ID: 1159011743

View in Genome Browser
Species Human (GRCh38)
Location 18:63064517-63064539
Sequence AAAAACATTCTGTAATTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159011742_1159011743 -5 Left 1159011742 18:63064499-63064521 CCTCAGGCATTATTTAACAAAAA No data
Right 1159011743 18:63064517-63064539 AAAAACATTCTGTAATTTAGTGG No data
1159011739_1159011743 15 Left 1159011739 18:63064479-63064501 CCATGTCAGATCAGATCATCCCT No data
Right 1159011743 18:63064517-63064539 AAAAACATTCTGTAATTTAGTGG No data
1159011741_1159011743 -4 Left 1159011741 18:63064498-63064520 CCCTCAGGCATTATTTAACAAAA No data
Right 1159011743 18:63064517-63064539 AAAAACATTCTGTAATTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159011743 Original CRISPR AAAAACATTCTGTAATTTAG TGG Intergenic
No off target data available for this crispr