ID: 1159005437

View in Genome Browser
Species Human (GRCh38)
Location 18:63006114-63006136
Sequence CATCATGCAGAGATGGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159005437_1159005445 29 Left 1159005437 18:63006114-63006136 CCTTGTACCATCTCTGCATGATG No data
Right 1159005445 18:63006166-63006188 TCCTTAGAATGAGAGACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159005437 Original CRISPR CATCATGCAGAGATGGTACA AGG (reversed) Intergenic
No off target data available for this crispr