ID: 1159017361

View in Genome Browser
Species Human (GRCh38)
Location 18:63112209-63112231
Sequence CTGAATATACAAATGGGCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159017355_1159017361 27 Left 1159017355 18:63112159-63112181 CCTTTCTAGGTTCCTGTCATCCT No data
Right 1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG No data
1159017357_1159017361 15 Left 1159017357 18:63112171-63112193 CCTGTCATCCTCACTGGCTTTGT No data
Right 1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG No data
1159017358_1159017361 7 Left 1159017358 18:63112179-63112201 CCTCACTGGCTTTGTTTTGCAGC No data
Right 1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159017361 Original CRISPR CTGAATATACAAATGGGCAA TGG Intergenic
No off target data available for this crispr