ID: 1159022522

View in Genome Browser
Species Human (GRCh38)
Location 18:63155354-63155376
Sequence GTACAGCAAGTCAACAGTAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 71}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159022522 Original CRISPR GTACAGCAAGTCAACAGTAT CGG Intronic
924496568 1:244596021-244596043 GACCAGCTAGTCAACTGTATTGG + Intronic
1063532125 10:6843605-6843627 GGGCAGCTTGTCAACAGTATAGG + Intergenic
1063944334 10:11162369-11162391 GTACAGCAAGTGGACATCATTGG + Intronic
1065000095 10:21330680-21330702 GTACAGAAAGTCTACAGGTTTGG + Intergenic
1065899197 10:30189743-30189765 TTACAAGAAGTCAAAAGTATAGG + Intergenic
1066200329 10:33137851-33137873 GTCCTGGAAGTCCACAGTATGGG + Intergenic
1068007159 10:51405270-51405292 GTACAGCCAGTCCCCAGTTTAGG - Intronic
1071313327 10:84365068-84365090 GTATAGCAAATTTACAGTATTGG - Intronic
1072601395 10:96934247-96934269 GTCCATTAAGTAAACAGTATAGG + Intronic
1073704586 10:105968730-105968752 GTCCAGCCAGAGAACAGTATTGG + Intergenic
1075388472 10:122075094-122075116 GATAAGAAAGTCAACAGTATAGG + Intronic
1080320405 11:31002553-31002575 GTAGAGAAAATCAACAGTTTAGG + Intronic
1082783593 11:57304387-57304409 GTACAGCAAGGCAGCAGAATTGG + Intronic
1086191724 11:84087369-84087391 GAACAGCAAATCAAAAGTACAGG - Intronic
1087327701 11:96743594-96743616 GCACAGAAAGTCAAGAGTACAGG - Intergenic
1088922158 11:114267996-114268018 CTACAACAAGTTAACAGCATGGG - Intronic
1089003746 11:115073717-115073739 GTTCAGCATGGCTACAGTATAGG + Intergenic
1093274134 12:17102978-17103000 GTACAGAAAATAAATAGTATAGG + Intergenic
1095106969 12:38245731-38245753 GTACAGCAAGTGGACAGAACTGG - Intergenic
1100054992 12:90498139-90498161 GTACACAAAGTCAACAGTGCAGG - Intergenic
1103190556 12:118998036-118998058 GTTCAGCAAGTCAGTAGAATGGG + Intronic
1105347484 13:19587418-19587440 GTACAAGAAGTCAAGAGGATGGG - Intergenic
1107479861 13:40777199-40777221 GTACAAGAAGTCAAGAGGATGGG - Intergenic
1108303960 13:49112118-49112140 TTACATCAAGTCATCAGAATAGG - Intronic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1114881712 14:26794620-26794642 ATACAGCTGATCAACAGTATAGG + Intergenic
1117147513 14:52849938-52849960 GAACATGAAGACAACAGTATAGG - Intergenic
1118787445 14:69057849-69057871 GTACAGCACTTCAGCAGTAAGGG + Intronic
1119431152 14:74568837-74568859 GTACAGAAGGCCAACAGTCTGGG + Intronic
1121330301 14:93045425-93045447 CTACAGCAAATCACCAGGATGGG + Intronic
1127685505 15:61339514-61339536 GGTCAGCAAACCAACAGTATCGG - Intergenic
1129743390 15:78001158-78001180 GGGCAGCAAGGAAACAGTATGGG - Intronic
1138498905 16:57426330-57426352 GTTCAGCAAGCTCACAGTATTGG - Intergenic
1146984461 17:37201523-37201545 TTGAAGCAAGTGAACAGTATAGG - Intronic
1149122603 17:53187959-53187981 ATAAAGCAAGTCAACAGCAAAGG - Intergenic
1149306990 17:55357659-55357681 GCACAGCAAGTCAAGAATACTGG + Intergenic
1151585927 17:75008442-75008464 GTACATCAACTGAACAGCATGGG + Intergenic
1157035837 18:43972179-43972201 GTGCAGCAAGTCATCAGTGGTGG - Intergenic
1157408603 18:47445027-47445049 GCACAGCAAGCCAACAGGGTTGG - Intergenic
1159022522 18:63155354-63155376 GTACAGCAAGTCAACAGTATCGG + Intronic
1161519462 19:4715664-4715686 GGACAGCAAGCCAACAGCACAGG - Intronic
1163110028 19:15154280-15154302 GTACAGCAGGACAGGAGTATTGG - Intergenic
925029509 2:638349-638371 GTATATAAAGTCAACAGTAGTGG - Intergenic
926865487 2:17352815-17352837 ATACAGCCAGTTAACAGTTTAGG - Intergenic
927370490 2:22349059-22349081 GTACAGCCAGTATACAGTAATGG - Intergenic
935656755 2:105429843-105429865 GCAAAGCAAGTCAAGAGTATGGG + Intronic
946761127 2:222994218-222994240 GTGCTGAAAGTCAACAGAATGGG - Intergenic
1170062025 20:12269226-12269248 GTACAGCAGGTCACCACTTTGGG - Intergenic
1174777288 20:53356182-53356204 GAATAGTAAGTCAACAGTATTGG - Intronic
1181981035 22:26766645-26766667 GTTCAGAAAGTCAACAGACTTGG - Intergenic
950321183 3:12054990-12055012 AGACAGAAAGTGAACAGTATAGG + Intronic
956827982 3:73016777-73016799 GTAAAGCCAGTTAACAGAATGGG - Intronic
958443616 3:94187460-94187482 GTACAGGATGTCAACATTAGGGG - Intergenic
962812203 3:138969104-138969126 GTACAGCAAGTCAGGAGCAGAGG + Intergenic
963167080 3:142215727-142215749 TTAGATCAAGTCAATAGTATGGG + Intronic
964594560 3:158409350-158409372 GTCCAGCAAGTCACAAATATAGG + Intronic
972004998 4:34090590-34090612 GTAGAGTAACTCAACAGCATAGG - Intergenic
981574673 4:146192394-146192416 GAACAGCAAGGCCACAGCATGGG - Intronic
990846149 5:60142018-60142040 GTACAGCAAGTCATGAATTTTGG + Intronic
991291983 5:65042139-65042161 GGACAGCAAGTCAACAGGTTAGG - Intergenic
992910481 5:81391886-81391908 GTTGAGCAAGTCAAAAGTCTAGG - Intronic
1003390978 6:5712500-5712522 GAACAGCAGGTGAACAGTAGGGG - Intronic
1008863577 6:56181611-56181633 GTAAAGTTAGTCAACAGCATGGG + Intronic
1013393990 6:109715599-109715621 GTATAGCAAATCATCAGTAAAGG - Intronic
1015554054 6:134442598-134442620 GGAATTCAAGTCAACAGTATTGG - Intergenic
1031303711 7:120097550-120097572 CTAGGGCAAGTCAACATTATTGG + Intergenic
1034569679 7:151945147-151945169 TTAGAGCAAGACAACAGAATTGG - Intergenic
1038280832 8:26162854-26162876 GTCCAGCAAATCCACACTATAGG + Intergenic
1046334983 8:112773536-112773558 GTACAGCAAGACAACAGTGAAGG + Intronic
1050124720 9:2344752-2344774 GCACAGAAAGTCTACAGGATGGG + Intergenic
1055995112 9:82148987-82149009 GAACAGAAAGTCCACAGTTTGGG - Intergenic
1059971846 9:119676283-119676305 GGACAGAAAGTAAACAATATAGG + Intergenic
1060235775 9:121861715-121861737 TGACAGCATGTCAACAGTACAGG + Intronic
1062406252 9:136398006-136398028 GTACAGAAAGACACCAGTGTTGG + Intronic
1192310778 X:70012542-70012564 GTACATCATTTCAGCAGTATAGG - Intronic
1195702365 X:107715157-107715179 GTACAGCAGACAAACAGTATGGG - Intronic
1201903790 Y:19069133-19069155 GGACAGCAAGGGAACATTATTGG + Intergenic