ID: 1158997578

View in Genome Browser
Species Human (GRCh38)
Location 18:62938799-62938821
Sequence GAGGGGTTTTTTAAGTTGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 134}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1158997572_1158997578 -4 Left 1158997572 18:62938780-62938802 CCCTTTATTCAGATGCCATGAGG 0: 1
1: 0
2: 3
3: 13
4: 152
Right 1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 134
1158997574_1158997578 -5 Left 1158997574 18:62938781-62938803 CCTTTATTCAGATGCCATGAGGG 0: 1
1: 0
2: 1
3: 12
4: 117
Right 1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG 0: 1
1: 0
2: 0
3: 6
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1158997578 Original CRISPR GAGGGGTTTTTTAAGTTGCT TGG Intronic
901098980 1:6704607-6704629 GCTGGGTTTTGTCAGTTGCTCGG - Intergenic
902912704 1:19612388-19612410 GAGAGGTTTTTTATGGGGCTTGG + Intronic
903646413 1:24898760-24898782 GAGTGGTTTTTGAAGTCGGTGGG + Intergenic
906615503 1:47230622-47230644 CAGCCGTTTTCTAAGTTGCTGGG - Intronic
909621399 1:77671566-77671588 GAGGGGTTTCATATCTTGCTCGG - Intronic
911854288 1:102857183-102857205 GAGAGTTTTATTAAATTGCTAGG - Intergenic
913669083 1:121078557-121078579 GAGGGGTCCATTAAGATGCTTGG - Intergenic
914020828 1:143865962-143865984 GAGGGGTCCATTAAGATGCTTGG - Intergenic
914659326 1:149773904-149773926 GAGGGGTCCATTAAGATGCTTGG - Intergenic
916240758 1:162636641-162636663 GAGGAGTTTTTTAACTTCATTGG + Intronic
916641513 1:166733464-166733486 CAGGGCTTTTTTTAGTTGGTAGG - Intergenic
918102704 1:181390387-181390409 GAGGTGTTGTTTTTGTTGCTTGG + Intergenic
918374597 1:183896547-183896569 AAGGGTTTTTTTCAGTGGCTTGG - Intronic
919393000 1:197010911-197010933 GAAGGTTTTTTTAAGTAGCCTGG + Intergenic
919555644 1:199049429-199049451 TAGGGCTTTTTTTGGTTGCTGGG - Intergenic
921287396 1:213621635-213621657 GAGGGCTTTTGTGATTTGCTAGG + Intergenic
921567937 1:216742848-216742870 GAGGGTTTTTTTAATTGTCTGGG - Intronic
922219570 1:223548195-223548217 GAGGGTTTTTCTCAGTTCCTTGG - Intronic
924938287 1:248790736-248790758 GAGGGGTCTGTTCAGTTGGTTGG + Intergenic
1065265443 10:23970720-23970742 GAGGGGTCTATTCAGTTGGTTGG - Intronic
1067395353 10:45911494-45911516 GAGGGGTTCATTCAGTTGGTTGG - Intergenic
1067458728 10:46441646-46441668 GAGGAGTTTTTCCAGGTGCTGGG + Intergenic
1067628466 10:47942990-47943012 GAGGAGTTTTTCCAGGTGCTGGG - Intergenic
1067863673 10:49880615-49880637 GAGGGGTTCATTCAGTTGGTTGG - Intronic
1075436490 10:122447706-122447728 TAGAGGTTTTTCAACTTGCTTGG - Intergenic
1080539634 11:33254048-33254070 GAGGGGTTTTTGAAGAGGCTAGG + Intergenic
1087078015 11:94143580-94143602 GAGAGGTTAAGTAAGTTGCTGGG + Intronic
1087583967 11:100094559-100094581 GAGGGGTGATTTAATTTTCTGGG + Intronic
1090327336 11:125900588-125900610 TGTGTGTTTTTTAAGTTGCTGGG + Exonic
1091090222 11:132764055-132764077 GAGATGTTCTTTAAGCTGCTGGG + Intronic
1100464212 12:94831213-94831235 GAGGGGTTTTTGAACTTGGCTGG - Intergenic
1102197771 12:111036566-111036588 GAGGGGTTTGTTCAGGTGATGGG + Intronic
1107117500 13:36762743-36762765 GAGGGGTTCATTCAGTTGGTTGG + Intergenic
1107171323 13:37345497-37345519 GAGGGGTCTTTGAAGTTTCTTGG + Intergenic
1110493983 13:76143661-76143683 GAGTGTTTCTTTAAGCTGCTGGG + Intergenic
1110887829 13:80660008-80660030 GAGGAGTTTTTCATGTTTCTTGG + Intergenic
1111602117 13:90487834-90487856 AAGGGCTATTTTAATTTGCTGGG + Intergenic
1113368732 13:109704064-109704086 GAGGGGTCTTCAAAGTGGCTGGG - Intergenic
1115871580 14:37810176-37810198 AAGGGGATTGTTAAGATGCTAGG + Intronic
1119384194 14:74246944-74246966 CAGGGCTTTGTTAAGTTGCTTGG + Intronic
1119756429 14:77123325-77123347 GAGAGGTTATATAACTTGCTAGG - Intronic
1120248586 14:82034398-82034420 GAGGGCTTTTTCAAGGTGTTTGG + Intergenic
1120611737 14:86649646-86649668 CAGGGCTTTTTTAGGTTGGTAGG - Intergenic
1125226818 15:37405154-37405176 GAGCGGTTTTTTAAGCCGGTCGG + Intergenic
1126010239 15:44295515-44295537 GAGGGGTGTATTAGTTTGCTAGG + Intronic
1127849393 15:62899802-62899824 GAGGGGTAATTTCAGGTGCTTGG - Intergenic
1128923643 15:71634337-71634359 GGATGGTTTTTTAAGTTCCTTGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131209052 15:90477603-90477625 GAAGGATCTTTTAAGTTGATGGG + Intronic
1132007158 15:98238068-98238090 CAGGGGTAGTTCAAGTTGCTGGG - Intergenic
1138089278 16:54161018-54161040 GTGTGTTGTTTTAAGTTGCTAGG + Intergenic
1138564476 16:57822964-57822986 GAGGGGTTTATTCAGATGGTTGG - Intronic
1139258945 16:65573572-65573594 GAAGGGTTTTCTTAGGTGCTTGG + Intergenic
1144169015 17:12640689-12640711 GAGGGGTATATTAGTTTGCTAGG + Intergenic
1146047060 17:29517431-29517453 GAGTTGTTTTTTATGTTGCCAGG + Exonic
1149164384 17:53733370-53733392 AAGAGGTTTTATAGGTTGCTTGG - Intergenic
1149921405 17:60663303-60663325 GAGGGGTTCTTTCAATTTCTTGG - Exonic
1150240115 17:63624031-63624053 GAAGGGTTTGTTCATTTGCTGGG + Intronic
1150839460 17:68594463-68594485 GAGTGTTGTTTTAAGTTACTAGG - Intronic
1152792762 17:82290993-82291015 GAGGGGTCTTTTCAGTAGTTGGG + Intergenic
1153182143 18:2446861-2446883 GAAGGGTTCTTTAACTTGGTTGG + Intergenic
1158997578 18:62938799-62938821 GAGGGGTTTTTTAAGTTGCTTGG + Intronic
1159138321 18:64362661-64362683 CAGGGCTTTTTTTAGTTGGTAGG - Intergenic
925505002 2:4552803-4552825 GGGGAGTTTATTAAGTTGTTTGG + Intergenic
931944574 2:67290790-67290812 GAGGCATTTTTTAATTTCCTTGG - Intergenic
934879954 2:97967906-97967928 GAGAGGTTTTTTAAGGTGGGAGG + Intronic
937449208 2:121987224-121987246 GAGAGGTTTATTATGTTGCATGG + Intergenic
940335086 2:152518317-152518339 AAGGGGTTATTTTAGATGCTTGG + Intronic
945650666 2:212555043-212555065 GAGGGGGTTATTGAGTTGGTTGG - Intergenic
1174143413 20:48433069-48433091 GAGGGGTCCATTCAGTTGCTTGG - Intergenic
1177223424 21:18222529-18222551 GAGGGGCTTTTTTTGTGGCTTGG + Intronic
1182120779 22:27785306-27785328 GAGGGGGTTTTTCCGTTGTTAGG - Intronic
949155478 3:821847-821869 GACGGGCTTTTTATGTTTCTTGG - Intergenic
951740795 3:25921140-25921162 CAGGGTATTTTTCAGTTGCTAGG - Intergenic
951787424 3:26437669-26437691 GAAGGGTTTTTTATGCTACTAGG - Intergenic
953161925 3:40428707-40428729 AATGGGTTTCTTAATTTGCTAGG - Intergenic
953669925 3:44953749-44953771 GTTGGGATTTATAAGTTGCTCGG + Intronic
954039587 3:47874769-47874791 GAGAGGATTTTTCAGTTTCTTGG + Intronic
954307171 3:49734441-49734463 GAGTGGCATTTGAAGTTGCTGGG - Intronic
954754685 3:52832745-52832767 GAGGGGTTTTTGAGGTCCCTAGG + Intronic
958893124 3:99802161-99802183 GGTGGGTTTTTTAGTTTGCTAGG + Intergenic
965191813 3:165540297-165540319 GAGTGTTTTTTTAAGCTGCTAGG + Intergenic
965959491 3:174412008-174412030 GAGGAGTTTATTCAGTTGGTTGG - Intergenic
966158787 3:176946717-176946739 GTGTGGTTTTTGAAGTTGCAGGG - Intergenic
970295552 4:14625543-14625565 GAGGGTTATTTTACTTTGCTAGG + Intergenic
971496388 4:27270357-27270379 GAGGGGTTCATTAAATTGATTGG - Intergenic
972121345 4:35708234-35708256 CAGGGCTTTTTTTGGTTGCTGGG + Intergenic
975433471 4:74322456-74322478 GAGGGGTTTTTAAAATTGGGTGG + Intergenic
977037228 4:91969910-91969932 CAGGAGTTTTTTAAATTGATAGG + Intergenic
978551182 4:109928925-109928947 GAGGGGTCTATTCAGTTGGTTGG + Intronic
978625358 4:110679393-110679415 GAGGGGTTTTTTAAATGACCTGG - Intergenic
978852109 4:113351296-113351318 GAGGGCTTTTTTAAAGTCCTAGG + Intronic
979561915 4:122110394-122110416 GCGCCGTTTTTTAAGTTGGTCGG - Intergenic
979902100 4:126234543-126234565 CATGGTTTTTTTAATTTGCTTGG + Intergenic
980586163 4:134818170-134818192 CTGGGGTTTTTTTAGTTGGTAGG - Intergenic
982435633 4:155381532-155381554 AAGGTGTTTTGTAAATTGCTTGG - Intergenic
982697769 4:158622889-158622911 GATGGGTATGTTAATTTGCTTGG + Intronic
983038417 4:162895768-162895790 CTGAGGTTTTTTAAGTTCCTTGG + Intergenic
986565415 5:9108850-9108872 GAGTGGTCTTTTAAATTGTTTGG - Intronic
986988647 5:13526694-13526716 GAGAGGTTTTCTAGGTTGTTAGG + Intergenic
990041817 5:51386053-51386075 GAGGGATTTTCTAAATTGTTTGG + Intronic
990264298 5:54059090-54059112 GAGGGTTTATATAAGTGGCTTGG - Intronic
990458165 5:56008851-56008873 GAGGTGTTTTTCATGTTGGTTGG + Intergenic
990605436 5:57405014-57405036 CAGGGGTTTTATAAGTTCCTTGG - Intergenic
990972759 5:61527310-61527332 GAGGGATAGTTTTAGTTGCTGGG + Intronic
993783122 5:92094456-92094478 CAGGGGTTTTTTACATTGTTTGG + Intergenic
993904242 5:93605010-93605032 CAGGGGGTTTTAAAGATGCTGGG + Intergenic
994211473 5:97091285-97091307 TAGGGTTTTTTAAAGTTCCTTGG + Intronic
996820549 5:127621579-127621601 AGGGGGTTTGTTCAGTTGCTTGG + Intergenic
998450634 5:142231867-142231889 GGGGGGTTCTTTAAATTCCTAGG - Intergenic
999483162 5:151967303-151967325 GAGGGGTTCATTCAGTTGATTGG + Intergenic
999618241 5:153448301-153448323 GAGGAAGTTTTTCAGTTGCTAGG - Intergenic
999821267 5:155231506-155231528 GAGGGTCTTTTTATGTTGCCAGG + Intergenic
1000754585 5:165141904-165141926 AAGTGGTTTTATAAGTTACTGGG + Intergenic
1003868247 6:10382193-10382215 GGGGCGTTTTTTAACTTCCTAGG - Intergenic
1005640555 6:27792222-27792244 GAGGCGTTTATAAAGATGCTAGG - Intergenic
1008362811 6:50641957-50641979 GAGGTATTTTTTAATTTGATGGG - Intergenic
1009511159 6:64551495-64551517 GAGGGGTCTCTTCAGTTGATTGG - Intronic
1012227187 6:96717792-96717814 GAGGGGTCTATTCAGTTGGTTGG - Intergenic
1016936666 6:149452980-149453002 GACTGCATTTTTAAGTTGCTAGG - Intronic
1018912729 6:168112233-168112255 GAGGGGTCTGTTCAGTTCCTGGG + Intergenic
1024342198 7:48277835-48277857 TTGTGGCTTTTTAAGTTGCTAGG + Intronic
1026964333 7:74429695-74429717 GAGAGGTTTTGTAATTTGATGGG + Intergenic
1027585608 7:80054872-80054894 AAGGGGTGTTTGAAGATGCTAGG + Intergenic
1029194111 7:98792454-98792476 GAAGGATTTTTTAAATTGGTAGG - Intergenic
1039265519 8:35819499-35819521 GAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1039325182 8:36477483-36477505 GTGGGTTTTTTTTATTTGCTTGG + Intergenic
1040689898 8:49924019-49924041 CAGTGGTTTTTTAATTTTCTAGG + Intronic
1044482372 8:92706600-92706622 GAGTGCTTTTTTCAGTTGCATGG - Intergenic
1047060315 8:121218466-121218488 GATGGTTTTTTTAAGTGTCTAGG - Intergenic
1058206196 9:102111386-102111408 CAGGGATTTTTTTAGTTGGTAGG + Intergenic
1062584379 9:137242287-137242309 GAGGGGTTTGTTAAGCTGTCAGG + Intronic
1187801785 X:23071802-23071824 GAGGGCTTTTTTTGGTTGGTAGG - Intergenic
1188031893 X:25273548-25273570 GAGGCGTTTTTTAAGTTACAAGG - Intergenic
1192245458 X:69367986-69368008 CAGGGGTTTTTTTGTTTGCTTGG + Intergenic
1194640085 X:96393262-96393284 AAGGAATTTTTTAAGGTGCTGGG + Intergenic
1195486954 X:105420117-105420139 GAGGGATTTTTGAAGTTCTTTGG + Intronic
1196509163 X:116485481-116485503 CAGGAGTTTTCTAAGTTGATTGG - Intergenic
1198370338 X:135983601-135983623 GAGGGGCATACTAAGTTGCTGGG + Intergenic
1200644978 Y:5771007-5771029 GAGGGTTTTTTCATGTTTCTTGG + Intergenic
1201955730 Y:19620336-19620358 CTGGGCTTTTTTAAGTTGGTAGG + Intergenic