ID: 1159001983

View in Genome Browser
Species Human (GRCh38)
Location 18:62982543-62982565
Sequence CTGGATTTCCAGCAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159001983_1159001990 0 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001990 18:62982566-62982588 ATAATTGGGAAAGGGCTTTGAGG No data
1159001983_1159001992 2 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001992 18:62982568-62982590 AATTGGGAAAGGGCTTTGAGGGG No data
1159001983_1159001993 11 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001993 18:62982577-62982599 AGGGCTTTGAGGGGAGAGAAAGG No data
1159001983_1159001991 1 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001991 18:62982567-62982589 TAATTGGGAAAGGGCTTTGAGGG No data
1159001983_1159001994 25 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001994 18:62982591-62982613 AGAGAAAGGAAGAAATGAAACGG No data
1159001983_1159001988 -8 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001988 18:62982558-62982580 AAATCCAGATAATTGGGAAAGGG No data
1159001983_1159001995 26 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001995 18:62982592-62982614 GAGAAAGGAAGAAATGAAACGGG No data
1159001983_1159001987 -9 Left 1159001983 18:62982543-62982565 CCTGCTTCCTGCTGGAAATCCAG No data
Right 1159001987 18:62982557-62982579 GAAATCCAGATAATTGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159001983 Original CRISPR CTGGATTTCCAGCAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr