ID: 1159027388

View in Genome Browser
Species Human (GRCh38)
Location 18:63196671-63196693
Sequence CCGTGCGGCCCTTTATCATA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 19
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159027388 Original CRISPR CCGTGCGGCCCTTTATCATA CGG Intronic
923078273 1:230629517-230629539 CCATGTGGCCCTTTGTGATATGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1122588110 14:102825347-102825369 CCTTGCTGCCCTTAATCAGATGG + Intronic
1143114639 17:4575754-4575776 CCGTGCGGCCCGGTATCAGGTGG + Intergenic
1157719936 18:49915942-49915964 CTGTGAGGCCCTTTTTCATATGG - Intronic
1159027388 18:63196671-63196693 CCGTGCGGCCCTTTATCATACGG + Intronic
1165807020 19:38586611-38586633 ACGTGGAGCCCTTTAACATAAGG + Intronic
1166147036 19:40845014-40845036 CCATTCGGCCTTTTGTCATAGGG - Intronic
960280622 3:115777744-115777766 AGGTGTGACCCTTTATCATAAGG + Intergenic
974696520 4:65382099-65382121 CTGTGCGGCCATTCATCTTAAGG + Intronic
978184188 4:105837443-105837465 CCATGTGGCCCTTCATCACATGG + Intronic
996406714 5:123112329-123112351 CAGTGCAGTCCTATATCATATGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1006589727 6:35145651-35145673 ACGTGCGGTTCTGTATCATAAGG - Intronic
1018587814 6:165382260-165382282 CCTTCCAGCCCTTAATCATAAGG + Intronic
1019158921 6:170056758-170056780 CTGTGTGGAACTTTATCATAAGG + Intergenic
1041461313 8:58114907-58114929 CCTTGCTGCCCTTCATCAGAGGG - Intronic
1045729014 8:105212582-105212604 CTGTGTAGCCCTTAATCATAGGG + Intronic
1199663405 X:150076744-150076766 CCCTGTGCCCCTTTATAATAGGG + Intergenic