ID: 1159020010

View in Genome Browser
Species Human (GRCh38)
Location 18:63135685-63135707
Sequence CAGGGACAATTGACGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 171}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159020010_1159020015 22 Left 1159020010 18:63135685-63135707 CCTTCCTCCGTCAATTGTCCCTG 0: 1
1: 0
2: 1
3: 10
4: 171
Right 1159020015 18:63135730-63135752 CATCCTTCCTTTCTGACCTCAGG 0: 1
1: 0
2: 4
3: 41
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159020010 Original CRISPR CAGGGACAATTGACGGAGGA AGG (reversed) Intronic
900175183 1:1288373-1288395 CAGGGACACGGGACGGAGCAGGG - Intronic
900175188 1:1288391-1288413 CAGGGACACGGGACGGAGCAGGG - Intronic
900175193 1:1288409-1288431 CAGGGACACGGGACGGAGCAGGG - Intronic
900175352 1:1289101-1289123 CAGGGACACGGGACGGAGCAGGG - Intronic
900175395 1:1289271-1289293 CAGGGACACGGGACGGAGCAGGG - Intronic
900175461 1:1289533-1289555 CAGGGACACGGGACGGAGCAGGG - Intronic
900175466 1:1289551-1289573 CAGGGACACGGGACGGAGCAGGG - Intronic
900175568 1:1289990-1290012 CAGGGACACGGGACGGAGCAGGG - Intronic
900175606 1:1290172-1290194 CAGGGACACGGGACGGAGCAGGG - Intronic
901903872 1:12391334-12391356 CATGATCAATTGACAGAGGAAGG - Intronic
902606342 1:17571409-17571431 CAGGGACAGGAGACGGAGCATGG + Intronic
906290209 1:44614779-44614801 CAGGGACAAGGGAGGGAGGCTGG - Intronic
907582224 1:55582639-55582661 GAGGGGCAATGGAAGGAGGAAGG + Intergenic
907771397 1:57468349-57468371 GTGGAACAATTGACGGAGTAAGG + Intronic
909382775 1:75018880-75018902 TAGGGACAAGTGACAGAGGAAGG - Intergenic
911262127 1:95699242-95699264 CAGGGCCTGTTGAGGGAGGAGGG + Intergenic
915346707 1:155201249-155201271 CAGGGAAAATATAGGGAGGAGGG - Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915482939 1:156199581-156199603 GAGGGACAATTTCTGGAGGAGGG + Intronic
917119053 1:171629824-171629846 CAGGGACATTTGTGGGATGAAGG + Intergenic
918846484 1:189621785-189621807 CAGGGACAATGGACGAAGCTGGG + Intergenic
919809769 1:201401101-201401123 CAGGGACACTTCACGAAGGCAGG + Intergenic
920628636 1:207629268-207629290 CAGGGAGACTTCACAGAGGATGG - Intronic
920945032 1:210520643-210520665 CAGAGACAATGGGAGGAGGATGG - Intronic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
923894518 1:238254275-238254297 TAGGGACAATGGACGGGGAAAGG + Intergenic
1062958705 10:1557285-1557307 CAGGTGCACTTGACAGAGGAGGG - Intronic
1064397182 10:14991397-14991419 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1064400074 10:15013855-15013877 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1067040762 10:42952034-42952056 CTGGGACTATTTAGGGAGGAGGG + Intergenic
1068027128 10:51660180-51660202 CAGTGACAAATGACACAGGAAGG + Intronic
1071007084 10:80895287-80895309 CAGGGACCACTGACGGCTGAGGG + Intergenic
1073465542 10:103692845-103692867 CAGGGGCCATGGACTGAGGAGGG + Intronic
1074388759 10:113038669-113038691 CTGGGACAATAGACTGGGGAAGG - Intronic
1077070074 11:665728-665750 CAGGGACAGGTGACGTAGCAGGG + Intronic
1078455279 11:11470090-11470112 CAGGGACACTTGGATGAGGATGG + Intronic
1080416236 11:32072438-32072460 CAGGAAGAATTGTGGGAGGAAGG + Intronic
1081914881 11:46724317-46724339 TAGGGTCAACTGACGGAGGTTGG + Intronic
1083872476 11:65497666-65497688 CAGGGACAAACGCCGGGGGAGGG - Intergenic
1084261075 11:67979051-67979073 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1084807556 11:71589488-71589510 GAAGGACAAGTGATGGAGGAAGG + Intronic
1084844654 11:71889495-71889517 GAAGGACAAGTGATGGAGGAAGG + Intronic
1084847506 11:71911954-71911976 GAAGGACAATTGATGGAGGAAGG + Intronic
1087577762 11:100010871-100010893 CAGGGAGGATTAATGGAGGAGGG - Intronic
1087626267 11:100600308-100600330 CAGGGCCAATTTTCTGAGGATGG - Intergenic
1089634838 11:119805431-119805453 CAGGGACAGTTGATGGGGGAAGG - Intergenic
1091081301 11:132671140-132671162 CAGGGACAGATGGCGGAGAAGGG + Intronic
1091173293 11:133537580-133537602 CAGAGACCTTTGAGGGAGGATGG - Intergenic
1091321607 11:134656221-134656243 CAGGGACGCCTGTCGGAGGAGGG + Intergenic
1092432336 12:8419619-8419641 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1096508967 12:52116573-52116595 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1101635628 12:106538774-106538796 CAGGGGCAATTGATTGAGAAGGG + Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1103820053 12:123690519-123690541 CAGGGACACCTGAGGGAGAAGGG - Exonic
1104603458 12:130169461-130169483 CAGGGACAGAGGAGGGAGGAGGG + Intergenic
1104876537 12:132038838-132038860 CAGGGCCACATGAAGGAGGAGGG - Intronic
1113507372 13:110826500-110826522 CAGGGTCAATTGATGGTGGATGG + Intergenic
1113507387 13:110826608-110826630 CAGGGTCAATTGATAGTGGATGG + Intergenic
1114225572 14:20735069-20735091 CAGGGGCTATTGATGGAGGCAGG - Intronic
1114227027 14:20748084-20748106 CAGGGGCTATTGATGGAGGCAGG - Exonic
1117038837 14:51751966-51751988 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1120055480 14:79919263-79919285 CACGGACAATGGAGGGAGGGAGG - Intergenic
1123053564 14:105559219-105559241 CAGGGACAGTGGCCGGAGGCTGG + Intergenic
1123078142 14:105679634-105679656 CAGGGACAGTGGCCGGAGGCTGG + Intergenic
1128313488 15:66646015-66646037 CAGGGACCATTGACTGAAAAGGG + Intronic
1129253492 15:74321091-74321113 CAGGGACAAGTCGGGGAGGATGG - Intronic
1129803674 15:78436941-78436963 CAGGGAAAATGGACAGAGGGAGG + Intergenic
1133576843 16:7099713-7099735 GAGGGACACTTCAAGGAGGAAGG + Intronic
1133997872 16:10761945-10761967 GAGGGGCAATGGAAGGAGGAGGG + Intronic
1143890684 17:10099901-10099923 CAGGGACAGTGGACAGTGGAAGG + Intronic
1146965521 17:37025482-37025504 CAGTGGCCATTGACGGGGGAGGG + Intronic
1148755452 17:49970708-49970730 CAAAGACAATTGCAGGAGGAGGG - Intronic
1151345692 17:73500092-73500114 GAGGGAGGATGGACGGAGGATGG - Intronic
1152350719 17:79782510-79782532 CAGGGACAGTGCCCGGAGGAGGG - Intronic
1153253048 18:3141843-3141865 CAGGGACAATGGAGTGAGGGAGG - Intronic
1157110481 18:44816068-44816090 CAGGGACAATAGATGAAAGAAGG + Intronic
1157286818 18:46382635-46382657 GATGGACAATAGACAGAGGATGG - Intronic
1159020010 18:63135685-63135707 CAGGGACAATTGACGGAGGAAGG - Intronic
1159970688 18:74648365-74648387 CAGGGACAATTGGGTGAGGTGGG + Intronic
1160516022 18:79479766-79479788 CAGGGACAAAGGGCGGTGGACGG - Intronic
1160820783 19:1056765-1056787 CAGGGGCAATTTAGGGATGAGGG - Intronic
1161737942 19:6002951-6002973 CAGGGACAACACAGGGAGGAGGG + Intronic
1163189771 19:15669246-15669268 CAGGGACAAAAGAAGAAGGAAGG + Intergenic
1166386047 19:42381932-42381954 CAGGGAGAAGTGACGGCAGAGGG - Intergenic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
1166894750 19:46016403-46016425 CAGGGGCAGGTGAGGGAGGAAGG - Intronic
1167980737 19:53272907-53272929 CTGGGACATTTGAAGGAGAAGGG + Intergenic
929993500 2:46810261-46810283 AAGGGAGATTTGACTGAGGAAGG + Intergenic
932349985 2:71023882-71023904 GAAGGACAAGTGATGGAGGAAGG + Intergenic
932569784 2:72932516-72932538 CAGGGAGAGTTGACAGATGAAGG + Intronic
935146350 2:100398171-100398193 CAGGGACCATTAAAGGAGGCAGG + Intronic
936266960 2:111018212-111018234 CAGGGAGAGGGGACGGAGGAGGG + Intronic
937356608 2:121201841-121201863 AAGGGACAGATGAAGGAGGAAGG + Intergenic
937357703 2:121208771-121208793 AAGGGACAGATGAAGGAGGAAGG + Intergenic
938134881 2:128748707-128748729 CAAGGCCAATGGACTGAGGATGG - Intergenic
938794582 2:134706946-134706968 CAGGGAGAGTTGTCGGAGCAAGG + Intronic
940874448 2:158885653-158885675 GAAGGACAAGTGATGGAGGAAGG + Intergenic
944617400 2:201475854-201475876 AAGTGAAAATTGAGGGAGGAAGG + Intronic
946919637 2:224565388-224565410 CAGGCACAAGAGATGGAGGAGGG + Intronic
947447773 2:230177713-230177735 CAGGGTGAATTCACAGAGGATGG - Intronic
947527721 2:230889431-230889453 TAGGGACAAGTGACTCAGGAAGG + Intergenic
947927117 2:233931471-233931493 CAGGGTCAATGAACAGAGGAAGG + Intronic
947935763 2:234002115-234002137 CAGGGAAGATTTATGGAGGAAGG + Intronic
948870244 2:240794159-240794181 CAGGGAAGCCTGACGGAGGAAGG - Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1171299860 20:24050736-24050758 CAGGGACTAATCAAGGAGGATGG + Intergenic
1173129830 20:40381400-40381422 CAGGGACATTTGACAGAGAAAGG + Intergenic
1173827865 20:46058726-46058748 CTGGGACAAGTGAGGGAGGAGGG + Intronic
1184321940 22:43748541-43748563 CAGGAACAATTGGATGAGGAAGG - Intronic
1184652600 22:45925968-45925990 CAGGGACAGGGGAGGGAGGAGGG - Intronic
949884603 3:8683239-8683261 GAAGGACAAGTGATGGAGGAAGG + Intronic
950880872 3:16321783-16321805 CAGGGAAAATTCAGAGAGGATGG - Intronic
956601176 3:71024244-71024266 CAGTGACAGTTGAAGGAGAAAGG - Intronic
956860903 3:73322685-73322707 CAGGGTCAAGGGCCGGAGGAGGG - Intergenic
960797789 3:121506334-121506356 CATGGACAATTCACTGGGGAGGG + Intronic
961110830 3:124281680-124281702 CAGGGACAATTTGAGGGGGATGG - Intronic
961275152 3:125720558-125720580 GAAGGACAAGTGATGGAGGAAGG + Intergenic
961278069 3:125743181-125743203 GAAGGACAAGTGATGGAGGAAGG + Intergenic
961876342 3:130026475-130026497 GAAGGACAAGTGATGGAGGAAGG - Intergenic
963404691 3:144847486-144847508 CAGAGACAATGGAAGAAGGAAGG + Intergenic
968988612 4:3893681-3893703 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969019594 4:4130924-4130946 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969024297 4:4161324-4161346 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969025205 4:4167270-4167292 GAAGGACAACTGATGGAGGAAGG - Intergenic
969495830 4:7525693-7525715 AAGGGACAAGTGACTGAGGTGGG - Intronic
969729520 4:8945840-8945862 GAAGGACAAGTGATGGAGGAAGG + Intergenic
969789106 4:9479780-9479802 GAAGGACAAGTGATGGAGGAAGG + Intergenic
969793844 4:9510548-9510570 GAAGGACAAGTGATGGAGGAAGG + Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
976554467 4:86433771-86433793 AAGGGAGCATTGAAGGAGGAAGG + Intronic
979522106 4:121679440-121679462 AAGGAACAATTGAGGGAGGAAGG - Intronic
982863066 4:160478487-160478509 CATGGAAAATTGACGTAGCAAGG + Intergenic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
989195963 5:38716601-38716623 CAGGGAGAATTGAGGGATGCTGG + Intergenic
994030526 5:95136530-95136552 CAGGGAAAATTCAAGGGGGAGGG + Intronic
999322056 5:150621615-150621637 CAGGTACAATTGCGGAAGGATGG - Intronic
999477342 5:151912664-151912686 CAGAGCCAATAGAAGGAGGATGG + Intronic
999521990 5:152360094-152360116 TAGGGAAAATTGAGGGAGCAGGG + Intergenic
1003694088 6:8385147-8385169 CAGGGACAATTTAGTGAGAAAGG + Intergenic
1010010878 6:71046710-71046732 CAAGGAGAATTCACGGAGGTAGG + Intergenic
1010919951 6:81668947-81668969 CAGGGACATTTTCTGGAGGAAGG - Intronic
1011318611 6:86065149-86065171 CAGGGACAGTTTCCAGAGGAAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1014355568 6:120405287-120405309 GAGGGTCAATTTGCGGAGGAAGG - Intergenic
1014512315 6:122338811-122338833 TAGGGACAATTGGGGGTGGAGGG + Intergenic
1016139054 6:140585839-140585861 CAGTGAGAGTTGACAGAGGAAGG + Intergenic
1017790154 6:157790730-157790752 CAAGGACAATTGGCTGAGGTGGG - Intronic
1019485046 7:1285563-1285585 CAGGGACAACTGGGGGAGGAGGG - Intergenic
1020306974 7:6842939-6842961 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1020311459 7:6871795-6871817 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1022798420 7:33751685-33751707 CAAGGACAATTGGGGCAGGAGGG + Intergenic
1024251327 7:47507846-47507868 CAGGGACAGCTGTGGGAGGAGGG + Intronic
1027552402 7:79615594-79615616 CAAGGACATTTGACAGAGAAAGG - Intergenic
1029078133 7:97951887-97951909 GAGGGACAAGTGATGGAAGAAGG - Intergenic
1035677132 8:1463747-1463769 CAGGCCCATCTGACGGAGGAGGG - Intergenic
1035757110 8:2042901-2042923 AAGGGACAAAAGACGGAGGGAGG - Intergenic
1036239877 8:7072620-7072642 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036262004 8:7248547-7248569 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036304587 8:7591011-7591033 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036314043 8:7707086-7707108 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036355438 8:8039003-8039025 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036820136 8:11933614-11933636 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036833304 8:12038539-12038561 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036855150 8:12285104-12285126 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036903465 8:12688957-12688979 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036905954 8:12708624-12708646 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1037312580 8:17572450-17572472 CAGAGACAGTTGAAAGAGGAGGG + Intergenic
1037529894 8:19762863-19762885 CAGGGAAAATAGCCTGAGGAAGG + Intergenic
1040081200 8:43288239-43288261 CTGGGACAGTTCACGGAGGCAGG + Intergenic
1041953123 8:63526317-63526339 CATGGACTATTGAAGCAGGAAGG - Intergenic
1047011662 8:120679130-120679152 CAGGAACTATAGACAGAGGAAGG - Intronic
1052502984 9:29316826-29316848 CAGGGACAAGAGATGGAGCAGGG + Intergenic
1056865892 9:90227116-90227138 GAAGGACAAGTGACGGAGGGAGG + Intergenic
1057854668 9:98593422-98593444 CAGGGACAATGGCAGGAGCAGGG + Intronic
1061219640 9:129242767-129242789 CAAGGACAGCTGAGGGAGGATGG + Intergenic
1061401833 9:130372763-130372785 CAGGGACAATCGAAAGTGGAAGG + Intronic
1185834749 X:3334937-3334959 CAGGGACGATTAACTGAGGCGGG - Intronic
1190000828 X:46685002-46685024 CAGAGACAAGTGATGGAGGGTGG - Intronic
1190114105 X:47614512-47614534 CAGGGACACTTGAAAGAGCACGG - Intronic
1196069628 X:111506379-111506401 AAGGGACCATTGATGGATGAAGG - Intergenic
1196735757 X:118979627-118979649 CAGGGACATTAGAAAGAGGAAGG + Intronic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1200301788 X:154983840-154983862 CAGAGACAAATGAGGGAGGAAGG - Intronic