ID: 1159028106

View in Genome Browser
Species Human (GRCh38)
Location 18:63205200-63205222
Sequence AGGCTGTTGTTGATGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 268
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 247}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159028106_1159028108 -10 Left 1159028106 18:63205200-63205222 CCATCCTTCATCAACAACAGCCT 0: 1
1: 0
2: 2
3: 18
4: 247
Right 1159028108 18:63205213-63205235 ACAACAGCCTTCCTTTGAACCGG 0: 1
1: 0
2: 0
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159028106 Original CRISPR AGGCTGTTGTTGATGAAGGA TGG (reversed) Intronic
901218477 1:7568177-7568199 ATGGTGATGTTGATGATGGATGG - Intronic
901218484 1:7568228-7568250 ACGGTGATGTTGATGATGGATGG - Intronic
901218504 1:7568394-7568416 ATGGTGATGTTGATGATGGATGG - Intronic
901218552 1:7568792-7568814 ATGGTGATGTTGATGATGGATGG - Intronic
901218563 1:7568901-7568923 ATGGTGATGTTGATGATGGATGG - Intronic
901483918 1:9544850-9544872 AGGCTGTTGTTGAAGACAGTTGG + Intronic
905395822 1:37665720-37665742 AGGCTGTTTTAGATGGAGGTAGG + Intergenic
905473283 1:38208526-38208548 GGGCTGGTGGTGATGATGGAAGG + Intergenic
906696739 1:47828291-47828313 AGCCTGTTTGTGAGGAAGGAGGG - Intronic
907372655 1:54013413-54013435 AGGCTGATGTTTCTGAAGGATGG - Intronic
907589073 1:55648450-55648472 AGGCTATTGATGATGAAAAATGG + Intergenic
907617485 1:55939118-55939140 AGGATGTTCTGGATAAAGGAGGG + Intergenic
907627757 1:56047501-56047523 AGGTGGTAGTTGATGAAGGTTGG + Intergenic
907632949 1:56102462-56102484 AGGGTGTGGTTGCTGAAGGTTGG + Intergenic
913519842 1:119634339-119634361 TTGGTGTTGTTGATGAAGAATGG + Intronic
914450767 1:147789472-147789494 ATGTTGATGTTGATGAAGAAGGG + Intergenic
916223601 1:162467062-162467084 TGGCTGTTCTTGCTGCAGGATGG + Intergenic
917297105 1:173531675-173531697 AGACAGTTGTAGATGAAGAAAGG - Intronic
919454857 1:197809130-197809152 AGGGTGTTGTTGATGAAATTTGG + Intergenic
921500530 1:215897280-215897302 AGGCTGTGGCTGATGCAGAAAGG + Intronic
923798972 1:237188114-237188136 ATGCTGTTTTAGGTGAAGGAAGG + Intronic
1065880858 10:30036710-30036732 AGGATTTTGTTCATGGAGGAGGG - Intronic
1067943653 10:50677217-50677239 GGGCTGATGTTGAGGAGGGAGGG + Intergenic
1068560180 10:58505590-58505612 TGGCTCTGGTTGAAGAAGGATGG - Intergenic
1069712518 10:70499245-70499267 AGCCTGGTATTGAAGAAGGAAGG - Intronic
1070430203 10:76330305-76330327 ATGCTTATGTTGATGAAGAATGG + Intronic
1070865138 10:79704084-79704106 GGGCTGATGTTGAGGAGGGAGGG + Intronic
1070878929 10:79842215-79842237 GGGCTGATGTTGAGGAGGGAGGG + Intronic
1071097918 10:82000652-82000674 AGGCTACTGTATATGAAGGAAGG - Intronic
1071632034 10:87226305-87226327 GGGCTGATGTTGAGGAGGGAGGG + Intronic
1071645487 10:87358524-87358546 GGGCTGATGTTGAGGAGGGAGGG + Intronic
1072912440 10:99515533-99515555 AGGTGGTTGTTGCTGAAGGCTGG + Intergenic
1073529685 10:104219637-104219659 AGGGTGTTGCTGATGAATGCAGG - Intronic
1074422972 10:113325600-113325622 AGGCTGTTGGTGTTGAGGAATGG + Intergenic
1074691660 10:116011076-116011098 AGGTAGTAGTTGCTGAAGGATGG - Intergenic
1078577356 11:12513553-12513575 AGGCTGTTCATGCTGATGGAGGG - Intronic
1078672877 11:13380564-13380586 AGGCAGTGGTTGATGAAAAATGG - Intronic
1080942329 11:36933447-36933469 AGGCTGATGTGGAGGAGGGATGG + Intergenic
1081816244 11:45944708-45944730 AGGCTGATGTTTATGAAGAGTGG - Intronic
1083039832 11:59675163-59675185 AGGCAGTGGTTGCTGAAGGTTGG + Intergenic
1083873028 11:65502592-65502614 GGGCTTTTGTTGATGAGGGAGGG + Intergenic
1084022439 11:66425764-66425786 TGGCTGTAGTTTAGGAAGGATGG - Intronic
1084870031 11:72092219-72092241 AGGCAGTTGGAGATGAAGGTCGG - Intronic
1085410108 11:76285766-76285788 AGGCTGTTGGGGATGGCGGAAGG + Intergenic
1085869479 11:80332491-80332513 AGGGTGTTTTTGATGAAGGAAGG + Intergenic
1086543878 11:87945530-87945552 GTGCTGTGGTTGATTAAGGAAGG + Intergenic
1087572656 11:99949443-99949465 AGACTGTTGTTGGTTAAGGCAGG + Intronic
1088747270 11:112814594-112814616 GGGTTTTTATTGATGAAGGAGGG - Intergenic
1088810613 11:113389095-113389117 AGGCAGATGTTGAGGGAGGAAGG - Intronic
1088971402 11:114777669-114777691 ACACAGTTGTTGAAGAAGGAAGG - Intergenic
1090516471 11:127433483-127433505 AGGCAGGGGTTGATGAAGAAAGG - Intergenic
1092301879 12:7258690-7258712 AGTCAGTTGGTGTTGAAGGATGG - Intergenic
1096997799 12:55849866-55849888 AGGCTGTCCTTGATGACGAAGGG + Intergenic
1098110285 12:67114312-67114334 AGCATGTTGTTTATGAATGATGG + Intergenic
1098496220 12:71138549-71138571 AGGTTGTGTTTGATGAAGAAAGG - Intronic
1098890420 12:76004972-76004994 AGACTGTTGTCCATGAAGGCAGG + Intergenic
1100858883 12:98783849-98783871 TGGTGGTTGTTTATGAAGGAGGG + Intronic
1101722776 12:107364812-107364834 AAGCTATTGTTGCTGAAGGCTGG + Intronic
1101856373 12:108446765-108446787 CGGCTGTTGTTATTGAAGGCAGG + Intergenic
1102651693 12:114447085-114447107 AGGGAGTTGTCGATGCAGGATGG - Intergenic
1104781069 12:131420819-131420841 GGGATGTTGTGGTTGAAGGAGGG + Intergenic
1104832472 12:131763083-131763105 AGGCAGTTGTTGATGAAAAGTGG + Intronic
1104874515 12:132024689-132024711 AGGCTGCTGTCGAGGAAGGTGGG - Intronic
1104874524 12:132024727-132024749 AGGCTGCTGTCGAGGAAGGTGGG - Intronic
1105782571 13:23716957-23716979 AGCCTTTTATTGATGAAGGCAGG + Intergenic
1106154944 13:27145720-27145742 AGACTTTTGTTGATAAAGAAGGG - Intronic
1106719536 13:32424399-32424421 ATGCTGTTGGTGGTGAAGGCTGG - Intronic
1108439852 13:50440063-50440085 AAGCTGTTCTTTAAGAAGGAAGG - Intronic
1108692244 13:52870049-52870071 AGAATGTTGTTGATGAGGCATGG + Intergenic
1113163827 13:107415203-107415225 AGGCAGTTGTTTATGAAGATAGG - Intronic
1114356288 14:21912799-21912821 AGACTGTTGTAGATAAAGAAAGG - Intergenic
1114601829 14:23962207-23962229 AGGGTGGTGTTGCTGAAGGCTGG + Intronic
1114606004 14:23997329-23997351 AGGGTGGTGTTGCTGAAGGCTGG + Intronic
1114611599 14:24045285-24045307 AGGGTGGTGTTGCTGAAGGCTGG + Intergenic
1116625934 14:47263321-47263343 AGGCTTTTGGGGATGGAGGATGG - Intronic
1118735354 14:68697039-68697061 AGGCTCTTGCAGAGGAAGGATGG - Intronic
1119338976 14:73859124-73859146 AGGCATTTGTTGATGAAATAAGG + Intronic
1121752390 14:96368537-96368559 GTGCTTTTGTTGATTAAGGAGGG - Intronic
1123435298 15:20249785-20249807 AGGGTGTGGTTGAAGCAGGAAGG - Intergenic
1128320999 15:66694208-66694230 CAGCTGTTGAAGATGAAGGAGGG - Intergenic
1129926185 15:79366366-79366388 AGGCAGTTGTGGATAAAGAAAGG - Intronic
1129936720 15:79457036-79457058 AAGCTGTGGTTGAAGAAGGGTGG - Exonic
1130197618 15:81795431-81795453 AGGCTATGGTTTATTAAGGAAGG + Intergenic
1130654397 15:85781996-85782018 AGGCTTTTGATAATGAAGGGAGG - Intronic
1131679673 15:94708139-94708161 AAGCTGTTAATGATGAAGGTAGG + Intergenic
1132211197 15:100023591-100023613 AGGCTTTTGTGGATGAAGAGAGG - Intronic
1133211679 16:4266630-4266652 GGGTTCCTGTTGATGAAGGATGG + Intronic
1133386810 16:5376542-5376564 AGGAGGCAGTTGATGAAGGAAGG + Intergenic
1133960056 16:10485622-10485644 AGGCTGTTGGGGAGGAAGGATGG - Intergenic
1134329243 16:13235368-13235390 TTGCTGTTGGTGATGAAGTATGG - Exonic
1136849315 16:33601205-33601227 AGGGTGTGGTTGAAGCAGGAAGG + Intergenic
1138378464 16:56583479-56583501 AGACAGTTGTAGATAAAGGAAGG + Intergenic
1138515667 16:57534457-57534479 AGGAGTTTGCTGATGAAGGAAGG - Intronic
1138757826 16:59510131-59510153 AGGCAGTTATTCATGAAGGGAGG + Intergenic
1140341300 16:74166257-74166279 AGCCTGACATTGATGAAGGATGG + Intergenic
1140884230 16:79228899-79228921 AGGCTGATGTTGCTGGAGGGAGG - Intergenic
1140967770 16:79983868-79983890 TGTGTGTTGTTGATGAGGGAAGG + Intergenic
1141030821 16:80586848-80586870 TGGGTGTTGTTGAAGAAGGGGGG + Intergenic
1141661051 16:85441727-85441749 AGGCTGTTGTGATAGAAGGAAGG + Intergenic
1203111022 16_KI270728v1_random:1449855-1449877 AGGGTGTGGTTGAAGCAGGAAGG + Intergenic
1142625943 17:1192042-1192064 AGGCAGTAGCTGATAAAGGAAGG + Intronic
1143757300 17:9076254-9076276 AGGCTGGTGTGGATGGAGGATGG - Intronic
1148807404 17:50270969-50270991 GGGCTGTTCTAGAGGAAGGAGGG - Intergenic
1151388642 17:73770827-73770849 AGGCGGGTGAGGATGAAGGAGGG + Intergenic
1152331968 17:79678749-79678771 AGGCTGGGGTTGAGGAAGGAGGG - Intergenic
1153691158 18:7595151-7595173 CTGCTGCTGTTGATGAAGGCAGG + Intronic
1153803597 18:8693002-8693024 AGATAGGTGTTGATGAAGGAGGG + Intergenic
1156635478 18:39023031-39023053 AGGGTGGTGATGAAGAAGGAAGG + Intergenic
1157411020 18:47463580-47463602 TGGCAGTTGTTTATGAGGGAAGG - Intergenic
1158911245 18:62065053-62065075 AGGCTGATACTGATGCAGGAAGG + Intronic
1159028106 18:63205200-63205222 AGGCTGTTGTTGATGAAGGATGG - Intronic
1162967718 19:14163917-14163939 CGGGTGTGGTTGGTGAAGGATGG - Intronic
1164623666 19:29713045-29713067 AGGCTCTTGTTGGGGAAGAAAGG + Intronic
1165031457 19:33000650-33000672 AGGGTGTGGTTGAAGCAGGAAGG - Intronic
1168292356 19:55362767-55362789 AGGCTGTGGCTGCTGGAGGAAGG - Intronic
1168393173 19:56027299-56027321 AGGCTGTTGTTCATCATTGACGG + Exonic
1168646447 19:58062004-58062026 AGGGAGGTGTTGAAGAAGGAGGG - Intronic
926554516 2:14341628-14341650 AGGCTGTTTGTGATGAGGGGTGG - Intergenic
926964619 2:18396485-18396507 AGGCTGATGATGATGATGGATGG - Intergenic
927436492 2:23070981-23071003 ATGCTGGTTTTGAGGAAGGAGGG + Intergenic
928061323 2:28116165-28116187 AGGCTAATGTAGATGGAGGAGGG + Intronic
928671002 2:33603385-33603407 TTGCTGGTCTTGATGAAGGAGGG - Intergenic
930710142 2:54543111-54543133 GGGCTGATGCTGAGGAAGGAAGG + Intronic
930916491 2:56696080-56696102 AGGCTGTTGTTTGGGGAGGATGG + Intergenic
931193588 2:60028687-60028709 AGGCTTTTGTTGATAAAGGATGG + Intergenic
933530956 2:83511176-83511198 CTGCTGCTGATGATGAAGGAGGG + Intergenic
934655473 2:96114972-96114994 AGGCTGTAGCTGAAGAAGAAGGG + Exonic
934681953 2:96290404-96290426 AGGAAGTTGTTGATTGAGGAGGG + Exonic
935936135 2:108185104-108185126 AAGCTGCTGTCCATGAAGGAAGG - Intergenic
936584068 2:113736850-113736872 ATGCTTTTTTTGATGAAGGTTGG + Intronic
939814325 2:146875080-146875102 AGGCTGTTGTTCATGAAACATGG - Intergenic
939915113 2:148031013-148031035 GGGCTGCTGGTGATAAAGGATGG + Intronic
940727777 2:157354567-157354589 AGGGTGGTGTTGCTGAAGGTTGG - Intergenic
940887444 2:159001880-159001902 AGGGGGTTGTTGATGGAGGGAGG + Intronic
941658989 2:168175119-168175141 AAGCTGTTGCTGAAAAAGGAGGG - Intronic
942110430 2:172676891-172676913 AGGATGGTGTTGCTGAAGGATGG - Intergenic
942325468 2:174772649-174772671 CAGCTGTTCTAGATGAAGGAAGG - Intergenic
942771441 2:179525709-179525731 AGGCTGATATTCAAGAAGGAAGG - Intronic
943895294 2:193350197-193350219 AAGCTGCTATAGATGAAGGAAGG + Intergenic
945818018 2:214629476-214629498 AGGCAGTTGTGGAAGATGGAGGG + Intergenic
1168789169 20:564376-564398 ATGCTGCTGTGGAGGAAGGAGGG + Intergenic
1169177898 20:3534582-3534604 TGGCTGATGTTAATGAAAGAGGG + Intronic
1169508269 20:6236623-6236645 AGGCTGTCGTCAATGAAGAAAGG - Intergenic
1169613393 20:7409939-7409961 AGGTGGTGGTTGTTGAAGGATGG + Intergenic
1170822423 20:19765830-19765852 AGACTAATGTTGTTGAAGGAAGG + Intergenic
1170968046 20:21093793-21093815 AGGCTGCTGATGCTGAAGGAAGG - Intergenic
1171182436 20:23100749-23100771 AGACTGATGTTGAAGAAGCAAGG + Intergenic
1174583679 20:51591301-51591323 AGGCTGCTGCTGATGGAGGGAGG - Intergenic
1175375483 20:58520881-58520903 GGGCTTCTGTTGATGCAGGATGG + Intergenic
1178064534 21:28889312-28889334 AGGCTGTCGGTGATGAGTGAGGG + Intergenic
1178122003 21:29478535-29478557 GAGCTGTTGTTGATACAGGAGGG + Intronic
1178225424 21:30711549-30711571 TGACTGTTTTTGATGAGGGAAGG - Intergenic
1179902320 21:44400605-44400627 AGGCTGATGTGGCTGAGGGACGG - Intronic
1180017535 21:45097127-45097149 AGGGTGCTGCTGAGGAAGGAGGG - Intronic
1180967373 22:19797711-19797733 AAGCTGGTGTTGAGGTAGGACGG - Intronic
1182794145 22:32978162-32978184 AGGCTGTTGATGAGGAAGACTGG + Intronic
1183092429 22:35531936-35531958 AGGCTGCTGATGATGGAGGACGG - Intergenic
950134825 3:10573643-10573665 AGCCAGTTCTTGCTGAAGGATGG - Intronic
951045970 3:18038793-18038815 AGACACTTGTGGATGAAGGAAGG + Intronic
951620576 3:24597670-24597692 AGGATGTTGTTGGTTCAGGAGGG - Intergenic
951884598 3:27511570-27511592 AGGTTGTTGTTGCTGAGGGGTGG + Intergenic
952317774 3:32246507-32246529 AGGGTGTTGTTTATAAAGCAGGG - Intronic
953100494 3:39820964-39820986 AGGCTGCTGCTGATGGTGGATGG + Intronic
954304589 3:49718825-49718847 AGGCCGTTCTTGAGGAAGGCCGG + Exonic
954408378 3:50358249-50358271 AGGCTGATGGTGATGGAGGATGG + Exonic
954496231 3:50966253-50966275 TGGCTATTGTGGATGAATGAGGG + Intronic
954911109 3:54110756-54110778 AGTCTGTGGGTTATGAAGGAAGG - Intergenic
955555524 3:60133175-60133197 GGGCTGGTGCTGATGAAGGAGGG + Intronic
957754419 3:84467970-84467992 AGGGTCTTGTTGGGGAAGGATGG - Intergenic
961829642 3:129616899-129616921 AGGCTGCTCTTGAGTAAGGAGGG - Intergenic
962942849 3:140141439-140141461 GGGCTGTTTTAGAGGAAGGATGG + Intronic
963208367 3:142659902-142659924 AGGCTTTAATTGATGAAAGAAGG - Intronic
963424542 3:145109816-145109838 AGGATGTTGTTGCTGAAGGTTGG + Intergenic
963929904 3:150992797-150992819 AGGGTGGTGTTGCTGAAGGTGGG + Intergenic
965662449 3:171056047-171056069 AGGGTGTTCTGGGTGAAGGAAGG + Intergenic
968965624 4:3767795-3767817 AGGCTGTAGCTGAAGAAGAAGGG - Exonic
969467548 4:7366546-7366568 AGGCTGATGAGGATGGAGGAGGG - Intronic
969916913 4:10500228-10500250 ACTCTTCTGTTGATGAAGGAAGG - Intronic
970337324 4:15061927-15061949 AGGCTGTTGTTAAAAAAGGACGG - Intronic
971470594 4:27021750-27021772 TGGCTGTTGCAGAGGAAGGATGG + Intronic
972365762 4:38372993-38373015 AGGGTGTTGTTGTTGAAGACTGG - Intergenic
972670237 4:41208150-41208172 ATGCCATTGTTGAAGAAGGAAGG - Intronic
975529554 4:75386252-75386274 AGGGGGTTGGCGATGAAGGAAGG - Intergenic
976734776 4:88298429-88298451 AGGCAGTTGTAGATAAAGAAAGG - Intergenic
977163304 4:93663620-93663642 AGGCAGTGCTTCATGAAGGAAGG + Intronic
978587922 4:110293204-110293226 ATGCTGTTGATCATGCAGGAGGG - Intergenic
981872209 4:149499935-149499957 AGGAAGTTGTTGAGCAAGGAAGG - Intergenic
982316559 4:154037750-154037772 AGGGTGTTGAGGATGAGGGAAGG + Intergenic
984814656 4:183825270-183825292 AGGCTGTGGGCGAGGAAGGAAGG + Intergenic
987718989 5:21610664-21610686 AGGCTTATGGTCATGAAGGAAGG - Intergenic
990525816 5:56626371-56626393 GGTCTGTTGTTGATGGGGGAGGG - Intergenic
993161293 5:84294890-84294912 TAGTTGTTGTTGATGAAGTAGGG - Intronic
993893358 5:93501941-93501963 AGGTTGTGGTTGCTGAAGGTTGG - Intergenic
997694940 5:135853243-135853265 GGGTTGTTGTTGCTGAAGGTTGG + Intronic
998956844 5:147447390-147447412 AGGCATATGTTGATGAAAGAGGG + Intronic
999217865 5:149950648-149950670 AGGCTGTTGGGGGTGAGGGAGGG + Intergenic
999443523 5:151620941-151620963 AGCCTGTTGTACATGAAGGGTGG - Intergenic
999738144 5:154528121-154528143 AAGCTGATGTTGAAGAAAGAGGG + Intergenic
1001183431 5:169542984-169543006 AGGTTGTTGTTGCTGAAGGTTGG - Intergenic
1001877228 5:175212336-175212358 GGACTGTTGCTAATGAAGGATGG - Intergenic
1003132390 6:3405964-3405986 AGGCTGTTTGGGTTGAAGGAGGG + Intronic
1006516205 6:34547014-34547036 AGGCAGGGGGTGATGAAGGAGGG - Intronic
1007361112 6:41356572-41356594 ACACTGTTCTTGATGAAGAAGGG + Intergenic
1007820919 6:44559974-44559996 AGGCCCTGGTTGATGGAGGATGG - Intergenic
1008433593 6:51449262-51449284 AGGCAGGTGTTGATAGAGGATGG - Intergenic
1010305380 6:74315642-74315664 AGGCTCCTTTTGTTGAAGGAAGG + Intergenic
1011726171 6:90212631-90212653 AGGCTGTTGTTGATGCTTGATGG - Intronic
1012699128 6:102430748-102430770 AGGCTGTTGTTTCTAAAGAAGGG + Intergenic
1014236747 6:118965680-118965702 AGGCTGTTGTGGAAGGAGTATGG + Intronic
1014775044 6:125498854-125498876 GGGTTGTGGTTGATGAAGAATGG + Intergenic
1017314549 6:153015432-153015454 AGGCTGGTATTGCTGAAGGTTGG - Intronic
1017441972 6:154472993-154473015 GGGAAGTTGGTGATGAAGGAAGG + Intronic
1017680352 6:156857537-156857559 AGGGTGTTGTTGAGCTAGGAAGG + Intronic
1020743001 7:12045812-12045834 ATGCTATTATTTATGAAGGAAGG - Intergenic
1021903852 7:25314121-25314143 AGGTGGTTGTCGATGAAGGCCGG - Intergenic
1024132191 7:46364555-46364577 AGGTGGTTGTTGCTGAAGGTTGG - Intergenic
1024161388 7:46679971-46679993 GGGCTTTTGTAGATGAGGGAGGG - Intronic
1026204678 7:68246505-68246527 AGGCTGGTGTTGTGGGAGGAAGG + Intergenic
1026405047 7:70056389-70056411 AGGGTGAAGGTGATGAAGGAGGG - Intronic
1027123167 7:75536864-75536886 AGGCTGTTGCTGCTTAAGGGAGG + Exonic
1027276126 7:76558314-76558336 AGGTGGTGGTTGCTGAAGGATGG - Intergenic
1027442853 7:78238725-78238747 AGACTGTTGGTGAGCAAGGATGG - Intronic
1027482298 7:78713867-78713889 TGGATCTTTTTGATGAAGGATGG - Intronic
1028185937 7:87785298-87785320 AGGCTGGTCTTGTGGAAGGAAGG + Intronic
1028711029 7:93908429-93908451 AGACAGGTGTTCATGAAGGAGGG - Intronic
1031908394 7:127487242-127487264 TGGCAGATGGTGATGAAGGATGG + Intergenic
1031995501 7:128227797-128227819 AGGCTGTTGGGGATGCTGGACGG - Intergenic
1032343822 7:131101164-131101186 AAGCTGTTGTGGATGAAGACAGG + Intergenic
1034077278 7:148244381-148244403 AGGCTGTTTTTTAGGAAGGTTGG + Intronic
1034173991 7:149086316-149086338 TGGCTTTTGTTCATGATGGAAGG + Intronic
1036473585 8:9072901-9072923 CGGCAGGTGTTGCTGAAGGAAGG - Intronic
1036679922 8:10864485-10864507 AGGCTGCTGTTGAGGCAGTAGGG + Intergenic
1039845195 8:41321022-41321044 AGGCTGAAGGTGAGGAAGGAGGG - Intergenic
1040468655 8:47717996-47718018 CAGCTGTTTTTGATTAAGGAGGG - Intronic
1040472538 8:47746747-47746769 AGATTGTTGGTGGTGAAGGAGGG + Intergenic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1041628142 8:60054943-60054965 AGGTTGTTGGAGATGAAGGGAGG + Intergenic
1043846702 8:85171807-85171829 AGGCTGCTGGTCATGATGGAAGG + Intergenic
1043932015 8:86102054-86102076 ACGCTATTGGTGATGGAGGATGG + Intronic
1044012077 8:87006526-87006548 AAGCTTTTATTTATGAAGGAAGG + Intronic
1044955192 8:97472663-97472685 ATACTGATGTTGCTGAAGGATGG - Intergenic
1045345908 8:101293277-101293299 AAGCTGATGGTGACGAAGGAAGG - Intergenic
1045511380 8:102814508-102814530 AGGCTGTTGCTACTGAGGGAGGG + Intergenic
1045555439 8:103210183-103210205 AGGCTGTAATTGGTGGAGGAAGG + Intronic
1046030439 8:108776750-108776772 ATGATGATGATGATGAAGGAAGG + Intronic
1047301854 8:123620226-123620248 AGGGTGTTGTTTTTGCAGGATGG + Intergenic
1047972515 8:130097437-130097459 AGGCTGTTGGAGATGTGGGAAGG - Intronic
1048455366 8:134573447-134573469 AGGCTGATGTTGCTGGTGGAGGG + Intronic
1050676201 9:8056723-8056745 TGGCTGTTTCTGATGAAGCATGG + Intergenic
1050696614 9:8286280-8286302 TGGCTTTTGTTGGGGAAGGAGGG - Intergenic
1051755641 9:20396812-20396834 AGGGTGTTGTTGCTGGAGTAAGG + Intronic
1053535206 9:38918763-38918785 AGACTGAGGTTGGTGAAGGAAGG + Intergenic
1054207428 9:62143167-62143189 AGACTGAGGTTGGTGAAGGAAGG + Intergenic
1054630925 9:67445187-67445209 AGACTGAGGTTGGTGAAGGAAGG - Intergenic
1056076625 9:83048149-83048171 GGGCTGTGATTGATGGAGGAGGG - Intronic
1058541478 9:106016717-106016739 AGGCTGATGATGATGATGAATGG + Intergenic
1059199136 9:112398281-112398303 GGGCTGTGGTGGATGAGGGAGGG + Intronic
1059603254 9:115804419-115804441 AGGGTGTGGTTGCTGAAGGTTGG + Intergenic
1061071089 9:128311153-128311175 AGGCACCTGGTGATGAAGGAGGG - Intronic
1061646326 9:132005055-132005077 AGTCTGTCTTTGATGAGGGAAGG - Intronic
1061703536 9:132434561-132434583 AGGCTTTTCTCCATGAAGGAAGG + Intronic
1189348802 X:40262125-40262147 AGGCTGCTGCTGCTGCAGGAGGG - Intergenic
1196260081 X:113568721-113568743 AGGGTGTGGTTGCTGAAGGTTGG + Intergenic
1197092802 X:122558735-122558757 AAGCTGTGCTGGATGAAGGATGG - Intergenic
1197166484 X:123383032-123383054 CTGCTGTTGTGGGTGAAGGATGG - Intronic
1198323001 X:135538036-135538058 GGGCAGTTGTTGCTGAAGGATGG + Intronic
1199511061 X:148622979-148623001 AGGCTGATGAAGATGAAGCAGGG + Intronic
1199881982 X:151981197-151981219 GGGCAGTTGTTGAAGAAGGAAGG + Intergenic