ID: 1159026312

View in Genome Browser
Species Human (GRCh38)
Location 18:63184937-63184959
Sequence CAAGATGCCCACTGCTTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159026312 Original CRISPR CAAGATGCCCACTGCTTCTG GGG (reversed) Intronic
900790410 1:4676136-4676158 CATGATGCCCACTGCTGCAGAGG + Intronic
902321323 1:15669176-15669198 TGAGAGGCCCACTTCTTCTGGGG - Intergenic
905154321 1:35961872-35961894 CAACTTACCCACTGCTGCTGTGG - Intronic
906129348 1:43446845-43446867 CAAGATTTCCCCTGCTGCTGTGG - Intronic
907534929 1:55143303-55143325 GAATTTGCCCAGTGCTTCTGTGG - Intronic
908521231 1:64944959-64944981 CAAGGTGCCAAGTGCTTCTCGGG - Intronic
909576091 1:77177934-77177956 AAAGATGCCATCTTCTTCTGGGG - Intronic
910232764 1:85003347-85003369 CCAGCTTGCCACTGCTTCTGTGG - Intronic
910312961 1:85847977-85847999 CCAGATGCCCCCTGCTTGTTTGG - Intronic
916959606 1:169875796-169875818 CATGACCCCCACTGCCTCTGAGG + Intronic
918683111 1:187379757-187379779 CACGATGCCCAGTGCTTCTGAGG - Intergenic
920510639 1:206549412-206549434 CAGGCAGCCCACTGCTTCTAGGG - Intronic
920510964 1:206551744-206551766 CAGGAAGCCCACTGCTTCTAGGG - Intronic
921918462 1:220640678-220640700 CAAGATGCCAACTTCTGGTGAGG + Intronic
921922811 1:220687853-220687875 CATGATGGCTTCTGCTTCTGGGG + Intergenic
922166594 1:223120656-223120678 CATGATGGCCAGTGCCTCTGTGG + Intronic
923124975 1:231027017-231027039 CAGGGTGCCCACTGCTACTTAGG - Intronic
1064998466 10:21316417-21316439 AAAGTTCCCCAGTGCTTCTGGGG - Intergenic
1070815010 10:79317425-79317447 CTAGAAGCCCCCTGCTCCTGGGG + Intergenic
1071396131 10:85225872-85225894 CAAAATGGCATCTGCTTCTGAGG + Intergenic
1072862300 10:99019332-99019354 CAAGATGTCCTCTGCATCAGAGG + Intronic
1076032908 10:127174641-127174663 CACAATGCCCATTGCTTCTTTGG + Intronic
1078484141 11:11706188-11706210 GAAGAAGCCCACAGCTTCTCTGG + Intergenic
1079353168 11:19710385-19710407 CAAGATCCCCAGTGATTCTTAGG + Intronic
1081978299 11:47249625-47249647 CAAGAGGGCCATTGATTCTGTGG - Intronic
1084607318 11:70180020-70180042 CAAGCTTCCCAATGCCTCTGAGG - Exonic
1085470869 11:76756908-76756930 CAAGATGCAGGTTGCTTCTGGGG + Intergenic
1085471853 11:76763564-76763586 CAAGATGCTTACTGCTTCAAAGG + Intergenic
1088939030 11:114435205-114435227 CATGATGGCATCTGCTTCTGGGG + Intronic
1090008590 11:123025007-123025029 CTAGATGCTTACTGCTACTGGGG - Intergenic
1090397652 11:126429743-126429765 GAAGCTGCCCACTGCCTCAGGGG - Intronic
1090596556 11:128327008-128327030 CAGCATGCCCACGGCCTCTGGGG - Intergenic
1090891032 11:130922618-130922640 CAACATACCCACAGGTTCTGGGG + Intergenic
1092953243 12:13526894-13526916 CAGGCTGCCCACTGATCCTGTGG - Intergenic
1096317756 12:50583435-50583457 CAAGGCGCTTACTGCTTCTGTGG + Intronic
1096460281 12:51818464-51818486 CCGGCAGCCCACTGCTTCTGAGG + Intergenic
1097912871 12:64989501-64989523 TAGGATGCCAACTGCTCCTGGGG - Intergenic
1100390229 12:94141147-94141169 CTAGGTGCCCCCTGCTGCTGAGG + Intergenic
1103414945 12:120737537-120737559 CCAACTGCCCACTGCTTCGGAGG + Intronic
1104473730 12:129053094-129053116 CATGGGGCCCTCTGCTTCTGTGG - Intergenic
1106756470 13:32827345-32827367 AAAGATGCCCATTGAGTCTGTGG + Intergenic
1110015361 13:70393475-70393497 CTAGATGCCCACTGGTTCACAGG - Intergenic
1111886911 13:94032868-94032890 CAAGGTGGGCACTGCATCTGTGG + Intronic
1112137836 13:96602590-96602612 CCAGATGCCCAGAGCTGCTGAGG + Intronic
1112934987 13:104785998-104786020 CAAATTGCCCACTGCTACTCAGG - Intergenic
1113968486 13:114169204-114169226 AAGGATGCCAACTACTTCTGGGG + Intergenic
1114072722 14:19127343-19127365 CAAGGTGCCCTGTCCTTCTGTGG + Intergenic
1114089538 14:19272629-19272651 CAAGGTGCCCTGTCCTTCTGTGG - Intergenic
1115728696 14:36244709-36244731 CAACATTCTCATTGCTTCTGTGG - Intergenic
1117436130 14:55716816-55716838 CTGGATAGCCACTGCTTCTGAGG - Intergenic
1120982667 14:90304323-90304345 CAAGATATGCACTGCTTCTTAGG + Exonic
1122238575 14:100346722-100346744 TAAGAGGCCCACTGCTGCTGTGG - Intronic
1122877956 14:104677505-104677527 CAATGTTCCCACTGCCTCTGGGG + Intergenic
1125100064 15:35902277-35902299 CAAGATGCAGACTTCCTCTGGGG - Intergenic
1125429158 15:39579162-39579184 CAAGATGCATTCTGCTTTTGTGG + Intergenic
1131180861 15:90238771-90238793 AAAGATGACCACTTCTTTTGTGG - Intronic
1131387183 15:92017582-92017604 CAAAATAGCCACTGCTTCTTAGG + Intronic
1132701340 16:1223423-1223445 ACAGCTGCCCACTGCTTCTCCGG - Exonic
1134776529 16:16858439-16858461 CAAGATGCCCAAAGATTCAGTGG - Intergenic
1136593370 16:31231394-31231416 CAAGATGCATCATGCTTCTGTGG - Intergenic
1137962347 16:52895285-52895307 CAGGATGCTATCTGCTTCTGGGG - Intergenic
1139295500 16:65897023-65897045 AAGGATGCCCACAGCTTCCGGGG + Intergenic
1142265400 16:89062050-89062072 CAAGTTTCCCACTCCTTGTGGGG - Intergenic
1142331743 16:89458862-89458884 GAAGCTGCCCACTGGTCCTGTGG + Intronic
1142470650 17:161576-161598 CACCATGCCCAGTGCGTCTGAGG - Intronic
1144672637 17:17141595-17141617 CAAGAGGCCAGCTGCTTCTCAGG - Intronic
1148152368 17:45404387-45404409 GAAGCCCCCCACTGCTTCTGTGG + Intronic
1148218915 17:45849051-45849073 CCAGATGGCCACTGCTCCGGTGG - Intergenic
1153118205 18:1686877-1686899 CAAGATGCCTTCTTCTTCTGGGG + Intergenic
1153698603 18:7669167-7669189 AAAGCTCCCCACTGCTTCAGTGG - Intronic
1154296974 18:13160226-13160248 CTAGAGGACCACTGCTTCTAAGG + Intergenic
1159026312 18:63184937-63184959 CAAGATGCCCACTGCTTCTGGGG - Intronic
1159212851 18:65349476-65349498 CAAGATTCCCACAGCGTCAGTGG - Intergenic
1160514980 18:79473188-79473210 CCAGCTGCCGAGTGCTTCTGGGG + Intronic
1161620935 19:5296751-5296773 CAAGATGCGCACGGCCTCAGAGG + Intronic
1163184754 19:15629546-15629568 CAAGATACTCACTGCCTCTCTGG + Exonic
1164483958 19:28638713-28638735 CAAGATGCACAGGACTTCTGAGG + Intergenic
1164605939 19:29598155-29598177 CCAGAGGCTCACGGCTTCTGGGG + Intergenic
1166157854 19:40928206-40928228 TAAGATGCCAACTGCTTCTTGGG + Intergenic
1166166718 19:40995228-40995250 TAAGATGCCAACTGCTTCTGGGG + Intronic
1167817849 19:51899767-51899789 CATGATGTGCACTGATTCTGAGG - Intronic
1168186587 19:54704219-54704241 CTAGATGACCACTGTTACTGGGG + Intergenic
926725455 2:15993995-15994017 CATGGTGCCCACGTCTTCTGTGG + Intergenic
927882324 2:26697525-26697547 CAGGAAGCCCCCTGCTTCTGGGG - Intronic
928260201 2:29759845-29759867 CATGATGTCCACTGCTCCTAAGG + Intronic
931933693 2:67170885-67170907 GCAGAAGCCCAATGCTTCTGGGG + Intergenic
933222752 2:79709665-79709687 AAACATGCCCACAGTTTCTGAGG - Intronic
936916032 2:117639859-117639881 TAACATGCCCACTTTTTCTGAGG + Intergenic
937231397 2:120400128-120400150 CACCATGCCCACTGCCTCTCGGG + Intergenic
939011734 2:136854816-136854838 CATGGTGCCCAATGATTCTGTGG - Intronic
939986569 2:148834768-148834790 CAAGATACCCACAGTTCCTGTGG + Intergenic
940358975 2:152776893-152776915 CAAGGTTAGCACTGCTTCTGAGG + Intergenic
941166263 2:162086346-162086368 AAAAATGCCATCTGCTTCTGGGG + Intergenic
943639184 2:190340643-190340665 CATAATGCCATCTGCTTCTGGGG - Intronic
943903970 2:193474601-193474623 CAGGTTGGCCAGTGCTTCTGCGG + Intergenic
944629121 2:201605365-201605387 CATGATGCGCACTGCTTCTGGGG + Intronic
946476116 2:220008081-220008103 GAAGAGGCCCACTGCCTCTCAGG + Intergenic
946654268 2:221928697-221928719 GAAGATGCCATCTGCTACTGGGG - Intergenic
1168817008 20:744764-744786 CAAAATCGCCACTGCTTCTGAGG - Intergenic
1169946014 20:10989312-10989334 CAAGATACTCACTCCTTCTGTGG - Intergenic
1170311402 20:14996642-14996664 CAAGCAGCCCACTGCTGCTGGGG - Intronic
1171382142 20:24742156-24742178 CAAGATGCCAACAGCATCTGTGG + Intergenic
1172037683 20:32021245-32021267 CACCATGCCCACTTCCTCTGTGG + Intronic
1174351570 20:49971988-49972010 CAAGAAGCTGACTGCTTCAGAGG - Intergenic
1178373952 21:32050992-32051014 AAGGCTGCCCTCTGCTTCTGGGG - Intergenic
1180491165 22:15849718-15849740 CAAGGTGCCCTGTCCTTCTGTGG + Intergenic
1180606142 22:17060299-17060321 CACGGTGCCCACTGCTTCAATGG + Intergenic
1183301364 22:37060668-37060690 GAAGATGCCCCCAGCTTCTGTGG + Intronic
1183560856 22:38571203-38571225 CAAAATGCCAACTGCTATTGTGG - Intergenic
1183719293 22:39553014-39553036 CAAGGTGCCCACAGGTGCTGGGG + Intergenic
951327678 3:21324833-21324855 CAAGATGCCAACATCTTGTGAGG + Intergenic
953524285 3:43674944-43674966 CAAAATACCCACTGCAGCTGGGG + Intronic
958036182 3:88172819-88172841 TAAGAATGCCACTGCTTCTGGGG - Intergenic
958187723 3:90144774-90144796 CAAGAAGCTTACTGCTTCGGAGG - Intergenic
960577749 3:119244096-119244118 TAGGATGCCATCTGCTTCTGGGG + Intergenic
961657713 3:128452557-128452579 GAAGATGCCAAGTGCTTGTGAGG + Intergenic
962044369 3:131740023-131740045 CAAGAAGCCAATTGGTTCTGTGG - Intronic
962838866 3:139215436-139215458 CAGGATGAGCAGTGCTTCTGAGG + Intronic
962851460 3:139311298-139311320 CAAGATGCTCACAGATGCTGAGG + Intronic
963928252 3:150974693-150974715 CTATATGCCCAGTTCTTCTGTGG - Intergenic
964747303 3:160024420-160024442 GAAGATGCCCACTTCATATGCGG + Intronic
965047465 3:163597728-163597750 CCAGATGCCCTGTCCTTCTGTGG - Intergenic
965949837 3:174295393-174295415 CAAGATTTCTACTGCATCTGTGG + Intergenic
966294040 3:178396932-178396954 CTAGATGGTCACTGCTTTTGAGG - Intergenic
966523666 3:180899062-180899084 CTAGATGCCCCCTGCTTCATGGG + Intronic
966800459 3:183758875-183758897 CAAGATCTCCACGGCTTCTCAGG + Exonic
967770608 3:193330083-193330105 CAAGGGGCCCACTGCATGTGGGG - Intronic
969535061 4:7751521-7751543 CATGGTGGCCTCTGCTTCTGGGG + Intergenic
972370283 4:38416989-38417011 CACCATGTCCTCTGCTTCTGGGG + Intergenic
973813900 4:54600566-54600588 AAAGATGCCATCTTCTTCTGGGG + Intergenic
973843737 4:54889823-54889845 CAAGATGGCCAATACTTCTCAGG - Intergenic
979620579 4:122794585-122794607 TAGGATGCCATCTGCTTCTGGGG - Intergenic
980441530 4:132853389-132853411 GAAGATTCACACTGCTTCTTAGG + Intergenic
980624553 4:135357529-135357551 AAACATGCTCACAGCTTCTGGGG + Intergenic
981725461 4:147842730-147842752 CAAGCTGCGCAGAGCTTCTGGGG - Intronic
982095219 4:151916040-151916062 GAAGATGCCAGCTGCTTCAGGGG + Intergenic
983332727 4:166352212-166352234 AAAAATGCCCCTTGCTTCTGTGG + Intergenic
986024055 5:3833372-3833394 CACTGTGCCCTCTGCTTCTGGGG - Intergenic
988022156 5:25634526-25634548 CAAGATGCCTACATCTTTTGAGG + Intergenic
988614714 5:32764337-32764359 CCAGCTGCCCCCTGCTTCTGGGG + Intronic
989677162 5:43985407-43985429 CATGGTGGCCTCTGCTTCTGGGG + Intergenic
989980271 5:50635174-50635196 CAAGTTCCCCACTATTTCTGTGG + Intergenic
990609708 5:57444877-57444899 CAAGATGCCCTCCAGTTCTGGGG - Intergenic
991347284 5:65683357-65683379 CAATATTTACACTGCTTCTGTGG - Intronic
992724381 5:79591660-79591682 AAAGATACCAAGTGCTTCTGAGG - Intergenic
993547612 5:89231287-89231309 CAAGATGTCCACTGTCTTTGAGG - Intergenic
996575455 5:124972836-124972858 GAAGATGGCCCCTTCTTCTGGGG + Intergenic
998414843 5:141938651-141938673 CGAGATGCCCACTTCTGCAGAGG - Exonic
999302092 5:150497571-150497593 CAAAATGCTCATTGCTGCTGGGG + Intronic
1003235829 6:4294667-4294689 CAACATGCCCCCTCCTTCTGGGG + Intergenic
1003274459 6:4637373-4637395 CGCTATGCCCACAGCTTCTGTGG + Intergenic
1006855693 6:37131603-37131625 CAAGCAGCCCTCAGCTTCTGTGG - Intergenic
1007705540 6:43788531-43788553 GAGCATGCCCACTGCATCTGAGG - Intergenic
1007763350 6:44147129-44147151 CATGGTCCCCACTGCATCTGAGG + Intronic
1009038629 6:58149695-58149717 GAAGATGTGAACTGCTTCTGAGG + Intergenic
1009214515 6:60904558-60904580 GAAGATGTAAACTGCTTCTGAGG + Intergenic
1009669691 6:66730778-66730800 CATGATGGCATCTGCTTCTGAGG - Intergenic
1009848329 6:69162980-69163002 TAAGCTGCCTCCTGCTTCTGTGG - Intronic
1010033131 6:71289894-71289916 CAGGATGCACACTTCTTCAGGGG - Intronic
1010266079 6:73869378-73869400 AGATATGCCCACTGCTACTGGGG + Intergenic
1010277079 6:73981138-73981160 CATTCTACCCACTGCTTCTGTGG + Intergenic
1011486535 6:87847683-87847705 CAAGGTGCCCACTGCCTATAGGG - Intergenic
1011829820 6:91358205-91358227 CATGATGGCATCTGCTTCTGTGG + Intergenic
1014896359 6:126904789-126904811 CAAAATGTACACAGCTTCTGTGG - Intergenic
1015705876 6:136086924-136086946 CACGATGCCCACAGTTTGTGTGG - Intronic
1016255734 6:142102976-142102998 AAAGATGCCATCTGCTTCTGGGG + Intergenic
1017386395 6:153889870-153889892 TAGGATGCCATCTGCTTCTGGGG - Intergenic
1017762726 6:157583744-157583766 CAGGATGCCCACTGCAGCTCTGG + Intronic
1018316368 6:162560906-162560928 AAAGATGCCCACTGGGTATGAGG + Intronic
1019062286 6:169265163-169265185 AATGATGCTCACTGCTTGTGAGG - Intergenic
1019288150 7:234017-234039 CGTGATGCCCACATCTTCTGGGG - Intronic
1019494669 7:1332195-1332217 AATGAAGCCCACTGCTTCAGCGG - Intergenic
1021891491 7:25190137-25190159 CAAGATGCCATCTTCTTCTGGGG + Intergenic
1022180123 7:27910875-27910897 GAAAATGCCCATTGCTTCAGTGG - Intronic
1022531328 7:31068716-31068738 CAAGATGGACACTGCTTCTCAGG - Intronic
1023821540 7:43983299-43983321 CAAGGTGCCCACTGCTTTAGGGG - Intergenic
1029749802 7:102536720-102536742 CAAGGTGCCCACTGCTTTAGGGG - Intergenic
1029767752 7:102635825-102635847 CAAGGTGCCCACTGCTTTAGGGG - Intronic
1035405688 7:158595675-158595697 CAAGGTGGCCTGTGCTTCTGGGG + Intergenic
1035731517 8:1856773-1856795 CGAGGTGCCACCTGCTTCTGTGG + Intronic
1037072926 8:14674865-14674887 CATGATGGCATCTGCTTCTGGGG - Intronic
1039159747 8:34604025-34604047 TGAGATGCCCACTACTACTGTGG - Intergenic
1042025881 8:64423090-64423112 AGAGCTGCCCACTGCTGCTGTGG + Intergenic
1043578999 8:81690010-81690032 CAAGATGCCCACAATTTCTGGGG - Intergenic
1044399425 8:91753273-91753295 CAAGGAGCCCACTGGGTCTGGGG - Intergenic
1045343842 8:101276968-101276990 CAGGACGCCCTCTGCTTCTTCGG + Intergenic
1049592605 8:143469399-143469421 CCAGCTGCCCACTGCAGCTGTGG + Intronic
1052525691 9:29616088-29616110 CAACATGCACACAGTTTCTGGGG - Intergenic
1055079376 9:72253617-72253639 CATCATGCCCACTGCATCTTGGG - Intronic
1056122447 9:83502892-83502914 CAAAATGCCAACTGCCTCTCTGG + Intronic
1056674737 9:88665782-88665804 CATGATGGCATCTGCTTCTGAGG + Intergenic
1058635926 9:107038623-107038645 CAAGTTGCCCACAGCTGGTGGGG + Intergenic
1058969972 9:110072277-110072299 CAAGCTGCCCACTGTTGCTTGGG + Intronic
1059307791 9:113368261-113368283 CAAAATGCCCTCTGCTTCTTCGG - Exonic
1060203090 9:121663544-121663566 GAGGTTGCCCACTGCTGCTGGGG - Intronic
1060902614 9:127273815-127273837 CAGGATTCCCACTGCTTATAAGG - Intronic
1061311591 9:129766938-129766960 GACGATGCCCACTGCCACTGGGG + Intergenic
1062461742 9:136665302-136665324 CATGATGCCCACTGCCTGCGAGG + Intronic
1062650747 9:137575748-137575770 CAGGATGCTCACTGCTACTCTGG + Intronic
1062731959 9:138115009-138115031 CTAGATGTCCAGGGCTTCTGGGG + Intronic
1188803039 X:34555178-34555200 AAAGATGCCAGCTTCTTCTGGGG - Intergenic
1189661236 X:43302122-43302144 CATGATGGCATCTGCTTCTGCGG - Intergenic
1190816944 X:53937749-53937771 CAGCTTGCCCAATGCTTCTGGGG - Exonic
1190968862 X:55329670-55329692 CATGATGCCCAGAGCTTCAGGGG + Intergenic
1193638009 X:83976817-83976839 TAAGATGCCATCTCCTTCTGGGG + Intergenic
1195260500 X:103126877-103126899 CACGATGGCATCTGCTTCTGGGG + Intergenic
1195772050 X:108361734-108361756 TAAGATCACCACAGCTTCTGAGG + Intronic