ID: 1159005171

View in Genome Browser
Species Human (GRCh38)
Location 18:63004663-63004685
Sequence GTGGAGACCCAGAGCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159005164_1159005171 21 Left 1159005164 18:63004619-63004641 CCAAGTTACCTGAGTGAGGGAAA No data
Right 1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG No data
1159005166_1159005171 13 Left 1159005166 18:63004627-63004649 CCTGAGTGAGGGAAAGGTACGCA No data
Right 1159005171 18:63004663-63004685 GTGGAGACCCAGAGCCAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159005171 Original CRISPR GTGGAGACCCAGAGCCAGGA GGG Intergenic
No off target data available for this crispr