ID: 1159021817

View in Genome Browser
Species Human (GRCh38)
Location 18:63149483-63149505
Sequence CAGAACAAGCGAAAGTCGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 42}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159021817_1159021819 2 Left 1159021817 18:63149483-63149505 CCAGACGACTTTCGCTTGTTCTG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1159021819 18:63149508-63149530 TCTGTTTCTCTTCTAGCCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 386
1159021817_1159021818 1 Left 1159021817 18:63149483-63149505 CCAGACGACTTTCGCTTGTTCTG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 1159021818 18:63149507-63149529 CTCTGTTTCTCTTCTAGCCCAGG 0: 1
1: 1
2: 2
3: 22
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159021817 Original CRISPR CAGAACAAGCGAAAGTCGTC TGG (reversed) Intronic
912215614 1:107607642-107607664 CAGAACAAGAGATAGATGTCAGG - Intronic
920687326 1:208119341-208119363 CAGACCCAGCGAAAGGTGTCCGG + Intronic
1074934235 10:118161937-118161959 AAGAACAAGGGAAAGTCATTGGG + Intergenic
1076810562 10:132884382-132884404 CAGAACAATCCAAAGGCCTCGGG + Intronic
1088984653 11:114894895-114894917 CAGAAAAAGGGAAATTCATCAGG - Intergenic
1095909538 12:47412077-47412099 CAGAAAAACTGAAAGTAGTCAGG + Intergenic
1102815828 12:115865578-115865600 CAAAACAAGCAAAAGTCTTTGGG - Intergenic
1109525580 13:63570464-63570486 CAGAACTAAGGAAAGTGGTCAGG - Intergenic
1111235592 13:85404070-85404092 CAGAACAATGGAAAGTCGTGTGG + Intergenic
1112900667 13:104353473-104353495 CAGAACAAGTGAAAATTTTCTGG - Intergenic
1116717804 14:48449516-48449538 CAGAACAAGCTAAAGTCTAAGGG + Intergenic
1121049031 14:90808077-90808099 CACAACAAGCGAATGATGTCAGG - Intronic
1133870266 16:9679468-9679490 CAGAACAAGAGAAAGACGTTTGG + Intergenic
1134662864 16:15997385-15997407 CAGAGAAAGCGCAAGTCGGCTGG - Intronic
1145357934 17:22180660-22180682 CAGAACATGAGAAAGTTGTGTGG + Intergenic
1159006770 18:63020205-63020227 CAGGGCAAGAGAAAGTCCTCAGG + Intergenic
1159021817 18:63149483-63149505 CAGAACAAGCGAAAGTCGTCTGG - Intronic
933732344 2:85466827-85466849 GAGAGCAAGAGAGAGTCGTCAGG + Intergenic
934580937 2:95437310-95437332 CAGATAGAGAGAAAGTCGTCTGG - Intergenic
934598513 2:95639404-95639426 CAGATAGAGAGAAAGTCGTCTGG + Intergenic
940963767 2:159814888-159814910 CAGAACAAATGAAAGTCATTGGG + Intronic
947847075 2:233252875-233252897 CATAACTTGAGAAAGTCGTCAGG - Intronic
1174470474 20:50756334-50756356 CAGAAAAAGCTAAAGTCTTTTGG + Intronic
1175876300 20:62231837-62231859 CAGAGCAAGGGAAAGTTGTTTGG - Intergenic
1176588366 21:8613079-8613101 CAGAACAGGTGAAAGTGGTTTGG + Intergenic
1180271198 22:10590075-10590097 CAGAACAGGTGAAAGTGGTTTGG + Intergenic
949811238 3:8008649-8008671 CAGAACAACCCAAATTCGTGAGG - Intergenic
956892868 3:73629403-73629425 CAGAACAAGAGAAAGTGCTGAGG + Intergenic
959977211 3:112474021-112474043 CACAACAAGCCAAAGTCCTAGGG - Intronic
960654833 3:119991032-119991054 CAGAACAAGTGAAACTAGGCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
970366034 4:15359286-15359308 CAGAAAAAGGGAAAGACATCTGG + Intronic
981908742 4:149953699-149953721 CAGAGCAAGCGAAAGCCCTGAGG + Intergenic
996593852 5:125179154-125179176 CAGAATAAGCCAAAGAGGTCTGG + Intergenic
1001111244 5:168897931-168897953 CAGAACAGGGGAAGGTCGGCTGG + Intronic
1012629135 6:101441892-101441914 CAGAACATAAGAAAGTAGTCTGG + Intronic
1013365493 6:109434682-109434704 CAGAACAATCGAAACTGCTCTGG + Intronic
1013575452 6:111479926-111479948 CAGAACAATCAAAAGTCAACTGG + Intronic
1021747987 7:23762993-23763015 CAGAACAATCTAAAGTCTTAAGG - Intronic
1033510265 7:142053717-142053739 CAGAGTAAGTGAAAGTGGTCAGG + Intronic
1036220815 8:6920610-6920632 CAGGACAAGGCAAAGACGTCAGG - Intergenic
1038638472 8:29305579-29305601 AAGAGCAAGCGAAAGGGGTCTGG - Intergenic
1050025013 9:1324692-1324714 CAGAACAAGTGACATTCCTCAGG + Intergenic
1052445864 9:28560370-28560392 CTGAACAAGAGAAATTCTTCAGG + Intronic
1203618375 Un_KI270749v1:91641-91663 CAGAACAGGTGAAAGTGGTTTGG + Intergenic