ID: 1159015772

View in Genome Browser
Species Human (GRCh38)
Location 18:63100727-63100749
Sequence GTTTGGGGATGCAGCTGTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159015772_1159015777 3 Left 1159015772 18:63100727-63100749 CCCTGACAGCTGCATCCCCAAAC No data
Right 1159015777 18:63100753-63100775 CACCAAACAGCTTGCCAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159015772 Original CRISPR GTTTGGGGATGCAGCTGTCA GGG (reversed) Intergenic
No off target data available for this crispr