ID: 1159032399

View in Genome Browser
Species Human (GRCh38)
Location 18:63244779-63244801
Sequence GAAACTTTCAGAGCCCGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159032396_1159032399 30 Left 1159032396 18:63244726-63244748 CCGTCCTAGGCAGTATTCTGGGC 0: 1
1: 0
2: 1
3: 10
4: 115
Right 1159032399 18:63244779-63244801 GAAACTTTCAGAGCCCGCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 82
1159032397_1159032399 26 Left 1159032397 18:63244730-63244752 CCTAGGCAGTATTCTGGGCAGAG 0: 1
1: 0
2: 0
3: 15
4: 214
Right 1159032399 18:63244779-63244801 GAAACTTTCAGAGCCCGCTTTGG 0: 1
1: 0
2: 0
3: 8
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159032399 Original CRISPR GAAACTTTCAGAGCCCGCTT TGG Intronic
903965718 1:27088082-27088104 GATACTTTCAGAGCCACCCTAGG - Intergenic
904462704 1:30689672-30689694 GGAACTATCAGAGCCTGCTATGG + Intergenic
906206567 1:43990596-43990618 GGAAGTTTCAGAACCCACTTTGG + Exonic
906646969 1:47482226-47482248 GAGACTTTCAGAGCCCAGTGTGG + Intergenic
908486733 1:64601870-64601892 GAAACTTTGAGAGTCCTCTCAGG + Intronic
913138158 1:115912742-115912764 GAAACTTTAAGAGCCCTCTGAGG + Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
919129313 1:193433493-193433515 CAAAGTTTCAGAGACCGCTAGGG + Intergenic
919312767 1:195932336-195932358 GAAAATTTCAGAGACATCTTTGG - Intergenic
920740349 1:208575967-208575989 AAAATTTTCAGAGCACACTTTGG - Intergenic
924890833 1:248277907-248277929 GAAACTTTCAGTGACCACATAGG - Intergenic
1063366819 10:5495901-5495923 GAAACCTTCAGAACCAGCTGAGG + Intergenic
1063391258 10:5651165-5651187 GAAACTTCCAGAGCCCAGCTGGG + Intronic
1066790532 10:39057751-39057773 GGAAATTTCAGAGCCCACTGAGG + Intergenic
1068130732 10:52891830-52891852 GAAACCTTCAAAGCTGGCTTGGG - Intergenic
1070691549 10:78530872-78530894 GGAACTTTCTGAGGCCACTTAGG - Intergenic
1074761625 10:116670776-116670798 GAAGCTTTCAGAGCCAACTGTGG + Intergenic
1084798426 11:71525121-71525143 GAAATTTTCAGAGCCCCCTAGGG - Intergenic
1089613107 11:119680694-119680716 GAAACTTTCAGAACACGGTAGGG - Intronic
1090829512 11:130411224-130411246 GAACCTTGCAGAGCCCATTTAGG + Intronic
1095048849 12:37539906-37539928 GAACATTTCAGAGCCCACTGAGG - Intergenic
1099305587 12:80950834-80950856 GTAACTCTCAGAGCCCCCTGTGG - Intronic
1107904301 13:45047963-45047985 GAAAGTTTCAGTGACCTCTTGGG - Intergenic
1111206733 13:85020523-85020545 AAAACTTTCAGATCCCTCCTGGG - Intergenic
1121316524 14:92964281-92964303 GACACTGTCAGGGACCGCTTGGG - Intronic
1123186509 14:106522574-106522596 GAAACTTTCAGAGAACTCATAGG + Intergenic
1123200801 14:106661914-106661936 GAAACTTTCAGAGAACTCATAGG + Intergenic
1126705931 15:51404950-51404972 GTAACTTGCAGAGCCAGCTGTGG - Exonic
1127969231 15:63945807-63945829 GGAATTTTCACAGCCAGCTTGGG - Intronic
1137058269 16:35756027-35756049 GGAACTTTCAGAGCCCATTGAGG - Intergenic
1137072767 16:35920441-35920463 GGACTTTTCAGAGCCCGTTTTGG - Intergenic
1141917710 16:87111175-87111197 GGGAGTTTCAGAGCCCTCTTTGG - Intronic
1144874238 17:18388882-18388904 GGAACTTCCAGTGCCCGCTATGG + Exonic
1145157990 17:20555536-20555558 GGAACTTCCAGTGCCCGCTATGG - Intergenic
1145365604 17:22264095-22264117 GAAAGTTTCAGAGCCCATTGAGG - Intergenic
1145749384 17:27344294-27344316 AAAACCTTCAGAGACCCCTTTGG - Intergenic
1150624743 17:66834871-66834893 GAGGCTTTCAGAGTCCGCATAGG - Intergenic
1150827322 17:68488424-68488446 GAAGCTTTAAGAGCCAGCATGGG + Intergenic
1157287765 18:46388837-46388859 GAAAATTTCACACCCCACTTAGG + Intronic
1159032399 18:63244779-63244801 GAAACTTTCAGAGCCCGCTTTGG + Intronic
932641200 2:73449018-73449040 GAAACTTTCAGAGCCTCTTCGGG - Exonic
932641292 2:73449876-73449898 GAAATTTTCAGAGCCTCTTTAGG - Exonic
932641450 2:73451298-73451320 GAAACTTTCAGAGCCTCTTCAGG - Exonic
935264085 2:101380188-101380210 GCTACTTTCAGAGCTCCCTTTGG - Intronic
948260570 2:236601491-236601513 GCAACATCCAAAGCCCGCTTTGG - Intergenic
1171543364 20:25983385-25983407 GAACATTTCAGAGCCCACTGAGG - Intergenic
1174535993 20:51251834-51251856 GAAACTTTCAGATGCCCCCTGGG + Intergenic
953563078 3:44010334-44010356 GAAGCTTTCAGAGCCCGTTGAGG + Intergenic
960996314 3:123342796-123342818 GAATCCTTCAGAGCCCTCTCAGG + Intronic
972041183 4:34602142-34602164 GAAACTCTCAGAGGCAGCTAAGG - Intergenic
976483060 4:85567184-85567206 GAATCTTTAAAAGCTCGCTTTGG + Intronic
977308353 4:95353243-95353265 AAAAGTTTTAGAACCCGCTTAGG - Intronic
983079521 4:163367951-163367973 TAAACTTTCACAACCCGCCTTGG + Intergenic
985703593 5:1388010-1388032 TAAGCCCTCAGAGCCCGCTTTGG - Intergenic
986441100 5:7782448-7782470 CAAACATACAGAGCCAGCTTAGG - Intronic
992295177 5:75320472-75320494 GAAATTTTCAGAGCCTTCTGGGG - Intergenic
993013645 5:82511395-82511417 GAAACTTTTAAAGCCCACTAAGG + Intergenic
998505316 5:142667734-142667756 GGAATTTTCAGAGCCCGCCGAGG - Intronic
999426288 5:151490277-151490299 GACAGTTTCTGAGCCCACTTTGG - Exonic
1002783598 6:384817-384839 AAAACTCTCAGAGACCCCTTGGG + Intergenic
1003548635 6:7082739-7082761 GAAACTTTCACATCCAGGTTGGG + Intergenic
1010564924 6:77399344-77399366 GAAACTTTCTGTGCCTGCTGAGG - Intergenic
1010837828 6:80612107-80612129 GAAGCTTTCAGAGCCTGTTGAGG + Intergenic
1014366585 6:120551256-120551278 GAGACTTTCCAAGGCCGCTTTGG - Intergenic
1019011131 6:168844292-168844314 GAAACTCACAGAGCCGGCGTCGG - Intergenic
1021973911 7:25992711-25992733 GAAACTTTCTCAGCCTGCTAAGG + Intergenic
1022430788 7:30318115-30318137 GAAACTTGGAGTGCCGGCTTTGG + Intronic
1023088913 7:36599945-36599967 GCAACTTTCAGAGCCTTCCTTGG + Intronic
1023177607 7:37448661-37448683 GAAACTTTACGAACCTGCTTGGG + Exonic
1032288574 7:130565051-130565073 GAAATTTTCAAAGCCCCCTAAGG - Intronic
1036398377 8:8386952-8386974 GTGGCTTTCAGAGCCCGCCTCGG - Intergenic
1040281553 8:46053030-46053052 GAACATTTCAGAGCCAGCTGAGG + Intergenic
1040283295 8:46082436-46082458 GAACATTTCAGAGCCCACTGAGG + Intergenic
1040285162 8:46096198-46096220 AAACATTTCAGAGCCCACTTAGG + Intergenic
1040321773 8:46313605-46313627 GAATATTTCAGAGCCCACTGAGG - Intergenic
1040321787 8:46313775-46313797 GGACATTTCAGAGCCCACTTAGG - Intergenic
1040326457 8:46344410-46344432 GAAAGTTTCAGAACCCACTGAGG + Intergenic
1040327280 8:46356475-46356497 GAAAATTTCAGAGCCCACTGAGG - Intergenic
1040331446 8:46387761-46387783 GAAACTTTCAGAGCTTTCTCAGG + Intergenic
1040332711 8:46398997-46399019 GAAAATTTCAGAGCCCACTGAGG - Intergenic
1040344781 8:46480806-46480828 GAAAATTTCAGAGCTCACTGAGG - Intergenic
1041326023 8:56665345-56665367 TAAAGATTTAGAGCCCGCTTTGG - Intergenic
1044974117 8:97646528-97646550 GAAAATTTCAAAGCCCTATTTGG + Intronic
1045018342 8:98018929-98018951 GAAACTCTCAGAGCCTGTTCTGG - Intronic
1049786537 8:144453638-144453660 GAAACAGGCAGAGCCAGCTTGGG + Intronic
1050638109 9:7635207-7635229 GAAAATTTCAGAGCCACCATTGG - Intergenic
1056654292 9:88496497-88496519 GAACCTTCCAGAGCCCACTTTGG + Intergenic
1057851852 9:98572093-98572115 CAAACTGTCAGAGCCTGCTCAGG - Intronic
1060652603 9:125342028-125342050 GGAACTTTCAGAACCTGCTTCGG - Intronic
1061790429 9:133056148-133056170 GAAGAGTTCAGAGACCGCTTTGG - Intronic
1195829337 X:109038594-109038616 GAAACTTTCAGAGTATGTTTTGG - Intergenic