ID: 1159001438

View in Genome Browser
Species Human (GRCh38)
Location 18:62978757-62978779
Sequence GCCTCCGATGAGCCCCCGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159001433_1159001438 12 Left 1159001433 18:62978722-62978744 CCACTTCTGAGATGAGCAGCGAG 0: 1
1: 0
2: 0
3: 4
4: 126
Right 1159001438 18:62978757-62978779 GCCTCCGATGAGCCCCCGCCCGG 0: 1
1: 0
2: 0
3: 10
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159001438 Original CRISPR GCCTCCGATGAGCCCCCGCC CGG Exonic
901033813 1:6324139-6324161 GTCTCAGATGAGCCCACCCCTGG + Intronic
901197526 1:7448408-7448430 GCCTCAGCTGAGCACCCACCTGG - Intronic
902078857 1:13807386-13807408 GCCTCCAATGCGCCCCCTCATGG + Intronic
902414462 1:16230727-16230749 CCCTCCAATGAGCCCCTGCTGGG - Intergenic
905890141 1:41513567-41513589 TCCTCAGAGGCGCCCCCGCCTGG - Exonic
909957896 1:81801622-81801644 GCCACCGCTCAGCCCCGGCCGGG + Intronic
915458188 1:156053980-156054002 GCCCCCCAGGGGCCCCCGCCTGG - Intergenic
922801621 1:228367224-228367246 GGCTCCTCTGAGCCCCGGCCTGG - Intronic
1062879577 10:967057-967079 GTCTCCGATGAGGCCTCCCCCGG + Intergenic
1068695971 10:59968588-59968610 GCCTCCTAAGAACCCTCGCCAGG + Intergenic
1072783952 10:98268116-98268138 CCATCTGGTGAGCCCCCGCCTGG - Exonic
1076405002 10:130205765-130205787 GCCTCCGACGAGGACCCCCCTGG - Intergenic
1076734731 10:132453512-132453534 CCCTCCTATGAGCCTCCTCCGGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077501668 11:2912276-2912298 GCCTTCGGTGAGCCCCCGAGGGG - Intronic
1079135890 11:17775831-17775853 GTCTCAGAGAAGCCCCCGCCTGG + Intronic
1084216370 11:67648913-67648935 GCTCCCTATGAGCCCCCTCCAGG + Intronic
1089456363 11:118628140-118628162 GCCTCCTGAGAGTCCCCGCCTGG + Exonic
1090227518 11:125080610-125080632 GCCCATGATGAACCCCCGCCTGG - Exonic
1098410795 12:70181363-70181385 ACCTCAGATGAGCCACCACCTGG - Intergenic
1103800555 12:123534289-123534311 TCCTGGGATGAGCCCCAGCCCGG - Intergenic
1104864529 12:131944968-131944990 TCCTCCGCTGAGCCCCTCCCTGG - Exonic
1111976023 13:94968017-94968039 GCCTCCGAGGGGTCCCGGCCAGG + Intergenic
1111979685 13:95003091-95003113 CCCTCCTGTGATCCCCCGCCAGG + Intergenic
1113601609 13:111573362-111573384 GCCGCAGATGAGCCCCAGCCGGG + Intergenic
1113635653 13:111917245-111917267 GCCTCCGATGACGGCCCGTCAGG - Intergenic
1121089362 14:91170523-91170545 GGCTCCGGTGAGCCTCAGCCAGG + Intronic
1121788688 14:96682419-96682441 GCCTCCTGTGAGCCTCAGCCAGG + Intergenic
1129739880 15:77985080-77985102 GCCACCCATGTGCCCCCGCCAGG + Intronic
1131248051 15:90813053-90813075 TCCTCCGATAAGCCCTCCCCAGG - Intronic
1132607075 16:798119-798141 CCATCCTATGAGCCCACGCCCGG - Exonic
1132804904 16:1770943-1770965 GGCTCCGATGAGCGCCCGCGAGG + Exonic
1135776128 16:25258367-25258389 GCCCCAGATGAGACCGCGCCGGG - Intergenic
1136040354 16:27573968-27573990 GCCTCCCATCAGCCCTCGCCAGG - Intronic
1141599938 16:85119498-85119520 GCCTCCGCCCAGCCCCTGCCAGG - Intergenic
1141663468 16:85453849-85453871 GCCTCAGCTGAGCCCCCACCAGG - Intergenic
1142210804 16:88807652-88807674 GCCACCCCTGAGCCTCCGCCCGG + Intronic
1142614217 17:1125493-1125515 GCCCCCGCACAGCCCCCGCCCGG - Intronic
1144971264 17:19111197-19111219 GCCTCCGGCGCGCCCCCTCCCGG + Intergenic
1147583094 17:41637901-41637923 GGCTCCTACGAGCCCCCGCAAGG + Intergenic
1147684028 17:42276350-42276372 GCCTGCGCTGGGTCCCCGCCCGG + Exonic
1148114764 17:45169177-45169199 GCCTCCGCTGAGCAGCCCCCTGG - Exonic
1151307605 17:73273198-73273220 GAGTCTGATGAGCCCCCGACCGG - Intergenic
1152537158 17:80957462-80957484 GCCTCATATGAGCTCCCGCTAGG - Intronic
1152920451 17:83064019-83064041 GCTCCCGCTGAGCCCCAGCCAGG - Intergenic
1152926176 17:83088776-83088798 CCTGCCGATGAGCCCCCTCCAGG + Intronic
1153498189 18:5721614-5721636 GCCTCTGCTGACCCCCAGCCTGG + Intergenic
1159001438 18:62978757-62978779 GCCTCCGATGAGCCCCCGCCCGG + Exonic
1160579650 18:79876293-79876315 GTCTCCGAAGGGCCCCAGCCAGG + Intronic
1160996310 19:1883672-1883694 GTCTCCCATCAGCCACCGCCCGG + Intronic
1161251386 19:3282261-3282283 GCCTCTGGTGAGCCTCCTCCAGG + Exonic
1162028134 19:7905594-7905616 GCCCCCGAGGAGTCCCCTCCAGG + Intronic
1163027156 19:14518843-14518865 GCCTGCGGTGGGCTCCCGCCCGG + Intronic
1165058664 19:33194525-33194547 GCCGCCGCTGAGCCCCCGCAGGG + Intronic
1166690499 19:44819316-44819338 GGCTCCGATCAGGCCCCGGCTGG - Intronic
1166734606 19:45076534-45076556 CCCTCCCATGAGCCCCGCCCTGG - Exonic
1167125343 19:47545141-47545163 CCCTCGGAGGAGTCCCCGCCCGG - Exonic
1167379218 19:49128932-49128954 ACCTCCGAGGAGACCCCACCCGG - Exonic
1167964486 19:53132368-53132390 GCCTCCCCTGAGCCCGCGCTGGG - Intronic
1168063340 19:53906436-53906458 GCCTCCTTTCAGACCCCGCCCGG + Exonic
925208508 2:2027009-2027031 CGATCCGATGTGCCCCCGCCTGG - Intronic
925814672 2:7735967-7735989 GCCTAGGATGAGCCACAGCCTGG - Intergenic
927465621 2:23334277-23334299 ACTTCCGATGACCCCCCGCCTGG - Intergenic
932090249 2:68799891-68799913 GCCTCCGATGAGCCAGCCTCAGG - Intronic
936344586 2:111665662-111665684 GCCTCCCAGGAGAGCCCGCCTGG + Intergenic
1172617722 20:36300217-36300239 GGCTCAGATGTGCCCCAGCCTGG + Intergenic
1173836400 20:46128812-46128834 GCCTCTGAGGAGCCCCTCCCTGG - Intronic
1174353244 20:49982769-49982791 GCCTCGGAGGAGTCCCCGCCCGG + Intergenic
1174588721 20:51628335-51628357 GCCTCTGATGTGGCCCCTCCTGG + Intronic
1175887651 20:62301945-62301967 GCCCTCTAAGAGCCCCCGCCTGG + Intergenic
1179339020 21:40486876-40486898 GCCTCCGCTGAGCTCCTGCTTGG + Intronic
1180087047 21:45512387-45512409 GCCTCCAAGTAGCCACCGCCTGG + Exonic
1181349211 22:22243457-22243479 GGCTCAGATGAGCCCCTGCTCGG - Intergenic
1182826018 22:33265516-33265538 GCCTTCCATGATCCCCGGCCTGG + Intronic
1183736632 22:39648243-39648265 GCCTCCTCCGAGCCCACGCCTGG - Intronic
1184265458 22:43343598-43343620 GCCTCCAAGCAGCCCCAGCCTGG - Intergenic
1184549549 22:45197142-45197164 GCCTGCGCAGAGCCCCGGCCGGG - Exonic
1185105361 22:48866320-48866342 GCCTCCGCTGCTCCCCAGCCTGG + Intergenic
1185281642 22:49972309-49972331 GCCTCCCCTGCGCCCCAGCCTGG + Intergenic
952706256 3:36380649-36380671 CCCTCCGAGCAGCCCCCGCGAGG + Exonic
961676711 3:128572075-128572097 TCCTCCGAGGAGTCCCCTCCGGG + Exonic
961823468 3:129586897-129586919 GCCTCTGCTGTGCCCCCACCAGG + Intronic
971376053 4:26056580-26056602 CTCTCAGATGAGCCCCAGCCAGG - Intergenic
992611208 5:78510047-78510069 GGCTCCGGGGAGCCCCCGCCCGG + Exonic
997990805 5:138543134-138543156 GCCGCCGCGGAGCCGCCGCCGGG - Exonic
1000662022 5:163949226-163949248 GTCTCCGTTGATCCCCTGCCTGG - Intergenic
1001526601 5:172433580-172433602 GCCACCAAGGAGCCCCTGCCGGG + Intronic
1002470196 5:179430430-179430452 GCCTTGGATGAGCTCCTGCCTGG - Intergenic
1003963292 6:11229356-11229378 GGGGCCGCTGAGCCCCCGCCCGG + Intronic
1005327913 6:24720410-24720432 GCCGCCGCTCAGCCCCCACCTGG + Exonic
1006338138 6:33431642-33431664 GCCTCCCATGACCCCCTCCCTGG - Intronic
1006725519 6:36196830-36196852 GCCTCCGCCGTGCCCCCTCCCGG - Exonic
1016820587 6:148342899-148342921 GCCTGCGAAGGGCCCCCGCGGGG + Exonic
1019607509 7:1917488-1917510 GCTTCCCCTGAGCCCCGGCCAGG - Intronic
1020756682 7:12211588-12211610 GCCTCTAATGAGGCCCAGCCAGG + Intronic
1021600003 7:22356042-22356064 GCCACCTAGGAGGCCCCGCCAGG - Intronic
1022723074 7:32957812-32957834 GCATCCGCTGAGGCCGCGCCGGG - Intronic
1033755899 7:144398341-144398363 CCCTGCGATGTGCCCCCGCTGGG + Exonic
1034447213 7:151119874-151119896 GCTGCCCATGAGCCCCGGCCAGG + Intronic
1049509732 8:143021485-143021507 GCCTCTGCTGAGCCCCGGCCCGG - Intronic
1051713003 9:19951084-19951106 GCCTTTGATGAGTTCCCGCCAGG + Intergenic
1060481520 9:124018972-124018994 CCCTCCACCGAGCCCCCGCCTGG - Intronic
1061534346 9:131238496-131238518 GCCTCTGCCCAGCCCCCGCCGGG - Intergenic
1062596428 9:137301954-137301976 GCCCGCGCTGAGCCCCGGCCCGG - Exonic
1062629102 9:137455694-137455716 GCCTCCCCTCAGCCCCCACCCGG + Intronic
1190225208 X:48539831-48539853 GGCTCCGGAGCGCCCCCGCCCGG + Exonic