:15201759-15201781 AAAGATGAAGAGGCCCATCTGGG - Intergenic
989621678 5:43390499-43390521 AAAGCCCAACAGATCCATCTGGG + Intronic
989810697 5:45669586-45669608 AAAGAAGAAAAGATCCAAAATGG + Intronic
990537286 5:56735211-56735233 CAAAATGAACAGAAGCATATTGG - Intergenic
991557955 5:67916870-67916892 ACAGATGAAAGGATCAATATAGG + Intergenic
994020533 5:95018965-95018987 AAACATAAACACATACATATAGG + Intronic
995955014 5:117766976-117766998 AAAGATGTACAGGCTCATATTGG + Intergenic
998186476 5:139983418-139983440 GAAGAGGAGCAGATCCAGATGGG - Intronic
998324792 5:141270637-141270659 ACAGATGAAGAGATGCATAGAGG - Intergenic
999344116 5:150799705-150799727 AAAGATGAACTGACACGTATTGG - Intergenic
999479921 5:151938597-151938619 AAAGATGAAGAGATGCAGAGGGG + Intergenic
1003850849 6:10220943-10220965 ACAGGTGAACAGATCCAGAGGGG - Intergenic
1005771368 6:29076094-29076116 AATTATGAACAGATACACATTGG - Intronic
1006487530 6:34355924-34355946 ACAGATGAAGAGATGCATAGGGG - Intronic
1007361419 6:41359256-41359278 AAACATGAACAGAACCATGTGGG + Intergenic
1009648157 6:66435943-66435965 AAACATGAACAGAAACATAAAGG + Intergenic
1009742748 6:67768636-67768658 AAAGATGAGCAGATTCTTTTTGG + Intergenic
1011566024 6:88672947-88672969 ACAGATGTACAGATACTTATTGG + Intronic
1011613247 6:89173933-89173955 AACAATGAACAGATCCTTATTGG - Intergenic
1011625081 6:89276239-89276261 GAATATAAACAGATCCATAGGGG + Intronic
1013479603 6:110542696-110542718 AATGATAAAAAGATCCACATGGG + Intergenic
1014790469 6:125666415-125666437 AAAAATTAACGGATCCATCTGGG + Intergenic
1016976166 6:149810787-149810809 AAAGAGGCACAGAGCCAAATTGG + Exonic
1017255410 6:152328140-152328162 AAAGAGGGACAGAGCCTTATAGG + Intronic
1017473982 6:154769768-154769790 AAAAATAAACAAATACATATAGG - Intronic
1017738563 6:157384098-157384120 AATCTTGAACAGATCCAAATTGG + Intronic
1019234746 6:170601241-170601263 TAAGGTGAACAGATGCTTATTGG + Intergenic
1021110299 7:16686328-16686350 AAAGATTACCAGATCGATTTCGG - Intronic
1021666109 7:22982488-22982510 AGAGATACATAGATCCATATTGG + Intronic
1022157006 7:27670838-27670860 GAAGATGAACTGAACCATCTTGG - Intergenic
1023454451 7:40323096-40323118 AGAGATTAACAGAGCCATATGGG - Intronic
1023699772 7:42881693-42881715 CAAGATGAACTCAGCCATATTGG - Intergenic
1027463438 7:78484603-78484625 GGAAATGAACAAATCCATATAGG - Intronic
1027675427 7:81151912-81151934 AAAGCTGAACAAATGCATTTAGG - Intergenic
1028859607 7:95633934-95633956 ATAGATGAACACAGGCATATAGG + Intergenic
1029036666 7:97529500-97529522 ACAGATGAAGAGATGCATAGGGG + Intergenic
1031067060 7:117116433-117116455 AGAGCTGCACAGATCCAAATGGG - Intronic
1031090773 7:117351077-117351099 TAACATGCACAGGTCCATATGGG + Intergenic
1031789425 7:126082252-126082274 AAAAATGCACTGATCCATTTAGG + Intergenic
1031859596 7:126962970-126962992 AAAGTTGGACAGAGACATATAGG - Intronic
1032627361 7:133606316-133606338 AGAGATGTACAGAGCAATATTGG - Intronic
1039272679 8:35899949-35899971 AAACATGAACAGAGCCCTGTTGG - Intergenic
1040609083 8:48964471-48964493 AAAGAGGTACAGATACATACAGG + Intergenic
1041627084 8:60042544-60042566 AAATATGTACAGTTCCATAATGG + Intergenic
1043569926 8:81591218-81591240 AAGGATGAAGAGAACCATAATGG - Intergenic
1043574465 8:81642191-81642213 AAAGATGAAGAGAACCATGATGG - Intergenic
1044017983 8:87069955-87069977 AAAACTGAACAGAACCACATGGG - Intronic
1045019062 8:98025771-98025793 AAAAATGGACAGATCCAAAATGG - Intronic
1045555597 8:103211998-103212020 AAGGATGAACAGAATCTTATTGG - Intronic
1046164766 8:110417961-110417983 AAAGATAAACAGGTGCATTTTGG + Intergenic
1048102758 8:131372491-131372513 AAATATGAACAGACCAATAATGG + Intergenic
1050583391 9:7084833-7084855 AAAGATGAACAAGAACATATGGG + Intergenic
1050673120 9:8020189-8020211 AAAGACAAACAGAACCATTTTGG - Intergenic
1052011059 9:23409772-23409794 AAATATAAACAGATACATATTGG + Intergenic
1052808187 9:33032115-33032137 AAATATTAACAGTTCCAGATTGG - Intronic
1055348965 9:75365491-75365513 AAATATGGACAGAACCATAAAGG - Intergenic
1055604618 9:77955638-77955660 AAATATGAAAAGATCAAAATAGG + Intronic
1061166200 9:128923649-128923671 AAAGATATACATATACATATGGG - Intronic
1186016648 X:5203049-5203071 ATAGATCAATAGATGCATATTGG + Intergenic
1187498939 X:19822333-19822355 AAAAATGAACAGAGCCTTAGAGG - Intronic
1189977514 X:46477485-46477507 CAAGAGGAACAGATCCAGAAGGG + Intronic
1190181414 X:48195678-48195700 AAAGATGTACAGACCCTTGTTGG + Intronic
1190187000 X:48243976-48243998 AAAGATGTACAGACCCTTGTTGG + Intronic
1190194455 X:48305168-48305190 AAAGATGTACAGACCCTTGTTGG + Intergenic
1190216195 X:48481098-48481120 GAAGATGCACAGAGCCAGATGGG + Intronic
1190655919 X:52612079-52612101 AAAGATGTACAGACCCTTGTTGG + Intergenic
1190657470 X:52624663-52624685 AAAGATGTACAGACCCTTGTTGG - Intergenic
1190660960 X:52653793-52653815 AAAGATGTACAGACCCTTGTTGG + Intronic
1192938390 X:75885602-75885624 AATTATGAACAGATACATATTGG + Intergenic
1193790841 X:85813701-85813723 ACAGATGACCAGAGCCACATGGG + Intergenic
1193908270 X:87269411-87269433 TAATATGAACATATCTATATAGG - Intergenic
1193995126 X:88356865-88356887 AAATATGAAAACATCCAAATTGG + Intergenic
1194867714 X:99089030-99089052 AAAGATCAACAAATCCAGAGGGG + Intergenic
1196600046 X:117591016-117591038 AAAGGTGAACAGAACCAAGTTGG + Intergenic
1196695720 X:118609201-118609223 AAAGTTTGACAGATCAATATGGG - Intronic
1197440787 X:126486842-126486864 AAAGATGGAGAGATACATACTGG - Intergenic
1199341183 X:146679218-146679240 AAAGATGTATAGAGCCATTTGGG - Intergenic
1199500485 X:148501093-148501115 AAAGTCGAATAGATCCATAGCGG - Exonic
1200978267 Y:9236800-9236822 AAAGATGATGAAATCCATAGAGG + Intergenic