ID: 1159001976

View in Genome Browser
Species Human (GRCh38)
Location 18:62982499-62982521
Sequence CAGGGTAAGTATTAGGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159001969_1159001976 -3 Left 1159001969 18:62982479-62982501 CCCTGAAGCCACAGTGTCTGCAG No data
Right 1159001976 18:62982499-62982521 CAGGGTAAGTATTAGGGAGAAGG No data
1159001970_1159001976 -4 Left 1159001970 18:62982480-62982502 CCTGAAGCCACAGTGTCTGCAGG No data
Right 1159001976 18:62982499-62982521 CAGGGTAAGTATTAGGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159001976 Original CRISPR CAGGGTAAGTATTAGGGAGA AGG Intergenic
No off target data available for this crispr