ID: 1159019637

View in Genome Browser
Species Human (GRCh38)
Location 18:63132827-63132849
Sequence ATGTATTAAAAGCAACAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 521
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159019637 Original CRISPR ATGTATTAAAAGCAACAAAG AGG Intronic
903096274 1:20977854-20977876 TAGTATTAAAAGCAATAAAGAGG + Intronic
904219080 1:28949902-28949924 ATGTCTTAAAAATAACAGAGTGG - Intronic
904396036 1:30223160-30223182 ACGTATTAACAGAAACAAAAGGG - Intergenic
904994261 1:34618652-34618674 ATTAATTAAAAGCAATCAAGTGG - Intergenic
907694244 1:56705699-56705721 ATGGAGTAGAAGGAACAAAGAGG - Intronic
907702980 1:56807260-56807282 GTGGAGTAAAAGCAATAAAGTGG - Intronic
909017347 1:70394154-70394176 ATGTATTAAAAGGATCACTGGGG + Intergenic
909345032 1:74574723-74574745 ATGTTTTTAATGGAACAAAGTGG + Intronic
909499983 1:76323560-76323582 ATGTAGTAAATTCAACAAATGGG - Intronic
909533988 1:76713185-76713207 ATGTATTAAAAGGTACACAGTGG - Intergenic
910333961 1:86107041-86107063 ATTTAGTAATAGTAACAAAGTGG - Intronic
910424256 1:87102749-87102771 AACTATTAAAAAAAACAAAGAGG - Intronic
910440900 1:87250755-87250777 ATTTAAGAAAAGCAACAAGGGGG + Intergenic
911382512 1:97133430-97133452 AATTTTTAAAAGCAACAAAAAGG - Intronic
911436402 1:97864764-97864786 ATTTATTAATAGTAACAAAGAGG + Intronic
911953037 1:104200652-104200674 ATATATTAAAATTATCAAAGGGG + Intergenic
912407583 1:109453327-109453349 ATGTATCAAATGAAACAAGGGGG + Intergenic
912718204 1:111997379-111997401 ATGCATTATAAGCAACAAGGTGG + Intergenic
912728580 1:112080962-112080984 ATGTATTAACAGGGAAAAAGGGG + Intergenic
914968174 1:152279932-152279954 AGCAGTTAAAAGCAACAAAGAGG + Intergenic
915809884 1:158896967-158896989 ATGTTTAAGAAGCAAAAAAGGGG - Intergenic
916062093 1:161106451-161106473 ATGTTTTAAAAGGAAAAATGTGG - Intronic
917027930 1:170662618-170662640 ATGTAATAAAAATAACAAAAGGG - Intergenic
917351807 1:174085826-174085848 AGGTATTAAAAGCAAAACAAAGG - Intergenic
917672934 1:177290699-177290721 AAGTATAAACAGCAACAAAAAGG - Intergenic
918259588 1:182783458-182783480 TTGTATGAAAAGGAAAAAAGAGG - Intergenic
918336927 1:183525266-183525288 ATGTTTTAAGTGCAGCAAAGAGG + Intronic
918879780 1:190102384-190102406 AAGCATAAAAAGAAACAAAGTGG - Intronic
919004043 1:191871805-191871827 ATGTATTAGAAGCAGAAAGGAGG - Intergenic
919495783 1:198266347-198266369 ATTTTTTAAAAGCTACAAATTGG - Intronic
919714120 1:200757218-200757240 ATTTATTAAAAGCAATAAAGGGG - Intronic
919722750 1:200856812-200856834 TAGTATTAAAAGCCACAGAGTGG - Intronic
920091655 1:203457476-203457498 AAGAATGAAAAGCAATAAAGTGG - Intergenic
921139487 1:212292861-212292883 ATATATTAAAACCAAAAAACTGG - Intronic
921674629 1:217964603-217964625 ATGCATTAAAAGAAACAGAAAGG + Intergenic
922381817 1:225036979-225037001 AAGTATAAAAAGAGACAAAGAGG - Intronic
922457106 1:225783874-225783896 CTGTATCAAAAGCAGCAAGGAGG - Intronic
923909946 1:238430479-238430501 AGCAGTTAAAAGCAACAAAGAGG - Intergenic
924833282 1:247620951-247620973 ATGGATTAAAAACAACCAAATGG + Intergenic
1063055763 10:2502469-2502491 ATGTATTAAAAGAAAAACAGTGG + Intergenic
1063333218 10:5183434-5183456 ATGTATTAAAATGAAATAAGGGG - Intergenic
1063399113 10:5724512-5724534 ATGTATTAAAAACAAGCAATTGG + Exonic
1063501172 10:6556128-6556150 ATGCTTTAAAAGCAACAAATAGG + Intronic
1065216543 10:23454668-23454690 AGATTTTAAAAGCAAAAAAGGGG - Intergenic
1065331011 10:24599601-24599623 ATTTATTATAACCAAAAAAGGGG - Intronic
1065692542 10:28350277-28350299 ATGTATTAAAATCACCAAGTAGG - Intergenic
1066287104 10:33979039-33979061 ATGTATTTGGAGCAAGAAAGGGG - Intergenic
1066315389 10:34241109-34241131 ATGTATAAAAAGCATTCAAGAGG + Intronic
1067795254 10:49316606-49316628 ATGTATTAAAAGAAAAATGGAGG + Intronic
1068313796 10:55315314-55315336 ATGTATAAAATGCAACAACACGG + Intronic
1069453062 10:68532669-68532691 GTTTATGAAAAACAACAAAGAGG - Intergenic
1070244609 10:74719447-74719469 ATGTATAGAAACCAACAAAAAGG - Intergenic
1070253400 10:74793074-74793096 ATGTATTAAAAATAGCAAAATGG + Intergenic
1070446246 10:76506491-76506513 ATGTATGAAAAGAAAATAAGGGG - Intronic
1070495015 10:77013592-77013614 ATGTGTTAAGAGCAACAAAGGGG - Intronic
1071191587 10:83108079-83108101 ATGTAATAAAAGAAATACAGGGG + Intergenic
1071315778 10:84395687-84395709 ATGTACTAAAAGGTAGAAAGAGG - Intronic
1072257929 10:93638557-93638579 ATGTTGTAGAAGCAATAAAGTGG + Intronic
1073826448 10:107328798-107328820 ATGTGTTAAAAGCCAAAAACAGG - Intergenic
1073937772 10:108654706-108654728 ATGTATTAAACACATTAAAGAGG - Intergenic
1073939685 10:108681747-108681769 ATGTGATAAAAGCTCCAAAGAGG - Intergenic
1074025046 10:109625708-109625730 AGGTAAGAAAAGCAAGAAAGGGG - Intergenic
1074483065 10:113845178-113845200 TTATATTAAAAGAAAAAAAGAGG + Intronic
1076434589 10:130431385-130431407 TTGAATTAAAAGAAAGAAAGAGG - Intergenic
1078375666 11:10791301-10791323 ATTTATTAAAAAAAAAAAAGAGG - Intergenic
1079086185 11:17446805-17446827 AAATATTAAAAGAAAAAAAGGGG - Intronic
1079554635 11:21743796-21743818 AGGTTTTAAAGGCAAAAAAGAGG + Intergenic
1080068215 11:28045101-28045123 GTGTAATAAAAGCAATAAATTGG + Intronic
1080189535 11:29527327-29527349 ATTTATAAGAAGCATCAAAGGGG + Intergenic
1080269614 11:30437242-30437264 ATGTATTAAAACAAACACAAGGG - Intronic
1081232385 11:40601517-40601539 CTGTATTAAAGGAAAAAAAGTGG + Intronic
1081842262 11:46211247-46211269 ATGTATTAACTGCAAAAATGTGG + Intergenic
1081890622 11:46539231-46539253 AAATATTAAAAGAAAAAAAGTGG + Intronic
1083019806 11:59495492-59495514 ATGTTTAAAAAGCAAAACAGTGG + Intergenic
1083120369 11:60506441-60506463 TTGTATTAAAAAAAACAACGAGG + Intronic
1085613709 11:77977504-77977526 ATGTATTTAAAGAAAAAAAATGG + Intronic
1085920930 11:80956287-80956309 TTTTATTAGAAGCAACAAAATGG - Intergenic
1086058378 11:82675026-82675048 ATGTCTTCAAAGCAAGTAAGTGG + Intergenic
1086194199 11:84117388-84117410 ATGAATGAAAAGGAACTAAGTGG + Intronic
1086581657 11:88406905-88406927 ATGTATTTTAGGCTACAAAGTGG + Intergenic
1086661381 11:89423157-89423179 GTGTATTAAAAGCATTAAAAAGG - Intronic
1086822490 11:91451322-91451344 ATGTAAGAAAAGCATAAAAGAGG - Intergenic
1086891452 11:92263033-92263055 ATTTATTAGAATCAACAATGTGG - Intergenic
1087000386 11:93413540-93413562 ATGTAATAAAATCATCAAAGAGG - Intronic
1087166613 11:95011683-95011705 ATGTATTTATAGGATCAAAGTGG - Intergenic
1087358754 11:97130177-97130199 AAGTATTAAAAGAAACATTGGGG - Intergenic
1087434958 11:98103229-98103251 AAGTATTAAAACCACCAAATAGG - Intergenic
1087712331 11:101567814-101567836 TAGTATTAAAATCAACAAAAAGG + Intronic
1087827869 11:102786827-102786849 GAGTTTTAAAAGCAACAAGGAGG - Intergenic
1088597306 11:111450063-111450085 ATGAAATAAAATCAACAAAGGGG - Intronic
1089054398 11:115573782-115573804 ATGTTTTATAAGTAATAAAGTGG + Intergenic
1089829987 11:121318801-121318823 ATGTCTGAGAAGGAACAAAGGGG + Intergenic
1091912262 12:4242136-4242158 ATGAATTAAAAGAAAAAAAAAGG + Intergenic
1092563097 12:9637158-9637180 ATGTATCAAAACCAAACAAGGGG + Intergenic
1093184978 12:16009425-16009447 ATGTATTAAATACAAAAAATTGG + Intronic
1093470282 12:19494079-19494101 TTCTATTAAAAGTAACAAACAGG + Intronic
1094105806 12:26810378-26810400 ATGTAAAAAAAGCCATAAAGTGG + Intronic
1094272145 12:28628844-28628866 ATGAATTATAAGAAACAAAATGG - Intergenic
1095367910 12:41430167-41430189 GTGCATTAAAAGAAACAAATAGG + Intronic
1097180363 12:57168331-57168353 ATGAAGAAAAAGCAACAGAGAGG + Intronic
1097713718 12:62942820-62942842 GTATTTTAAAAGTAACAAAGTGG + Intergenic
1098089653 12:66887754-66887776 ATATACTAAAAGAAACAGAGAGG + Intergenic
1098695888 12:73554518-73554540 TTGAATTAAAAGTTACAAAGTGG - Intergenic
1099697651 12:86042268-86042290 CTGAATTAAAAGGCACAAAGTGG - Intronic
1100121558 12:91374762-91374784 ATGCATCAAAAGCAACAAGAGGG - Intergenic
1100240368 12:92705066-92705088 ACAGATTAAAAGAAACAAAGAGG + Intronic
1100851067 12:98712110-98712132 ATGTATTTGAACCACCAAAGTGG + Intronic
1104297451 12:127529926-127529948 ATTTATTAAAAAAAAAAAAGAGG + Intergenic
1104689819 12:130817263-130817285 CAGTATTAAAAGGAACCAAGTGG + Intronic
1106416141 13:29547678-29547700 TTGTAATGAAACCAACAAAGAGG + Intronic
1109772283 13:66992489-66992511 ATGAATTAAAGTCACCAAAGAGG - Intronic
1110029203 13:70584668-70584690 ATTTAATAAAAAGAACAAAGTGG + Intergenic
1110539009 13:76686683-76686705 ATTTTTTAAAACCAACAAACAGG - Intergenic
1110590920 13:77257847-77257869 ATTTAGTAAAAACAACAAAAAGG + Intronic
1110914290 13:81002183-81002205 ATTTATTAAAAACAAAATAGAGG + Intergenic
1111161610 13:84402017-84402039 AGGTATTAAAAGCAAGTAAATGG + Intergenic
1111205499 13:85003847-85003869 AAGTATAAAATGCAACAAAATGG - Intergenic
1111896176 13:94144386-94144408 GTGTTTTAAAAGCACCTAAGAGG - Intronic
1112158482 13:96843713-96843735 ATGTATTAAATGATACAAAAAGG - Intergenic
1112742465 13:102490569-102490591 AGGTATGAAAATCAAAAAAGAGG + Intergenic
1112850038 13:103694770-103694792 ATGTGTAAATAGCAAGAAAGGGG - Intergenic
1113390039 13:109887239-109887261 ATGTACTCAAAGCATCTAAGAGG - Intergenic
1113477650 13:110596238-110596260 ATATTTTAAAAGCTACAAACTGG + Intergenic
1114505571 14:23209840-23209862 ATGTTTTAAAAGAATCACAGAGG - Intronic
1115010042 14:28535347-28535369 AAGGATTAAAAGGGACAAAGAGG - Intergenic
1115028740 14:28769305-28769327 AAGTATTAAAACAAACAAAAAGG + Exonic
1115065059 14:29249353-29249375 ATGTAGCAAAAGCAGCATAGAGG - Intergenic
1117206008 14:53444242-53444264 ATGTATTAAAACTTAGAAAGTGG - Intergenic
1117494447 14:56288898-56288920 ATGTATTTACGGCAACGAAGAGG + Intronic
1118309081 14:64679533-64679555 TTGTTTTTAAAGAAACAAAGTGG - Intergenic
1118337807 14:64868902-64868924 ATTTATTAAAAGCTAATAAGGGG + Intronic
1118535457 14:66758572-66758594 ATGTATCAAAATGAAAAAAGGGG + Intronic
1119965834 14:78914631-78914653 ATGTTTGAGAAACAACAAAGAGG + Intronic
1120167491 14:81217303-81217325 ATTTTTTAAAAACTACAAAGTGG + Intronic
1120405154 14:84084931-84084953 ATTTATTAAAAAAAAAAAAGAGG + Intergenic
1120566168 14:86060308-86060330 ATGTAGTTAAAGCCCCAAAGTGG - Intergenic
1120583671 14:86285322-86285344 ATGAATTCAATGCAACAGAGTGG - Intergenic
1120828813 14:88979888-88979910 ATCTATTTAAAGCATCAAAGTGG - Intergenic
1120917303 14:89721308-89721330 AGGTAATAGAAGAAACAAAGGGG - Intergenic
1123470164 15:20544898-20544920 AAGTGTGAAAAGCAACAAACCGG + Intergenic
1123647889 15:22455803-22455825 AAGTGTGAAAAGCAACAAACTGG - Intergenic
1123730463 15:23139879-23139901 AAGTGTGAAAAGCAACAAACCGG + Intergenic
1123748601 15:23337297-23337319 AAGTGTGAAAAGCAACAAACCGG + Intergenic
1124128557 15:26963629-26963651 CTCTATTAAAAGGAACCAAGGGG + Intergenic
1124301727 15:28550439-28550461 AAGTGTGAAAAGCAACAAACCGG - Intergenic
1124865399 15:33485822-33485844 AAGTATGATAAACAACAAAGGGG + Intronic
1125064058 15:35460742-35460764 AAGTATTCTAAGCAACAAATGGG - Intronic
1125099718 15:35897951-35897973 ATGTCTGAGAAGCAACAGAGTGG - Intergenic
1125168578 15:36740199-36740221 AGGTATTAGATGCAAAAAAGAGG - Intronic
1125497947 15:40215167-40215189 AGGAATTAAAAGCCAGAAAGGGG + Intronic
1126936986 15:53721722-53721744 TTGTATTAAAAACAAAAGAGAGG + Intronic
1127056016 15:55132704-55132726 GAGTACTAAAAGAAACAAAGAGG - Intergenic
1127955584 15:63849946-63849968 ATCTATTAAAAGGACCAAAAAGG + Intergenic
1129496047 15:75981825-75981847 ATGTTTTAAAATCAGAAAAGAGG + Intronic
1129619181 15:77128244-77128266 TTGAATTAAAAGGGACAAAGTGG + Intronic
1131503275 15:92991547-92991569 ATATAATAAAAGCAAAAAAGAGG - Intronic
1131766963 15:95687911-95687933 ATGTAACAAAAACAAGAAAGCGG + Intergenic
1133196672 16:4175780-4175802 ATGAATTAAAAGGGTCAAAGAGG - Intergenic
1133692231 16:8227844-8227866 ATGAAATAAAAGCATAAAAGGGG + Intergenic
1133866239 16:9646200-9646222 ATTTAATAAAAGCAACTGAGTGG - Intergenic
1134666270 16:16021236-16021258 AAGTATTACCAGCAAGAAAGAGG + Intronic
1135228388 16:20681695-20681717 TGTTATAAAAAGCAACAAAGGGG + Intronic
1135396650 16:22136720-22136742 ATATTTTAAAAGCACCAAAAGGG - Intronic
1135816358 16:25637791-25637813 ATGTAATAAAAGCAATATGGTGG - Intergenic
1135936518 16:26785212-26785234 ATTTATTAATAGGGACAAAGTGG - Intergenic
1137024874 16:35463282-35463304 ATGTAAGAAAAACAATAAAGAGG - Intergenic
1137932122 16:52598905-52598927 ACCTATTAAAAACAACAGAGTGG + Intergenic
1139694547 16:68664601-68664623 ATGTATAGAAAGGAACAAACTGG + Intronic
1139774154 16:69303632-69303654 ATGTAAGAAAAGCAGCAAAAGGG - Exonic
1141217386 16:82037662-82037684 AAATATCAAAAGCAACAAAAAGG + Intronic
1143481190 17:7228119-7228141 ATGGATTAAGAGACACAAAGAGG + Intronic
1143590597 17:7884399-7884421 ATATATTTAAAGCAACGGAGAGG + Intronic
1145982445 17:29020998-29021020 ATGTAGACAAGGCAACAAAGGGG - Intronic
1146971538 17:37076641-37076663 ATATATTAAAAACAACACTGGGG - Intergenic
1147128243 17:38388077-38388099 ATGAATTAAAAGCCATTAAGTGG - Intronic
1147151253 17:38515794-38515816 CTGTATTAAAAAAAAGAAAGAGG + Intergenic
1149375614 17:56041154-56041176 ATCTATTCAAAGGAATAAAGTGG + Intergenic
1149917484 17:60624429-60624451 ATTTAATAAAAGCAAAAAAGAGG - Intronic
1150244862 17:63666820-63666842 ATGTATTAAAAGCATGAAGGTGG + Intronic
1150627591 17:66851542-66851564 ATGTGTTTAAAACAACAAGGAGG + Intronic
1150660698 17:67074296-67074318 ATGTATTGAAAGATACAAATTGG - Exonic
1151198349 17:72448116-72448138 ATCTATTTATAGCAAGAAAGAGG - Intergenic
1152813840 17:82395330-82395352 ATGGATTAAAATCCACCAAGGGG - Intronic
1153084314 18:1266194-1266216 TTGTATCACAAGCAACAAAGAGG + Intergenic
1153182919 18:2456169-2456191 ATTTTTTAAAAGGAAAAAAGGGG + Intergenic
1154039963 18:10845084-10845106 ATGTATTAAGAACTATAAAGAGG - Intronic
1154108326 18:11544681-11544703 CTTTATAAAAAGCACCAAAGGGG - Intergenic
1154301979 18:13202368-13202390 ATGTAATAAAAGCACAAAATGGG + Intergenic
1155104819 18:22653033-22653055 ATGTACTAAAAGAAAAAAAAAGG - Intergenic
1155288492 18:24316550-24316572 ATGTATTACAAGAGATAAAGAGG + Intronic
1155461342 18:26088030-26088052 ATATATTAAAAGGACCCAAGGGG - Intronic
1155868438 18:30995663-30995685 ATGTTTTAAAAGCTTCATAGAGG + Intronic
1156240773 18:35251794-35251816 ATTTATTAAAAAAAAAAAAGAGG - Exonic
1157094208 18:44672523-44672545 ATGTATGAAAAGCACCTATGTGG - Intergenic
1158269811 18:55700592-55700614 ACCTATTAAAAGTAACAAACTGG - Intergenic
1158284679 18:55866648-55866670 AGGTATTAAAATCACAAAAGTGG + Intergenic
1158494935 18:57946509-57946531 ATGAATAAAAGGCAAAAAAGAGG - Intergenic
1159019637 18:63132827-63132849 ATGTATTAAAAGCAACAAAGAGG + Intronic
1159074781 18:63668058-63668080 ATGCATTTAAAACAACAGAGAGG + Intronic
1160713971 19:566848-566870 ATTTATAAAAAGCATCAAGGAGG - Intergenic
1164033313 19:21431195-21431217 GTTTATAAAAAGCATCAAAGGGG - Intronic
1164106450 19:22110514-22110536 ATGTATTAAAATGAAACAAGAGG + Intergenic
1164285970 19:23818072-23818094 ATTTATAAAAAGCGTCAAAGGGG - Intronic
1164499004 19:28796661-28796683 ATGCATTAACACCACCAAAGAGG + Intergenic
1164554899 19:29243917-29243939 TTTTTTTAAATGCAACAAAGAGG + Intergenic
1164568056 19:29343691-29343713 ATATATTCAAAGCAATAAAAGGG + Intergenic
1164991283 19:32686089-32686111 ATATATTAATATTAACAAAGTGG + Intergenic
1165077511 19:33288381-33288403 ATGTATTAAAAGGAAGGAAGGGG + Intergenic
1165181360 19:33974040-33974062 ATGTATTCACAGCAAAAATGTGG + Intergenic
925598244 2:5579756-5579778 ATATATTAAAAGTAACAAAATGG + Intergenic
927416862 2:22889048-22889070 ATGTATTATAAGTAACCTAGAGG - Intergenic
928201995 2:29253427-29253449 ACATATTAAAAGAAGCAAAGGGG + Intronic
928514928 2:32036369-32036391 AAGTATTAAAAGAAAAAAACTGG + Intronic
928647181 2:33366957-33366979 AAGTATTAAAATAATCAAAGAGG + Intronic
928785809 2:34884837-34884859 AGTCATTAAAAACAACAAAGAGG - Intergenic
929704439 2:44195516-44195538 ATGTATTAAAACTACCAAACAGG + Intronic
929727505 2:44445774-44445796 ATGTATTAAAATGAAACAAGAGG - Intronic
929733821 2:44524245-44524267 ATGTTTTAAAACCACCACAGGGG + Intronic
929746419 2:44664130-44664152 GTTTATTAAAAGCAGCAGAGTGG + Intronic
930073604 2:47389152-47389174 AGGTAATAAAGGCAAGAAAGTGG - Intergenic
930444648 2:51454768-51454790 ATGTTTTGAAAAGAACAAAGAGG - Intergenic
931798969 2:65740305-65740327 AGGTATTAAAAGAAACAGAGAGG - Intergenic
931932429 2:67154542-67154564 ATGTATTAAAAATCTCAAAGTGG + Intergenic
932212207 2:69941618-69941640 CTTTTTCAAAAGCAACAAAGGGG + Exonic
932263368 2:70345479-70345501 ATGTATTAAGAGCTATCAAGGGG - Intergenic
932426027 2:71635883-71635905 GTGGAGAAAAAGCAACAAAGAGG + Intronic
932510431 2:72282159-72282181 AAATATGAAAAGCAACAAAAGGG + Intronic
932541130 2:72653869-72653891 AAGTATTAATAACAACAAAATGG + Intronic
933137466 2:78755947-78755969 ATGTATTATAAGAAAAAAATGGG - Intergenic
935933813 2:108159098-108159120 AAGTATAAAAAGCAAGAAAATGG + Intergenic
936860397 2:117010615-117010637 ATATATTACAAGCCACAAAGTGG - Intergenic
938372198 2:130777735-130777757 ATGTATTAGAAGGATTAAAGTGG + Intergenic
939637130 2:144595737-144595759 TTGTATTAATAAAAACAAAGTGG + Intergenic
940448839 2:153812980-153813002 ATGTATAAAAATGATCAAAGTGG + Intergenic
940624595 2:156157625-156157647 ATATATTCACAGCAACAAATAGG + Intergenic
941757881 2:169207637-169207659 ATGTGATAAAAGTAGCAAAGAGG + Intronic
942005612 2:171696861-171696883 ATTTTGTAAAAGGAACAAAGGGG - Intronic
942171307 2:173292011-173292033 ATGTATTAAAATGAAACAAGTGG + Intergenic
942207474 2:173634488-173634510 ATGTATTAAAAGCTAAAGAATGG + Intergenic
942379998 2:175380446-175380468 ATGTATTAAGAGCCTCAAAAAGG - Intergenic
942857566 2:180568398-180568420 ATGGCTTAGAAGCAACAATGGGG - Intergenic
942940459 2:181609393-181609415 ATGTTTTAAAAGCAATGAGGGGG + Intronic
942985868 2:182141102-182141124 AAGTACTAATAGAAACAAAGTGG + Exonic
943142167 2:183996739-183996761 ATCTATAAAAAGCAATAAATAGG + Intergenic
943242901 2:185409329-185409351 ATGTATTAAAAGTAAAAATTTGG + Intergenic
943325114 2:186488093-186488115 AAATATTAACAACAACAAAGTGG + Intronic
943409902 2:187533511-187533533 TAGTATTAACATCAACAAAGAGG + Intronic
943547065 2:189293782-189293804 ATTGATTAAAAGCAACCCAGAGG + Intergenic
943940738 2:193991333-193991355 ATTTATTTAAACCAACAATGAGG - Intergenic
944031731 2:195242406-195242428 ATGAATTAACAACAACAAAAAGG + Intergenic
945370115 2:209006032-209006054 ATGTATCAAAAGGAAACAAGGGG - Intergenic
945382885 2:209162414-209162436 TTGTATTAAAAGCAAAAGAAAGG - Intergenic
945609797 2:211985637-211985659 ATGTATTAGAAGGATGAAAGGGG + Intronic
945904858 2:215580406-215580428 GTGTATTCAAAGAAACAGAGAGG - Intergenic
946091832 2:217232901-217232923 ATGTTTTAAAGGCACAAAAGTGG - Intergenic
946267114 2:218555384-218555406 ATGTATTTTTAGCATCAAAGTGG + Intronic
946269662 2:218580267-218580289 CTGTTTTAAAAGCAGAAAAGTGG - Intronic
946714410 2:222538467-222538489 CTGTATAAAATGCAACAGAGAGG - Intronic
947910717 2:233799161-233799183 ATGTGAAAAAAGCAACTAAGGGG + Intronic
948113699 2:235477715-235477737 ATATATTAAAAAGATCAAAGTGG + Intergenic
948431977 2:237924725-237924747 TTGTATTAAAAAAAAAAAAGGGG + Intergenic
1168791203 20:577390-577412 ATGCATTGAAAGAAAAAAAGGGG + Intergenic
1169923450 20:10758865-10758887 TTGTTTAAAAAGAAACAAAGGGG - Intergenic
1170354280 20:15475317-15475339 ATCCAGGAAAAGCAACAAAGAGG - Intronic
1171100878 20:22382972-22382994 GTTTATTAAAAGAAAGAAAGAGG - Intergenic
1176959539 21:15143728-15143750 ATGTTTTCAAAGCAAGAGAGAGG - Intergenic
1177865591 21:26509222-26509244 ATGTTTTAGGAGCAGCAAAGAGG - Intronic
1179005100 21:37507140-37507162 ATGTATTCAATGTTACAAAGTGG - Intronic
1179086676 21:38224568-38224590 ATTTATAAAAAGCATCAAAGGGG - Intronic
1180756447 22:18165145-18165167 ATGTATAAAAAGAATCACAGAGG - Intronic
1181075322 22:20372289-20372311 ATGTATAAAAAGAATCACAGAGG + Intronic
1182133726 22:27880521-27880543 ATGTTTTAAAAGTAAAAAGGCGG - Intronic
1182810340 22:33110904-33110926 AGATAATAAAAACAACAAAGGGG + Intergenic
1183571763 22:38658422-38658444 GTGTATTAAAAAAAAGAAAGAGG - Intronic
1184044151 22:41961992-41962014 GTATAGTAAAAGCAACACAGTGG + Intergenic
1184201892 22:42975315-42975337 ATCTATTAAAAGGTAGAAAGGGG + Intronic
949675713 3:6450553-6450575 ATGTTTTAAAATCAAAATAGTGG + Intergenic
951426019 3:22545805-22545827 ATTTTTTAAAAACAACAAAAAGG - Intergenic
951480583 3:23158088-23158110 ATTTAATAAAGGCAACAATGGGG + Intergenic
952008057 3:28865069-28865091 ATGTTTTAAAAGAAATAAAAGGG + Intergenic
952270043 3:31821530-31821552 ATGTTTTTAAAGCAATAGAGTGG - Intronic
952359164 3:32612454-32612476 ATGTACTCCAAGCAAGAAAGAGG + Intergenic
953445075 3:42956498-42956520 ATCAATTAGAAGCAATAAAGTGG - Intronic
954774125 3:53000323-53000345 ATGTTTCAACAACAACAAAGAGG + Intronic
954790100 3:53126239-53126261 ATTTATTAATAACAACCAAGAGG + Intronic
955989828 3:64614688-64614710 ATATCATAAAAGCAAGAAAGAGG + Intronic
956213189 3:66822892-66822914 CTGCATTAACAGAAACAAAGAGG - Intergenic
957637784 3:82809040-82809062 ATGTATTAAAATAAAAATAGAGG + Intergenic
957729289 3:84111851-84111873 ATTTTTTAAAAGCAAAAAAGGGG - Intergenic
958658095 3:97029336-97029358 ATTTATTAAAAACATCACAGGGG - Intronic
958901284 3:99889619-99889641 ATGAGATAAAAGCAACAAAAAGG - Intronic
959221373 3:103524974-103524996 ATGGAATAAAAGGAAAAAAGAGG + Intergenic
959425336 3:106180016-106180038 TTCTGTGAAAAGCAACAAAGTGG + Intergenic
961030984 3:123603659-123603681 ATGAATTAAAAAGAACAAACTGG + Intergenic
961099850 3:124189499-124189521 GTGTGTAAAAAGCAACATAGAGG + Intronic
961443419 3:126966407-126966429 AAGCATTATAGGCAACAAAGGGG + Intergenic
961715570 3:128855053-128855075 ATTTATAAACAGCATCAAAGGGG - Intergenic
962059644 3:131912076-131912098 TTGTGTGAAAGGCAACAAAGAGG - Intronic
963037266 3:141042317-141042339 ATGTGTTAAAAGCAAAAAGATGG + Intergenic
963170012 3:142241115-142241137 ATTTATTAAAAGCAAAACACGGG + Intergenic
963673917 3:148284781-148284803 ATGTATAAGAAGCTCCAAAGTGG + Intergenic
963799214 3:149659506-149659528 ATTTTTTAAAAGCAAAAATGGGG + Intronic
963817461 3:149847830-149847852 AAGTATTAAAAACAACAGAGAGG - Intronic
964037734 3:152218776-152218798 GTTTATTAAAAGTGACAAAGAGG + Intergenic
964137480 3:153360814-153360836 ATTTAAAAAAAACAACAAAGAGG - Intergenic
964746177 3:160014739-160014761 ATGTTTCAAAGGCCACAAAGAGG + Intergenic
966292207 3:178372891-178372913 ATATAGTAAAAGAAACAGAGTGG - Intergenic
966811654 3:183851619-183851641 ATATAATAAAGGCAACAAAATGG + Intronic
967011970 3:185443848-185443870 ATGATTTAAAAGCACCAAAAAGG - Intronic
969871999 4:10110458-10110480 ATGTACCAAAAGCAACACACAGG + Intronic
971249364 4:24960015-24960037 ATCTATTAAAAGATATAAAGAGG - Intronic
971850641 4:31981887-31981909 ATGTATCATTAGCAATAAAGAGG - Intergenic
972182585 4:36487452-36487474 AAATATTAAAAGGAACAAAAAGG + Intergenic
972465425 4:39351472-39351494 ATGTCCTAAAAGCAAAAAACAGG + Exonic
972480299 4:39490210-39490232 ATTTATAAAAAGCATCAAAGGGG + Intergenic
972983648 4:44736964-44736986 ATGTAATAAAAGCAAAAATAAGG + Intergenic
973210865 4:47614020-47614042 TTGTCTAAAAAGAAACAAAGTGG + Intronic
973831162 4:54760645-54760667 ATACACTAACAGCAACAAAGTGG - Intergenic
974156128 4:58075311-58075333 AAGTATTTAAAGCATCAAAGAGG + Intergenic
975085711 4:70336219-70336241 ATGATTTAAAAGCAACAAAAGGG + Exonic
975161010 4:71123868-71123890 TTGTATTAAAAGCATCAATTGGG + Intergenic
975193657 4:71496693-71496715 ATGTATTAGAAACAAAAAATAGG + Intronic
975940283 4:79635667-79635689 ATTTATTAAAAAAAAAAAAGAGG - Intergenic
976611650 4:87036701-87036723 ATCTATTAAGAGAAACAAAATGG + Intronic
977255896 4:94739689-94739711 ATGTATTAGAGACAGCAAAGTGG - Intergenic
977415301 4:96725296-96725318 ATATTTTAAAGGCAACTAAGAGG - Intergenic
977822910 4:101496987-101497009 ATGTATTAAAAGCAATAGTGTGG + Intronic
977849306 4:101806128-101806150 ATGTAATAAAAACAAAAAACTGG + Intronic
978664036 4:111162301-111162323 ATTTATTAAAAGAAAAAAAAAGG + Intergenic
979058168 4:116020067-116020089 ATTTATAAAAAGCATCAAAGGGG + Intergenic
979080593 4:116334625-116334647 ATCTATTAAGAGCAACTAGGAGG - Intergenic
979324292 4:119361094-119361116 ATGTATAAAAAGCAGTAAAGTGG - Intergenic
980218074 4:129877209-129877231 TTCTGTTAAAAGCAACAAACTGG - Intergenic
980428911 4:132664669-132664691 ATATTTTAAAAACAACAACGAGG - Intergenic
981058321 4:140390485-140390507 ATGTTTTAAAAACAATATAGAGG + Intronic
981078734 4:140617274-140617296 ATGCATTAAAACAAACACAGCGG - Intergenic
981308721 4:143274315-143274337 ATGTCATAAAAGAAAAAAAGGGG + Intergenic
981743809 4:148032168-148032190 AAGTATAAAAAGATACAAAGTGG + Intronic
981793696 4:148570116-148570138 CTGAATTAAAAACAACAATGAGG - Intergenic
981908134 4:149946735-149946757 ACGTATAAAAATTAACAAAGTGG + Intergenic
982367545 4:154596734-154596756 ATGTATTAATATCAACAACATGG + Intergenic
982586811 4:157251981-157252003 ATGGTGCAAAAGCAACAAAGTGG - Intronic
983242132 4:165245793-165245815 ATGTATAAAAAGCAGTAAAGTGG - Intronic
983321667 4:166202876-166202898 ATGTATGAAAAGGAAACAAGGGG - Intergenic
983371301 4:166862373-166862395 TTGAATAAAAAGTAACAAAGAGG + Intronic
984745927 4:183217581-183217603 ATATATTAAAAAAAACAAAATGG + Intronic
984924380 4:184793819-184793841 AGGTATTAGAAGGAACAAAAAGG - Intronic
986891088 5:12306955-12306977 ATTGATGACAAGCAACAAAGAGG - Intergenic
987744765 5:21956328-21956350 ATGTATTAAAATTAATAAACTGG + Intronic
988145659 5:27302653-27302675 AGGTATTAAAAACAACTGAGTGG + Intergenic
988695369 5:33616433-33616455 ATGTAATAGTAGCAACAAAGGGG - Intronic
988696298 5:33625870-33625892 ATGTTTTATATGCAACAAGGAGG - Intronic
988899592 5:35718063-35718085 ATGTATTAAAACAAAACAAGGGG + Intronic
990391349 5:55324767-55324789 ATGTTTTTAAATAAACAAAGAGG - Intronic
990428321 5:55710990-55711012 AGGTATTAAAAAGAAAAAAGAGG + Intronic
990470851 5:56114025-56114047 ATATATTAAAATGAATAAAGTGG + Intronic
990996806 5:61740631-61740653 AAGTATTAAAAACAAAAAGGAGG + Intronic
991764971 5:69966457-69966479 ATGTATTAAAATTAATAAACTGG + Intergenic
991782354 5:70151696-70151718 ATGTATTAAAATTAATAAACTGG - Intergenic
991844203 5:70841528-70841550 ATGTATTAAAATTAATAAACTGG + Intergenic
991874797 5:71152011-71152033 ATGTATTAAAATTAATAAACTGG - Intergenic
994559523 5:101349441-101349463 TTTTATTAAAAGATACAAAGTGG + Intergenic
994983951 5:106911790-106911812 AAGTAATAGAAGCAATAAAGAGG + Intergenic
995027931 5:107446241-107446263 ATGTATTAAAACAAAGTAAGAGG + Intronic
999487353 5:152010796-152010818 AAGTATTAAAAGGAAAATAGGGG - Intergenic
999781075 5:154850824-154850846 ATTTTTTAAAAGAAAAAAAGGGG - Exonic
1000407059 5:160899329-160899351 ATTTATTAAAAATAAGAAAGTGG + Intergenic
1000568431 5:162881021-162881043 ACGGATAAAAAGCTACAAAGGGG - Intergenic
1000706733 5:164521956-164521978 ATGCATTAAAAACTACAAGGTGG + Intergenic
1001319588 5:170669445-170669467 ATGTATTTAAAGTAATAGAGTGG + Intronic
1002221294 5:177684682-177684704 ATGTTTTAAAACCACCACAGAGG - Intergenic
1002547006 5:179955672-179955694 ATGGAATAAAAGGAAAAAAGAGG + Intronic
1004058095 6:12161418-12161440 ATCTAATAAAAACAACCAAGAGG - Exonic
1004173133 6:13314592-13314614 TTTTATTGAAATCAACAAAGTGG + Intronic
1004716583 6:18221898-18221920 ATGTTTTACAGGCAACAAACAGG + Exonic
1005396824 6:25391000-25391022 AAATATTAAAAGCCACAAAGTGG - Intronic
1005475853 6:26206982-26207004 ATGTAACAACAGCAACAAAAAGG + Intergenic
1005606466 6:27483256-27483278 ATATTTTAAAAACAAGAAAGAGG + Intergenic
1005722622 6:28617567-28617589 ATTTTTTAAAAGGAACAAATAGG - Intergenic
1005988264 6:30887612-30887634 AGCTATGAAAAGTAACAAAGAGG - Intronic
1006938734 6:37737265-37737287 ATGTTTTAAAAAGAACACAGAGG + Intergenic
1007188483 6:39993656-39993678 ATTTATAAAAGGCACCAAAGAGG - Intergenic
1009838270 6:69032778-69032800 ATGTTTTAAAAGATACAAAAGGG - Intronic
1010062722 6:71643347-71643369 ATATATTAAAAGCAAGTAAATGG + Intergenic
1010600705 6:77822494-77822516 ATGTATTTATAGCATCAATGAGG - Intronic
1011157928 6:84354559-84354581 ATTTATTAAAAGCAGTAAAGTGG + Intergenic
1011228492 6:85134056-85134078 ATGTGATAAAACCAACCAAGAGG + Intergenic
1011591183 6:88972148-88972170 ATGTATTAAAATGAAACAAGGGG - Intergenic
1012053777 6:94378874-94378896 ATGCTTTAATAGCAACAGAGAGG - Intergenic
1012154853 6:95806090-95806112 ATTTATTAAAAAAAAAAAAGGGG + Intergenic
1012250151 6:96971097-96971119 ACATATTAAAAACAACTAAGTGG - Intronic
1012429111 6:99145667-99145689 AATTATTAAAAGCAACAAGCTGG - Intergenic
1012448468 6:99330383-99330405 ATGTATTCAGTACAACAAAGGGG + Intronic
1012844633 6:104374587-104374609 AACTATAAAAAGAAACAAAGGGG + Intergenic
1012931370 6:105320810-105320832 ATGTAATAGAAGCAAAAATGTGG + Intronic
1014026492 6:116653153-116653175 ATATACTAAAAGCAGGAAAGGGG - Intronic
1014449187 6:121564044-121564066 ATTCTTTAAAAGCAAGAAAGAGG - Intergenic
1014703982 6:124724199-124724221 ATATTTTAAAAGCAACGTAGGGG - Intronic
1015452057 6:133381285-133381307 TTGTATTAAAAGCAAAAGACGGG + Intronic
1016083294 6:139881555-139881577 ATGTGTTAAAAAAAAAAAAGTGG + Intergenic
1016368448 6:143343841-143343863 ATTTATTAAAAACAACTAATAGG - Intergenic
1016507778 6:144803160-144803182 ATGTATTAAAAACAAAACAGTGG - Intronic
1016805466 6:148207749-148207771 ATGTTTTAAAAGGGACAAAGAGG - Intergenic
1017081748 6:150676169-150676191 ACGTAATGAAAGCAACAAAATGG + Intronic
1017277518 6:152587250-152587272 ACTTATCAAAAGCAACAAAAAGG - Intronic
1019801180 7:3089493-3089515 ATATATTAAAAGCCAGAAGGTGG - Intergenic
1020372329 7:7445690-7445712 ATTTATTAATAGCAACAAAATGG + Intronic
1020736781 7:11959851-11959873 AAGTTTTAAAGGCAAAAAAGAGG + Intergenic
1021244179 7:18241505-18241527 ATGTAGTGAAAACAACAAAGAGG - Intronic
1023245141 7:38194975-38194997 ATGTTTTAAAAACAAAAAAAAGG - Intronic
1024042532 7:45566462-45566484 ATGTATCAAAATCAACCAGGAGG + Intergenic
1024393470 7:48840731-48840753 AAGTGTTAAAAGAAACAGAGGGG - Intergenic
1024440138 7:49407521-49407543 GTTTTTTAAAAGCAAAAAAGGGG - Intergenic
1024746098 7:52408149-52408171 ATACATCAAAAGGAACAAAGGGG + Intergenic
1024882871 7:54109828-54109850 ATGTTTTAAAAGCACCAGACTGG - Intergenic
1025157825 7:56625364-56625386 ATGTATTAAAACGAAACAAGGGG - Intergenic
1025757909 7:64362677-64362699 ATGTATTAAAACGAAACAAGGGG + Intergenic
1025823216 7:64990920-64990942 ACTTATAAAAAGCATCAAAGGGG - Exonic
1026470058 7:70687489-70687511 ATGTACTATAAACTACAAAGGGG - Intronic
1027006568 7:74698710-74698732 TTGTTATAAAAGCAAAAAAGAGG - Intronic
1028183192 7:87749668-87749690 ATAAATTAAAAGCAGCAATGTGG - Intronic
1028204432 7:87999573-87999595 ATGTATTAAAAACAACTATCTGG - Intronic
1028411947 7:90539441-90539463 AAGAAATAAAAGCATCAAAGTGG + Intronic
1029852406 7:103476811-103476833 ATGTATCAAAAACAAAAAATAGG - Intronic
1030463100 7:109865354-109865376 CTGTAATAAAATCAACAGAGGGG - Intergenic
1030481532 7:110110886-110110908 ATGGATTACAAGCAGCAATGGGG - Intergenic
1030647796 7:112082933-112082955 ATACATTAAAAGTAATAAAGTGG - Intronic
1030962260 7:115940240-115940262 ATGTTTTAAAAGCAGCAACTTGG - Exonic
1031133867 7:117864170-117864192 ATGTATTACCATCAATAAAGAGG + Intronic
1031136366 7:117888555-117888577 ATGTATTCACAGCAGCCAAGAGG + Intergenic
1031295240 7:119993828-119993850 ATTTTTTAAAAATAACAAAGGGG - Intergenic
1031299972 7:120053321-120053343 ATTTGTAAAAAGCATCAAAGCGG - Intergenic
1031751682 7:125582633-125582655 ATCATTTAAAACCAACAAAGGGG - Intergenic
1031785792 7:126029612-126029634 AAGTATTAAATCCAATAAAGAGG - Intergenic
1031834631 7:126668192-126668214 ATGGATGAAAAGGAAGAAAGGGG - Intronic
1033146092 7:138871156-138871178 AAGCAATAAAATCAACAAAGAGG - Exonic
1033334728 7:140442791-140442813 AGGTCTTAAAAGTAAGAAAGTGG - Intergenic
1033789654 7:144776060-144776082 ATGTTTTAAGAGCAGCAAGGAGG - Intronic
1033854819 7:145547216-145547238 ATGTTTTAAAAGAAACTATGTGG - Intergenic
1033976852 7:147113437-147113459 ATTTATTAAAAAAAAAAAAGAGG + Intronic
1034698208 7:153073832-153073854 ATGAATTAAAAACAACACACTGG - Intergenic
1034933784 7:155185031-155185053 ATGTCTTTAAAGGAACAAAAGGG - Intergenic
1035237075 7:157504658-157504680 ATGTATTATTAGAAATAAAGAGG - Intergenic
1035879177 8:3225669-3225691 TTGATTTAAAAGAAACAAAGGGG + Intronic
1035944511 8:3946473-3946495 ATGATTTAAAAAGAACAAAGTGG - Intronic
1035962719 8:4155780-4155802 GTGTATTAAGAGCCACAAAGGGG + Intronic
1036089388 8:5648730-5648752 ATTTCTCAAAAGCAACAAAGAGG - Intergenic
1036148389 8:6275565-6275587 CTGTACTAAAAGAAAGAAAGGGG + Intergenic
1036296029 8:7538213-7538235 ATGTCTTAAAAGCCTCCAAGGGG - Intergenic
1036326537 8:7782806-7782828 ATGTCTTAAAAGCCTCCAAGGGG + Intergenic
1037904948 8:22710782-22710804 ATGAATTAAAAGCAGAAGAGGGG + Intergenic
1038222097 8:25619982-25620004 ATAAATTAAAAGCATCAAATAGG + Intergenic
1038556020 8:28517047-28517069 ATGAATTAAGAGCAACAAAAGGG - Intronic
1039353067 8:36783096-36783118 CAGTAATAAAAGCAAGAAAGGGG + Intergenic
1039611157 8:38920439-38920461 CTCTACTAAAAGTAACAAAGTGG - Intronic
1040011005 8:42661232-42661254 ATCTAGTAGAAGCAAGAAAGAGG + Intergenic
1040440831 8:47440106-47440128 ATGTATTAAATGCAACATGCAGG + Intronic
1040809187 8:51431516-51431538 ATGTGTCAAAAGCCACAAAAAGG - Intronic
1042287144 8:67126130-67126152 ATGTATCTAAAGAAATAAAGTGG - Intronic
1043208898 8:77485275-77485297 AGGAATTAAAAGCAAAAAAGAGG - Intergenic
1044692105 8:94891357-94891379 ATATATGAAAAACCACAAAGTGG + Intronic
1047179547 8:122573966-122573988 CTGTATTAAATCCAACAAGGGGG - Intergenic
1047883541 8:129222657-129222679 AAGAACTAAAAGCAGCAAAGAGG + Intergenic
1047907535 8:129488386-129488408 AGGTATTAAAGACAACAATGGGG + Intergenic
1048011863 8:130463883-130463905 ATTTTTTAAAAGCATTAAAGTGG - Intergenic
1048115961 8:131522775-131522797 AGGTATTAAAAACAACATTGGGG + Intergenic
1049331685 8:142057956-142057978 AGGTAGTAAAAACAAGAAAGAGG + Intergenic
1050076494 9:1871177-1871199 CTGTATTACAAGAAACAAATTGG - Intergenic
1050932516 9:11348502-11348524 ATGTTTTTAAAGGAAAAAAGGGG - Intergenic
1050963118 9:11763198-11763220 ATTAATTAAACACAACAAAGTGG - Intergenic
1050967589 9:11826545-11826567 AGGTATTAACTTCAACAAAGAGG + Intergenic
1051653369 9:19353086-19353108 ATATTTTAGAAGAAACAAAGGGG + Intronic
1051736647 9:20206777-20206799 ATTAATTAAAAGTAATAAAGCGG - Intergenic
1051854303 9:21545450-21545472 ATGTTTTAAATGCATCAAAGAGG + Intergenic
1052308812 9:27041585-27041607 ATGTAGTAGAATCAACAATGAGG - Intronic
1052536781 9:29757856-29757878 ATGTATTACAAGCAATCTAGAGG - Intergenic
1054763037 9:69020459-69020481 ATGCATTATAAGGGACAAAGAGG + Intergenic
1055542065 9:77320213-77320235 AAGTAATAATAGCTACAAAGTGG + Intronic
1055718779 9:79148286-79148308 ATGTATTGAAAGCATGAAATTGG + Intergenic
1055879434 9:80981636-80981658 ATGACTGAAGAGCAACAAAGAGG - Intergenic
1056126692 9:83541559-83541581 ATCTTTGAAAAGCACCAAAGTGG + Intergenic
1057287517 9:93771589-93771611 ATGTATAAAAAGTGACCAAGTGG + Intergenic
1058716324 9:107725456-107725478 TTGTATGCATAGCAACAAAGAGG + Intergenic
1059030469 9:110688065-110688087 ATGGTTTAAAAGCAACACTGAGG - Intronic
1059034478 9:110739255-110739277 ATAGATTAAAATCATCAAAGAGG + Intronic
1059127152 9:111700554-111700576 ATGTACCCTAAGCAACAAAGAGG + Intronic
1060241523 9:121907789-121907811 ATGTATTATATCCAACCAAGTGG + Intronic
1060461710 9:123861750-123861772 ATATATATAAATCAACAAAGAGG + Intronic
1060645411 9:125274760-125274782 ATGAATTAAAATGAATAAAGCGG - Intronic
1186343373 X:8666292-8666314 ATTTGTTAAATACAACAAAGGGG - Intronic
1187255873 X:17641547-17641569 ATCTATTAAATGCAAGAAATTGG - Intronic
1187672495 X:21682444-21682466 AAGTATTATAAGAAATAAAGAGG + Intergenic
1187964610 X:24598360-24598382 ATGTATTTAAAGATAGAAAGGGG - Intronic
1187998614 X:24956580-24956602 ATACATTGAAAACAACAAAGGGG - Intronic
1188932474 X:36128935-36128957 ATGTATTAAAAAAAATAAAATGG - Intronic
1188942416 X:36256634-36256656 ATGTTTTACAAACAACAAACAGG + Intronic
1189023594 X:37368427-37368449 ATGTATTATAAGAGATAAAGAGG - Intronic
1189096395 X:38144713-38144735 CTGTAAGAAAAGCGACAAAGAGG - Intronic
1189151478 X:38712674-38712696 AAGTTTCAAAAGCAACAGAGTGG + Intergenic
1190444468 X:50509635-50509657 AAGTTCTAAAAGCAAAAAAGGGG + Intergenic
1190512116 X:51184032-51184054 AGTTATTAAAAGAAACAAATGGG - Intergenic
1190650998 X:52568689-52568711 ATGTATGGCAAGCACCAAAGTGG - Intergenic
1191644617 X:63467007-63467029 ATGTATTAAAATGAAACAAGGGG + Intergenic
1193249697 X:79275729-79275751 ATGTAATAAAAGCAATATAGAGG - Intergenic
1194814270 X:98423430-98423452 ATTTATTAAAAAAAAAAAAGAGG - Intergenic
1194861357 X:99002484-99002506 ATGTATTGAAAGCAAAAATTTGG + Intergenic
1195362047 X:104092152-104092174 ATTTATTCAAAGCAGAAAAGAGG - Intergenic
1195646765 X:107239891-107239913 GTGTATAAAATGCAACAAAAGGG - Intronic
1196189525 X:112780253-112780275 AGGAATTAACAGCAACAAAAAGG + Intronic
1197129119 X:122983732-122983754 AAATATTCAAAGCAACAAATTGG - Intergenic
1197240810 X:124121186-124121208 AAATATTGAAAGCAAAAAAGTGG + Intronic
1197480006 X:126971360-126971382 ATGCATTCAAAGAAACAAAATGG + Intergenic
1197782179 X:130170476-130170498 AAGTCTTAAAAGAAACAAATGGG + Intergenic
1198978749 X:142368757-142368779 AAGCATTAAATGGAACAAAGAGG + Intergenic
1199494844 X:148441532-148441554 AAGCATTAAAATGAACAAAGGGG - Intergenic
1200898607 Y:8403938-8403960 ATGTATTAAAATGAAACAAGGGG - Intergenic
1201541386 Y:15108968-15108990 ATGTAATAAAAGTGATAAAGGGG - Intergenic
1201548529 Y:15193963-15193985 TTTTATTAAATGCAACAAAATGG + Intergenic
1202095003 Y:21240706-21240728 ATTCATAAAAAGCATCAAAGGGG - Intergenic
1202327095 Y:23703243-23703265 ATATTTTAAAAGAAAAAAAGAGG + Intergenic
1202543675 Y:25966809-25966831 ATATTTTAAAAGAAAAAAAGAGG - Intergenic