ID: 1159026468

View in Genome Browser
Species Human (GRCh38)
Location 18:63187015-63187037
Sequence AACAGGGAAATGCTTAAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 179}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159026468_1159026473 21 Left 1159026468 18:63187015-63187037 CCAACCTTAAGCATTTCCCTGTT 0: 1
1: 0
2: 0
3: 17
4: 179
Right 1159026473 18:63187059-63187081 CAACAGTCCCTTTTAAGAACAGG 0: 1
1: 0
2: 1
3: 17
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159026468 Original CRISPR AACAGGGAAATGCTTAAGGT TGG (reversed) Intronic
901290559 1:8120908-8120930 AAAAATGAAATGCTCAAGGTAGG - Intergenic
902440575 1:16427004-16427026 AATAGGGAAATGGTTAATGATGG - Intronic
910787718 1:91018885-91018907 AACTGGAAAATGTTTAAGGTTGG + Intronic
912917718 1:113833385-113833407 TTCAGGGAAATGTTTCAGGTGGG - Intronic
913025693 1:114836986-114837008 ACAAGGGAAATGCAGAAGGTGGG + Intergenic
916705373 1:167343924-167343946 AACAGGGAAATGCTACGGGGAGG + Intronic
921398628 1:214695145-214695167 AACAGGGACCTGCTTTAGGCTGG - Intergenic
924205479 1:241707328-241707350 AAAAGGGAAATACTCAAGGTAGG - Intronic
924458048 1:244233847-244233869 AACAGGGAAAAGCTTAACTTTGG + Intergenic
1065793691 10:29285334-29285356 AATAAGGAAATGCTGAGGGTGGG - Intergenic
1067069511 10:43121567-43121589 AACATGGAAATGCTAGATGTTGG + Intronic
1068013599 10:51485350-51485372 AACAAGAAAATGTTCAAGGTAGG - Intronic
1068277010 10:54812968-54812990 ATCAGTGAAATGTTTTAGGTAGG - Intronic
1069120120 10:64559306-64559328 CAAAGGGAAAAGCATAAGGTTGG - Intergenic
1070729712 10:78818092-78818114 AATTTGGAAATGCTTAAAGTGGG + Intergenic
1071150142 10:82624413-82624435 AAAAGGAGAATGGTTAAGGTGGG - Intronic
1073450282 10:103605156-103605178 CAGAGAGAAATGCTTAAAGTTGG + Intronic
1073615348 10:104989686-104989708 ACCAGGGAAATGCTGCAGATGGG + Intronic
1074246603 10:111700020-111700042 GATAGGGAAATGCTTATGGTAGG + Intergenic
1075336564 10:121613173-121613195 AATAGGGAGATGATTAAGGTGGG - Intergenic
1076065151 10:127442549-127442571 AACAGGGAAAGGGCTTAGGTGGG + Intronic
1079576790 11:22013765-22013787 AACAGGAAAATCCTTCAGGCAGG - Intergenic
1080184485 11:29464726-29464748 AACAGGGAAATACTAAAGTCAGG - Intergenic
1080789865 11:35512695-35512717 AAAAGGAAAATGGTTAGGGTGGG + Intronic
1081156776 11:39703005-39703027 CACAGAGAAATGCTTTGGGTGGG - Intergenic
1082010843 11:47448768-47448790 TACAAGGAGATGCTGAAGGTGGG - Exonic
1083512678 11:63226625-63226647 AACAAGGAAATGCTTACCTTGGG - Intronic
1083610963 11:64004104-64004126 AGCAGGGAGATGCCTAAGATGGG - Intronic
1085840620 11:80007866-80007888 GACAGGGAAATTCCTAGGGTGGG - Intergenic
1089165436 11:116472402-116472424 AACAACAAAATGCTCAAGGTAGG - Intergenic
1090208905 11:124901632-124901654 AACTGGGCAATGTTTAAGCTAGG - Intergenic
1093039951 12:14366190-14366212 AACAGAGAAGAGCTTGAGGTCGG - Intronic
1094268234 12:28582929-28582951 AACAGAGAAAAGCTTCAAGTAGG - Intergenic
1095562553 12:43583462-43583484 AAAAGGGAAAGGCGTAGGGTAGG - Intergenic
1100764467 12:97848465-97848487 AACAGGGATATTCTTATGGGAGG + Intergenic
1103383891 12:120516602-120516624 AACAAGGAGATGCTAAAGGTTGG - Exonic
1107556118 13:41517931-41517953 AACAGCCAAATGCTTCAGGAAGG + Intergenic
1108503337 13:51087574-51087596 AATAGGGAAATGATGAAGGAAGG - Intergenic
1109332977 13:60954032-60954054 AGCAGGGAAATGGTGATGGTAGG + Intergenic
1110827382 13:79988501-79988523 AACAGGGGAATTCTTAAGGAAGG - Intergenic
1110927357 13:81171048-81171070 TAAAGGGAAATGCTTTAAGTAGG - Intergenic
1111106901 13:83657224-83657246 AAGAGGGAAATGAATGAGGTAGG + Intergenic
1113549532 13:111181814-111181836 AACAGGAAAGAGCTTCAGGTAGG + Intronic
1115551714 14:34511031-34511053 AGGAGGGAATTGCTTGAGGTAGG - Intergenic
1116367067 14:44080469-44080491 TATAAGGAAATGCTTAAAGTAGG + Intergenic
1116661252 14:47713066-47713088 AACAGTGTAATTTTTAAGGTGGG + Intergenic
1120568137 14:86084724-86084746 AACTGGGAAATAGTTAAGGGAGG - Intergenic
1122468367 14:101949445-101949467 TACAGGGAAAAGCTAAAGATGGG + Intergenic
1125083467 15:35702544-35702566 AACATGTATTTGCTTAAGGTGGG + Intergenic
1127357502 15:58214629-58214651 AACCGAGAAATCCTCAAGGTTGG - Intronic
1127372184 15:58351812-58351834 GCCAGGGAAATGCTTATGATAGG - Intronic
1127694358 15:61429862-61429884 AACAGGGAAAAGTTTAAGTCAGG - Intergenic
1130111719 15:80970890-80970912 AACAGGATTATGCTGAAGGTAGG + Intronic
1131825002 15:96313521-96313543 AATAGGGAAATGGTTATGATAGG + Intergenic
1132824106 16:1894472-1894494 AACAAGGAATTGTTTAAGGAAGG + Intergenic
1134428060 16:14171941-14171963 AACATGGACATGCTGAAGGAAGG - Intronic
1139397325 16:66650570-66650592 ACCAGGGATATAGTTAAGGTGGG - Intronic
1140464677 16:75171457-75171479 CAAAGGGAAATGTTTTAGGTTGG - Exonic
1141015984 16:80449850-80449872 AAGAAGTGAATGCTTAAGGTTGG + Intergenic
1141120992 16:81356069-81356091 GCAAGGGAGATGCTTAAGGTTGG + Intronic
1143684294 17:8501619-8501641 ACCAGGAAATGGCTTAAGGTTGG + Intronic
1149229911 17:54520821-54520843 AAGGGGGAAATCATTAAGGTTGG - Intergenic
1152161843 17:78673695-78673717 AACAGGGAAAAGTCTCAGGTGGG - Intergenic
1154427613 18:14284212-14284234 TAATGGGAAATGCTAAAGGTGGG + Intergenic
1155600622 18:27542443-27542465 TACAGTGAAATGCTTAAGTAAGG - Intergenic
1158181049 18:54715207-54715229 TACAGAGAAATGCTTAATGGTGG + Intergenic
1159026468 18:63187015-63187037 AACAGGGAAATGCTTAAGGTTGG - Intronic
1161105923 19:2444005-2444027 CACAGGGAAATGCCTACGATGGG + Intronic
1161947368 19:7446066-7446088 AACAGAGAAATGCTTCAGTTTGG - Intronic
1164949655 19:32326516-32326538 AACAGAGAAATGGTCAAGGGGGG - Intergenic
1165355897 19:35303858-35303880 CAGAGGGAATTGCTTAAGGAAGG - Intronic
927880901 2:26689409-26689431 AACTGGGAAATGCTTCATGGAGG + Intergenic
929251244 2:39757884-39757906 AAGAGGGAAATGGATCAGGTTGG + Intronic
930260691 2:49142695-49142717 AACAAGGAAATGGAAAAGGTAGG + Intronic
931127310 2:59292457-59292479 AACAGAGAAATGCTTTTTGTAGG - Intergenic
933056277 2:77671268-77671290 AAGAGGGAAATTTTTAAGTTTGG - Intergenic
933221622 2:79696466-79696488 AGCAGGAAAATGTTTACGGTTGG + Intronic
933927831 2:87115583-87115605 AAGAGGGAAATTTTTAAGTTTGG - Intergenic
936619785 2:114083347-114083369 AACAGTGAAATGATTAAAGTTGG - Intergenic
939508823 2:143081649-143081671 AACAGAGAAATGCTGTAAGTAGG - Intergenic
939599042 2:144165600-144165622 AACAGGGAATGTCTGAAGGTTGG - Intronic
939625046 2:144466717-144466739 ACCAGGGCAGTGCTGAAGGTAGG + Intronic
942498284 2:176562214-176562236 AAATGGAAAATGCTTAGGGTTGG + Intergenic
942505937 2:176641804-176641826 AAAATGGAAATGATTAAGGCTGG + Intergenic
942893507 2:181020731-181020753 AAAAGGTAAATGGTTAAAGTGGG + Intronic
942932533 2:181513007-181513029 AACAGTGAAATGCTTCAGAGTGG - Intronic
943029607 2:182670265-182670287 AACAGTTAAATGGTTTAGGTGGG - Intergenic
943121297 2:183739418-183739440 ACCAGGGAAAAGCTTCAGATTGG - Intergenic
943139105 2:183956448-183956470 AACAGAGAAAGCCTTAGGGTAGG - Intergenic
945064456 2:205936997-205937019 AACATTGAAATGCTAGAGGTTGG - Intergenic
946299359 2:218813137-218813159 AATAGGGAACTGGTTCAGGTTGG - Intronic
1170263284 20:14436505-14436527 TACAGGGTGATGGTTAAGGTGGG - Intronic
1173314596 20:41931844-41931866 AACTGGGAAATGGCAAAGGTTGG + Intergenic
1174184860 20:48699223-48699245 TACAGGAAAATGCTGAAAGTAGG + Intronic
1175231077 20:57473674-57473696 AACAGGGCAATTCTCAAGTTTGG - Intergenic
1178438389 21:32579267-32579289 AACAGGGTGATCCTTCAGGTGGG + Intronic
1181014434 22:20061103-20061125 AACAGGGACATGATTGTGGTGGG + Intronic
1181892800 22:26078845-26078867 AACAGGCATATGCTTGAGGGAGG - Intergenic
1182234911 22:28867501-28867523 AAGAGGGACCTGCTGAAGGTGGG + Intergenic
1182725780 22:32444190-32444212 AACAGGGGAATGATCAAGTTTGG + Intronic
951064903 3:18252502-18252524 AGCAGGGAAATGTTAAATGTGGG - Intronic
951135664 3:19102183-19102205 TACAGAGAAATGCTTAAAGGAGG - Intergenic
951702281 3:25508521-25508543 AACAGGGAAATTCATATTGTAGG + Intronic
952871094 3:37902145-37902167 GCCAGGGAAAAGCTTTAGGTGGG + Intronic
953479203 3:43234983-43235005 AGCAGGGAAATACTTTAGGGTGG - Intergenic
953582739 3:44171992-44172014 GACAGGGAAAGGCTGAAGGCTGG + Intergenic
954590692 3:51779011-51779033 AACAGGGAGATGCTCAATGGGGG + Intronic
957634936 3:82770270-82770292 AACAGCCAAATGCTGAAGGAAGG - Intergenic
958598340 3:96260077-96260099 AACAGGGAAAAGCTGGATGTTGG - Intergenic
960909324 3:122633184-122633206 GACAGTGAGCTGCTTAAGGTAGG + Intronic
962298706 3:134217433-134217455 GAAAGGGATTTGCTTAAGGTAGG - Intronic
962835612 3:139185848-139185870 AACAGGGAAATGATGCAGGGAGG + Intronic
963291342 3:143492921-143492943 AACAGGGAAAGACTGAAGGTAGG + Intronic
965294134 3:166921486-166921508 AACAGGGAAAGGATTAACGTGGG - Intergenic
969217320 4:5732712-5732734 GACATGAAAATGCTTGAGGTTGG + Intronic
973393123 4:49572887-49572909 TAATGGGAAATGCTAAAGGTGGG + Intergenic
976797864 4:88954949-88954971 AAGAGGGAAATGCTGGTGGTGGG - Intronic
977989587 4:103424836-103424858 AAAAGGGAACTCTTTAAGGTGGG + Intergenic
980799032 4:137724424-137724446 CAAAGGAAAATGCTTAATGTGGG + Intergenic
981241759 4:142485305-142485327 AAAAGCTAAATACTTAAGGTTGG - Intronic
981381247 4:144074283-144074305 AGCAGGGGTAAGCTTAAGGTAGG - Intergenic
981624690 4:146742302-146742324 CACAGAGAAATGCTTGTGGTTGG - Intronic
981726128 4:147849333-147849355 AACAGGAAAGGGCTTAAGTTTGG + Intronic
981829301 4:148981726-148981748 TACAAGGAAATGCTTCACGTTGG - Intergenic
982916909 4:161223255-161223277 AACAGGGATATACATACGGTGGG + Intergenic
983231187 4:165130493-165130515 AACAGGGAAGTGTTGAAGCTGGG + Intronic
985766665 5:1783627-1783649 AGCAGGGAGATGTTTAAGGAAGG + Intergenic
985824841 5:2184576-2184598 AACAGGGCAAAGGTGAAGGTGGG - Intergenic
986312762 5:6566895-6566917 AACATGGACATGCTGAAGCTTGG - Intergenic
986524181 5:8655173-8655195 AACAGGGAGATGATTGAGGCTGG - Intergenic
986710251 5:10483485-10483507 AACAGGGAAATGCCTGGGGCTGG - Intergenic
987192284 5:15490599-15490621 AAGAGGAAAATGCTTCAGGAAGG - Intergenic
988090702 5:26537384-26537406 ACAAGGGAAATGCTGAAGGCTGG + Intergenic
989756097 5:44956704-44956726 AAGAGGGAAATGTTTCAGTTAGG - Intergenic
991419741 5:66428794-66428816 AACAGGGGACTGCTTCAGGATGG - Intergenic
992493291 5:77267048-77267070 CACAGGGAAATGCATCATGTGGG - Intronic
993340416 5:86718521-86718543 GACAGGAAAATGCTCAAAGTTGG + Intergenic
993383512 5:87235179-87235201 AAAATGGAAATGATTTAGGTTGG - Intergenic
993703176 5:91142555-91142577 AACAGGAAAGTGATTAAGCTGGG - Intronic
994791025 5:104225166-104225188 AACAACGTAATGCCTAAGGTTGG + Intergenic
998358805 5:141566214-141566236 AACGGGGGAATGGTTGAGGTAGG + Intronic
1001187327 5:169586998-169587020 AAGAGGGGAATCCTTAAGGCAGG - Intronic
1001192948 5:169647474-169647496 GACAGGGAAATGGATGAGGTGGG - Intronic
1004815738 6:19310198-19310220 AACAGGGCAATAATTATGGTTGG - Intergenic
1008639427 6:53446266-53446288 AATAAGGAAATACTTGAGGTTGG + Intergenic
1008939111 6:57026542-57026564 AACAGTGAAATAATTAATGTTGG + Exonic
1010556449 6:77285363-77285385 TACAGGGAAATGTTTAAATTAGG - Intergenic
1010847708 6:80730967-80730989 AACATAGAAATGCTTAAGTTAGG - Intergenic
1011657105 6:89561937-89561959 AATAGGGCAATGCTTTAGGACGG + Intronic
1012791742 6:103707538-103707560 ACCAGGATAATTCTTAAGGTGGG + Intergenic
1013067690 6:106699476-106699498 GACAGTGAAATGGTTAAGTTAGG + Intergenic
1016520701 6:144943598-144943620 AACATAAAAATGTTTAAGGTGGG + Intergenic
1020039133 7:4987946-4987968 AACAGGGAGAAGCTGAAGGTAGG + Intronic
1020156162 7:5726516-5726538 AACAGAGAGAAGCTGAAGGTAGG - Intronic
1021396384 7:20153861-20153883 AACAGGTAAATTTTGAAGGTGGG - Intronic
1023587308 7:41744048-41744070 ACAAGGGAAATGCTTAAAGGAGG - Intergenic
1024678673 7:51661137-51661159 AACAGGGCAATGCCCATGGTGGG + Intergenic
1024744810 7:52393887-52393909 AACAGGGAATTGCTTTAGATTGG - Intergenic
1026459879 7:70604571-70604593 AACAGCCAAATCCTTAAAGTAGG - Intronic
1026794116 7:73354849-73354871 TACAGGGAAGTGCTTGAGGCTGG + Intronic
1027163385 7:75818155-75818177 TACAGGGAAATTGTTAAGGCAGG + Intronic
1027424718 7:78051018-78051040 AACAGGTCAATGCTCCAGGTGGG - Intronic
1028166413 7:87542641-87542663 AAAAAGGAAATGGTTAAGTTAGG - Intronic
1028326584 7:89534332-89534354 TACAGGGAAATGCTTAAAAGTGG + Intergenic
1028827625 7:95291532-95291554 AACATGGAAATCCTTAATGCTGG - Intronic
1029907867 7:104110133-104110155 AAGAGGGTTATGCTTAGGGTAGG - Intergenic
1030217784 7:107063711-107063733 ATCAGGGATGTGATTAAGGTTGG - Intronic
1033310887 7:140260902-140260924 AACAGGGAAATCCTGAATGTGGG + Intergenic
1033381006 7:140818971-140818993 AAAAGGGAAATACTGAAGATAGG - Intronic
1034632312 7:152540151-152540173 AAAATGGAAATGGTTAAGTTAGG + Intergenic
1035963398 8:4162869-4162891 AACAGGGAAATTTTTAGGGCGGG - Intronic
1036759988 8:11501983-11502005 AACAGGCAAATGCTACAGGTCGG - Intronic
1037299586 8:17436905-17436927 AACAGAGAAATTCATCAGGTTGG - Intergenic
1038708664 8:29920852-29920874 GGCAGGGCAATCCTTAAGGTAGG - Intergenic
1039635483 8:39159960-39159982 AACAGGACAATGCTTGAGGGGGG - Intronic
1044579380 8:93809272-93809294 AAAAGGGAAGGTCTTAAGGTGGG - Intronic
1045064508 8:98433816-98433838 ATCAGGAAAATGCTTGAGCTAGG + Intronic
1047268858 8:123335339-123335361 TACAGGGAAATGCCTAGGGAAGG + Intronic
1048449705 8:134522758-134522780 ACTAGGGAAATACTTGAGGTTGG - Intronic
1049952292 9:656771-656793 AAAAGGGAAAAGCTTAAGTGAGG + Intronic
1050782698 9:9357883-9357905 AACAGAGAAATGGTTGTGGTAGG - Intronic
1051974883 9:22937557-22937579 AACAGTGAAATGCTGAAGTCTGG - Intergenic
1058040773 9:100299288-100299310 AACTGGTTAATGCTTAATGTGGG - Intronic
1059026178 9:110633763-110633785 AAAAGGGAAATACAAAAGGTTGG - Intergenic
1061300075 9:129699062-129699084 CACAGGGAAATGCTTCAGCCTGG - Intronic
1185625448 X:1478179-1478201 TACAGAGAAATGCTTAGGATTGG - Intronic
1186460761 X:9746786-9746808 AGCTGCGAAATGCTTAATGTAGG + Intronic
1186809549 X:13174761-13174783 AACAGAAAACTGCTTAAGATAGG - Intergenic
1187499932 X:19831430-19831452 GAAAAGAAAATGCTTAAGGTAGG + Intronic
1189499768 X:41545635-41545657 TACATGGAAATGCACAAGGTCGG - Intronic
1191143215 X:57136996-57137018 AACAGGGAAGTGGTTAGGATAGG - Exonic
1191895308 X:65986481-65986503 GAAAGGGAAAAGTTTAAGGTTGG - Intergenic
1191975977 X:66871796-66871818 CACAGAGAAATGCTAAATGTTGG - Intergenic
1195541994 X:106073016-106073038 AATATGCAAATGCTTATGGTGGG - Intergenic
1195625953 X:107005996-107006018 AGCAGGGAAATGCTTCAGCAGGG + Intergenic
1200769147 Y:7107600-7107622 AGCTGTGAAATGCTTAAGGTAGG + Intergenic
1202047060 Y:20745827-20745849 AGCTGGGAAATGCTTCATGTAGG + Intergenic