ID: 1159033082

View in Genome Browser
Species Human (GRCh38)
Location 18:63251096-63251118
Sequence CAAAATATGAGACTTGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 617
Summary {0: 2, 1: 9, 2: 51, 3: 105, 4: 450}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159033077_1159033082 13 Left 1159033077 18:63251060-63251082 CCATATTTAATAATGTAGGTGCA 0: 1
1: 0
2: 2
3: 9
4: 157
Right 1159033082 18:63251096-63251118 CAAAATATGAGACTTGAAGAAGG 0: 2
1: 9
2: 51
3: 105
4: 450
1159033076_1159033082 14 Left 1159033076 18:63251059-63251081 CCCATATTTAATAATGTAGGTGC 0: 1
1: 0
2: 1
3: 14
4: 138
Right 1159033082 18:63251096-63251118 CAAAATATGAGACTTGAAGAAGG 0: 2
1: 9
2: 51
3: 105
4: 450
1159033075_1159033082 15 Left 1159033075 18:63251058-63251080 CCCCATATTTAATAATGTAGGTG 0: 1
1: 0
2: 1
3: 32
4: 237
Right 1159033082 18:63251096-63251118 CAAAATATGAGACTTGAAGAAGG 0: 2
1: 9
2: 51
3: 105
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159033082 Original CRISPR CAAAATATGAGACTTGAAGA AGG Intronic
900812770 1:4820554-4820576 CAAAACATTAGACTTCAAGAAGG - Intergenic
901285553 1:8075854-8075876 ACAAATATGAGACTCAAAGAAGG + Intergenic
901500522 1:9650047-9650069 CAAAATACAAGACTGGATGAAGG + Intergenic
902980879 1:20122037-20122059 GAAAAGATGATACTTGAACAGGG + Intergenic
904965253 1:34367152-34367174 AAAAATATGAGGCATGAAAAAGG + Intergenic
906668811 1:47640279-47640301 CAAGAGATGAGACTGGGAGAGGG + Intergenic
907531062 1:55097511-55097533 CAGAATATGAAAATTGAAAAAGG + Intronic
908191268 1:61705989-61706011 GAAAATATGAAACTGGAAAAGGG + Intronic
908483214 1:64564459-64564481 CAAAATAGGAGCCTCAAAGAAGG - Intronic
909900792 1:81132207-81132229 AGGAATATGAGGCTTGAAGAAGG - Intergenic
910831220 1:91464321-91464343 CCAAATGGGAGAATTGAAGAGGG + Intergenic
910838983 1:91543101-91543123 GAAAAACTGAGGCTTGAAGAGGG + Intergenic
912502969 1:110134667-110134689 ACATATATGAGACTTGGAGAGGG - Intergenic
913240664 1:116826648-116826670 CAAAATAAGTCACTTGAAGAGGG + Intergenic
914350960 1:146839987-146840009 CAAAATATGAGGCATGGAGAAGG - Intergenic
914760379 1:150593855-150593877 CAAATTAAGAGAGCTGAAGAAGG + Intergenic
915667781 1:157460553-157460575 CCAAATAGGAGAGTTGAACAGGG + Intergenic
916303141 1:163298413-163298435 CAAAGTAGAGGACTTGAAGAGGG + Intronic
917063321 1:171064825-171064847 AAAGATATGGAACTTGAAGAAGG + Intergenic
917153361 1:171967906-171967928 CAAAGTATGAGACTCAAAGAGGG - Intronic
917825218 1:178812851-178812873 CAAAATATCAAATTTGTAGAAGG - Intronic
918176119 1:182046805-182046827 CAAAATATTAGAAATGAAAAGGG - Intergenic
918513940 1:185341852-185341874 CACAGTATGAGACTCAAAGAGGG + Intergenic
918756889 1:188349450-188349472 CAAAAAATATGACATGAAGATGG - Intergenic
919227930 1:194732074-194732096 CAAAAAAAGAGACTTTAACATGG + Intergenic
919415353 1:197301460-197301482 TAAATAATGAGACTTGAAGCCGG - Intronic
920434321 1:205938344-205938366 CATGAGATAAGACTTGAAGAGGG - Intronic
921058453 1:211562696-211562718 CACAATTTAAGACTTGAAGATGG + Intergenic
921243124 1:213207604-213207626 CAAAATATGAGACTCTAAGAAGG - Intronic
921500338 1:215894819-215894841 TGACATATGAGACCTGAAGAGGG - Intronic
923029187 1:230233793-230233815 CAAAATATGAGACTCAAAGAAGG + Intronic
923252879 1:232193441-232193463 ACAAATAAGAGACTTAAAGAGGG + Intergenic
923274860 1:232387022-232387044 AAAAATTTGAAACTTGGAGAGGG + Intergenic
924009246 1:239646585-239646607 TATAATATGAGACTTGAGAAAGG + Intronic
924132348 1:240924515-240924537 CAACATATGACAGTTGCAGAAGG - Intronic
924140130 1:241013369-241013391 CAAAGTGTGAGACTCGAAGCAGG - Intronic
924416740 1:243863704-243863726 CAAAACATCAGATTTTAAGATGG + Intergenic
924841752 1:247717988-247718010 CAAAATATGAGATTCAAAGAAGG + Intergenic
1063761775 10:9086917-9086939 CAAAAGATAAGAGTTGAAGTAGG - Intergenic
1064545817 10:16449042-16449064 CCAAATAGGAGAGTTGAACAGGG + Intronic
1066048587 10:31615839-31615861 CAAAATGTGAGACTCAAGGAAGG + Intergenic
1066124862 10:32331140-32331162 CTAAATATGAGACTTCTATATGG - Intronic
1066280769 10:33916107-33916129 AAAAATATTTGACTAGAAGATGG + Intergenic
1066560644 10:36665951-36665973 CAACATATGAAATTTGATGATGG + Intergenic
1066675918 10:37887037-37887059 CATGATATGAGAGTTCAAGAAGG + Intergenic
1066762292 10:38766961-38766983 CAAAGAATAAGACTTGAAGATGG - Intergenic
1066959298 10:42205509-42205531 CAAAGTATAAGACTTGAAGATGG + Intergenic
1067064067 10:43093858-43093880 CAAAAAATGAGGCAAGAAGAAGG + Intronic
1067365203 10:45621022-45621044 TAAAATATGAGACTAGGAAATGG - Intronic
1067958768 10:50823753-50823775 CAAAAATTGAGACCTGAAGATGG - Intronic
1068225465 10:54102519-54102541 CCAAATAGGAGAGTTGAACAGGG + Intronic
1068366801 10:56061706-56061728 AAAATTATGAGAATGGAAGATGG + Intergenic
1069086466 10:64145481-64145503 CAAAATATGTAACTTCCAGATGG - Intergenic
1069566877 10:69469355-69469377 CAAATTATCAAACTTGGAGAAGG + Intronic
1070256494 10:74817408-74817430 CAAAATATGATACTTGATTTTGG + Intergenic
1070411072 10:76141046-76141068 CAAAATACAAGACTCAAAGAAGG - Intronic
1070462714 10:76685916-76685938 CCAAATTGCAGACTTGAAGAAGG + Intergenic
1070845244 10:79516981-79517003 CAAAAAATGAGACTGCAAGAAGG - Intergenic
1070928554 10:80243327-80243349 CAAAAAATGAGACTGCAAGAAGG + Intergenic
1071078292 10:81780988-81781010 CAAAATAAGAGAGTTGAACTAGG - Intergenic
1071090915 10:81917238-81917260 CCAAATAAGGGACTTGAAGTGGG - Intronic
1071331890 10:84568705-84568727 CGAAATATGAGACTCAAAGAAGG - Intergenic
1071364581 10:84885418-84885440 CCAAATAGGAGAGTTGAACAGGG + Intergenic
1071742471 10:88375841-88375863 TAAAATATGGGATTGGAAGAAGG + Intronic
1072215607 10:93285014-93285036 CCAAATATGAGACTCGAACAAGG + Intergenic
1073597946 10:104818515-104818537 CAAAAGAAGAGATATGAAGAGGG + Intronic
1073644995 10:105293009-105293031 AAAAAAATCAGACTTCAAGATGG + Intergenic
1073957782 10:108892542-108892564 CCAAATAGGAGAGTTGAACAAGG + Intergenic
1074141894 10:110680485-110680507 GAACAGATGAGACTTGGAGAAGG - Intronic
1074186106 10:111100689-111100711 CAAAATATGAAAATAGCAGAGGG - Intergenic
1074938557 10:118211931-118211953 AAGAATATGAGACTGGAAGAAGG + Intergenic
1076123093 10:127951820-127951842 CCAAATAGGAGAGTTGAAGGTGG - Intronic
1076527680 10:131122702-131122724 CAAATTATCAAACTTGAAGGAGG + Intronic
1079420220 11:20279110-20279132 CAAAATATGAGACTCAAAGAAGG + Intergenic
1079980093 11:27141920-27141942 CAAATTATGAGAGTTCCAGAAGG + Intergenic
1080048834 11:27837769-27837791 CAAAATGTGAGGCATCAAGATGG + Intergenic
1080307589 11:30853548-30853570 CAAAATATGATACTCAAAGAAGG + Intronic
1080379885 11:31757608-31757630 CAGAAAATGAGCATTGAAGAGGG - Intronic
1080428020 11:32173744-32173766 CCTAAGATCAGACTTGAAGAGGG - Intergenic
1080999252 11:37647491-37647513 CAATATAAGAGACTTAAAAAAGG + Intergenic
1082212523 11:49522568-49522590 GAAAATATGATACTTGAAGTGGG + Intergenic
1083028151 11:59568120-59568142 CAAAACACAAGACTTGAAGATGG + Intergenic
1083076132 11:60040898-60040920 AAAAATATGAGTCTGGAAGCAGG - Intronic
1083128013 11:60591908-60591930 CAAAATATAGGAGTTCAAGAAGG + Intergenic
1083168682 11:60908752-60908774 CAAAATATGAGGCTCAAAGAAGG + Intergenic
1083884232 11:65563627-65563649 GAAGATATGGGACTTGACGAAGG + Intergenic
1085811918 11:79690853-79690875 GAAAATATGATATTTGAAGAGGG + Intergenic
1086637073 11:89101929-89101951 GAAAATATGATACTTGAAGTTGG - Intergenic
1086719554 11:90103230-90103252 CAAAGTATAAGACTTGAAGATGG - Intergenic
1086780661 11:90900954-90900976 CAAAATAGGTGAGTTGAATAAGG + Intergenic
1086834007 11:91599465-91599487 CAAAATAGGAGAGTTGAACAGGG - Intergenic
1087485820 11:98758793-98758815 CAAAATTTTAGGCTTGCAGATGG - Intergenic
1088053048 11:105542070-105542092 CAGAAGATGAGACTCAAAGAAGG + Intergenic
1089162117 11:116446547-116446569 CATAATATGAGATTCAAAGAAGG + Intergenic
1089870258 11:121666265-121666287 CAAAATAAGATGCTTGAAGGTGG + Intergenic
1090167642 11:124567849-124567871 CAAAATCTGAAACTTGTTGAGGG - Intergenic
1090287071 11:125509213-125509235 CAAAATATGAGATTCAAAGAAGG + Intergenic
1090287644 11:125513740-125513762 CAAAATATGAGACACAAAGGAGG - Intergenic
1090289176 11:125526955-125526977 CAAAATATGAGACTCAAACAAGG - Intergenic
1090582794 11:128178403-128178425 TTAAATATGAGACCTGAGGAAGG - Intergenic
1091095411 11:132816888-132816910 CATAAAATGAGGCGTGAAGAGGG + Intronic
1091104205 11:132903109-132903131 CATAATATGAGACTCAAAGAAGG - Intronic
1091920608 12:4301611-4301633 CATAGTATGAGGGTTGAAGACGG + Exonic
1092093166 12:5820729-5820751 CCAAATGGGAGAGTTGAAGAGGG - Intronic
1092824417 12:12385086-12385108 CAAAAGATAAGATTTGAAAATGG - Intronic
1093259695 12:16920025-16920047 GAAAATATGTGAAGTGAAGAAGG + Intergenic
1093509905 12:19914227-19914249 CAAAATGTAAGACTTGAAGAAGG - Intergenic
1094269482 12:28596717-28596739 CAAAATATGACACGCCAAGAGGG - Intergenic
1094821272 12:34227720-34227742 GAAAGTATGAGTCTTGAAAAAGG - Intergenic
1095093630 12:38131066-38131088 GAAAGTATGAGTCTTAAAGAAGG + Intergenic
1095098229 12:38159125-38159147 CAACATGTCAGGCTTGAAGAGGG + Intergenic
1096204681 12:49711062-49711084 CAAAAGTTGAGAATTCAAGAAGG + Intronic
1096931834 12:55219420-55219442 AAAAATATGGGAGTTGATGAAGG - Intergenic
1096947853 12:55429354-55429376 TAAAATATGACACTTGGACAAGG - Intergenic
1097206743 12:57328466-57328488 CAAAATATATGACTTGCTGAAGG + Intronic
1097722812 12:63041773-63041795 CACAATAGGAGACCTGAAGCAGG + Intergenic
1097806126 12:63966961-63966983 CAACTTATGAGACGTGAATATGG - Intronic
1098088347 12:66872919-66872941 CAAAATCTGAGACTTCATCAGGG + Intergenic
1098109638 12:67108407-67108429 TAAAATATTGGACTAGAAGATGG - Intergenic
1099338467 12:81395920-81395942 CAATGTATTAGACTGGAAGAGGG - Intronic
1099508412 12:83506014-83506036 CCAAATAGGAGAGTTGAAGAGGG - Intergenic
1099584347 12:84497733-84497755 CAAAATATAAGCCTGGAACAGGG + Intergenic
1099852195 12:88114523-88114545 GAAAATAAGCAACTTGAAGAAGG - Exonic
1100043331 12:90346840-90346862 CAAAGTATGAAACTCAAAGAAGG + Intergenic
1100133708 12:91527901-91527923 CACAATATGAGACTCCAAGAAGG + Intergenic
1100427038 12:94497247-94497269 CAAAATATGAAACTTAGAGAAGG + Intergenic
1101025852 12:100605441-100605463 CAAAAGATAAAACTTGAAGTTGG - Intronic
1101211816 12:102542425-102542447 CAAGAGATGAGATTGGAAGAGGG - Intergenic
1101258280 12:103002087-103002109 CAAAATTTATGACTTGAATATGG + Intergenic
1102092870 12:110207850-110207872 CAAAATGTGAGATTTAAAGCAGG - Intronic
1102386059 12:112511279-112511301 CAAGATAAGAGCCATGAAGAGGG + Intergenic
1104085726 12:125472581-125472603 CAACATATGAAAGTTGGAGAAGG - Intronic
1104692932 12:130839898-130839920 CAAATTATGGAACTTGAAGGTGG - Intergenic
1104694496 12:130852978-130853000 CAAATTATCAAACTTGAGGAGGG - Intergenic
1105650310 13:22370170-22370192 CAAAATATGAGACTCAAAGAAGG - Intergenic
1106185866 13:27409085-27409107 CAATATATGAGACTTGAAGAAGG + Intergenic
1107210127 13:37843491-37843513 CAAAACTAGAGACTAGAAGAAGG + Intronic
1107560506 13:41553161-41553183 CAAAAGATAAAACTTGCAGATGG + Intergenic
1107651623 13:42550794-42550816 CAAATTATGAGAATCGTAGATGG - Intergenic
1107664098 13:42671499-42671521 CAAACTGTGAGGCTCGAAGAGGG - Intergenic
1107985307 13:45770866-45770888 CAAAATATGAAACTCAAAGAAGG + Intergenic
1108009904 13:45995245-45995267 CAAAATTGGAGACTTGAGGAAGG - Intronic
1108448419 13:50533090-50533112 CAAAACATGAGACTCAAAAAAGG - Intronic
1109087002 13:57986618-57986640 TTAAATATTAGACTTGAAGAAGG + Intergenic
1109135600 13:58645972-58645994 CAAAATATGAGTCTTAGAAATGG + Intergenic
1109341978 13:61074273-61074295 CAAAATATGAGAATTTATTAAGG + Intergenic
1109360146 13:61284751-61284773 CAAAATCTGAGACTCAAAGAAGG + Intergenic
1109360208 13:61285595-61285617 CAAAATCTGAGACTCAAAGAAGG + Intergenic
1109594424 13:64531094-64531116 CAAAATATGAGAGTGGAAATAGG - Intergenic
1109992394 13:70075113-70075135 CAAATTATGAGACTTGAAGAGGG + Intronic
1110014588 13:70385739-70385761 CAACATATGGGAATTCAAGATGG + Intergenic
1110588578 13:77225551-77225573 CAAATTATAACACTTGCAGATGG - Exonic
1111792208 13:92871753-92871775 CAAAACATGAAACATGAAGCAGG - Intronic
1111801902 13:92991538-92991560 CAAAATAGATTACTTGAAGAGGG + Intergenic
1112697882 13:101970956-101970978 AAAAATATGAGACTCAGAGAAGG - Intronic
1113062960 13:106343634-106343656 TAAAAGATGAGACGTAAAGATGG + Intergenic
1113376462 13:109768870-109768892 GAAAATCTGAGGCCTGAAGATGG - Intronic
1113729926 13:112634057-112634079 CAAACTATGAAACCTGAAGAGGG - Intergenic
1115964669 14:38874368-38874390 CAAAATATGAGACTTAAAGAAGG + Intergenic
1116617863 14:47161775-47161797 CAAAATATAAGAGTTGAGGTTGG - Intronic
1117721880 14:58636892-58636914 CAATACATGATACTTCAAGAGGG + Intronic
1117826226 14:59706389-59706411 CAAAATATGAAACTCAAAAAAGG - Intronic
1117995509 14:61474041-61474063 GAAGAGAGGAGACTTGAAGAAGG + Intronic
1118376601 14:65182861-65182883 CAGAATAAGAGACTTGAAGAAGG - Intergenic
1118485460 14:66210546-66210568 CAATATAGGAGACTCAAAGAAGG - Intergenic
1118486407 14:66218450-66218472 CAAAATGTAAGACTCAAAGAAGG + Intergenic
1118487038 14:66224150-66224172 CAAAATATGAAACTCAAATAAGG + Intergenic
1118909201 14:70047154-70047176 CAACATTTGAGGCTTTAAGAAGG - Intronic
1119798538 14:77421907-77421929 CAATATATGAAACTTGCAGGTGG - Intronic
1120097218 14:80402563-80402585 CACAAAATGAGACTCAAAGAAGG + Intergenic
1120556866 14:85938498-85938520 GAAAATATGAGTCTCAAAGAAGG + Intergenic
1120935279 14:89889678-89889700 CAAAATTTCAGACTCGCAGAAGG - Intronic
1121168638 14:91835341-91835363 CAAAATATGAAACTGGTAAATGG + Intronic
1121864282 14:97347863-97347885 AAAAATGTGAGACCTGGAGAGGG + Intergenic
1202933625 14_KI270725v1_random:63214-63236 CAAAGTATAAGACTTGAAGATGG - Intergenic
1124914561 15:33957063-33957085 CAAATTATTAAACTTTAAGAAGG - Intronic
1126527464 15:49672622-49672644 CAAGATTTGAGTATTGAAGATGG + Intergenic
1126885264 15:53142242-53142264 CAAAAGATGATACCTGGAGATGG + Intergenic
1127117243 15:55741593-55741615 CAATACGTGAGACTTTAAGACGG - Intronic
1127207815 15:56738674-56738696 CAAAACATAAGACTCAAAGAAGG + Intronic
1127287572 15:57544773-57544795 CAAAATAAGTGACTTGAGTAAGG + Intronic
1127621520 15:60739096-60739118 CAAAATATAAGTTTTGAGGAGGG + Intronic
1128903907 15:71450814-71450836 CAAAATATGAGACTCAAAGAAGG + Intronic
1129075962 15:72996387-72996409 CAAAATATGAGACTCAAAGAAGG + Intergenic
1129362342 15:75031779-75031801 CAAAATATGAGATTCCCAGAAGG + Intronic
1129591503 15:76919106-76919128 CAAAAAATGAAACTTAAATATGG - Intergenic
1130692419 15:86094996-86095018 CAAATTATCAAACCTGAAGACGG - Intergenic
1130826656 15:87554606-87554628 GAAAATAGAAGACTTGAAAAAGG - Intergenic
1131647864 15:94364884-94364906 TTAAATATGAGGCCTGAAGAAGG + Intronic
1131687888 15:94790560-94790582 AAAAAGATTAGACTTGAAGCAGG + Intergenic
1132007273 15:98239607-98239629 CAAGATTTGAGTCTTGAATACGG + Intergenic
1132300404 15:100771841-100771863 GAAGATCTGAGACTTGGAGATGG + Intergenic
1134338459 16:13323444-13323466 ATAAATATGAGATTTGAAGGGGG - Intergenic
1137387196 16:48052656-48052678 AGACATATGTGACTTGAAGAAGG + Intergenic
1139123805 16:64053118-64053140 CTCAACATGAGATTTGAAGAGGG - Intergenic
1139462123 16:67130697-67130719 CAAAATATGAGATGGGAGGAAGG + Intronic
1139983076 16:70875556-70875578 CAAAATATGAGGCATGGAGAAGG + Intronic
1140128833 16:72139732-72139754 CAAAGTTTGAGAATTAAAGAAGG + Intronic
1140545621 16:75805999-75806021 CAAACTATGAAACCTGAGGAAGG + Intergenic
1142297181 16:89232063-89232085 CTCAACATGAGACTTGATGAGGG - Exonic
1143007595 17:3846834-3846856 CAAAAATTGAGACTCCAAGAGGG + Intergenic
1143943922 17:10572661-10572683 CAAAATATGAGACTCAAGGGAGG - Intergenic
1144273319 17:13640963-13640985 GAAAGTATGAGGCTTGAAGAGGG - Intergenic
1146536401 17:33656617-33656639 TCTAAAATGAGACTTGAAGAAGG - Intronic
1147517249 17:41131680-41131702 CAAACTATAAGACTTGAAGAAGG - Intergenic
1148973374 17:51504702-51504724 AAAAATATGACATTTGAAAATGG - Intergenic
1148997278 17:51721953-51721975 CAAATTATCAAACATGAAGAGGG + Intronic
1149010527 17:51851923-51851945 CAAAATATGAGGATTTAAGATGG - Intronic
1149020082 17:51952945-51952967 CAAAATAGGAGAATTAAAAAAGG + Intronic
1149031155 17:52084111-52084133 CAGAATATAAGACTTGCAGCAGG + Intronic
1149238860 17:54624950-54624972 TAAAATATGTGATTTTAAGATGG - Intergenic
1149771652 17:59327188-59327210 GAAAATAAGAGACTTGGACAGGG + Intergenic
1149927149 17:60712760-60712782 TAAAATATGAGACTCAAAGAAGG + Intronic
1151885662 17:76921975-76921997 CAAAACGTTAGCCTTGAAGATGG + Intronic
1153585704 18:6617866-6617888 AAAAATATGAGACTCAAAGAAGG + Intergenic
1153830907 18:8921792-8921814 AAAAATATGAGACTCAAAGAAGG + Intergenic
1155448491 18:25938460-25938482 CAAAATATGAGACTCAAAGAAGG + Intergenic
1156815803 18:41309653-41309675 CAAAATATGAGAGTTGAGGAGGG - Intergenic
1156905094 18:42342760-42342782 AAAACTATGAGACTCAAAGAAGG - Intergenic
1157975701 18:52324420-52324442 CAAATTATCAAACATGAAGAAGG + Intergenic
1158210267 18:55041017-55041039 CAAAGTATGAGACTCAAAGAGGG - Intergenic
1158882312 18:61792287-61792309 CATAAGATGTGACTTAAAGATGG - Intergenic
1158928134 18:62292139-62292161 AAGAATAAGAGACTTGGAGAGGG - Intronic
1158931345 18:62326948-62326970 CAAAATAAGAGACTTGAGGAAGG + Intronic
1159033082 18:63251096-63251118 CAAAATATGAGACTTGAAGAAGG + Intronic
1159175187 18:64824022-64824044 CAAACTATAAGATATGAAGAGGG + Intergenic
1159377765 18:67615717-67615739 GAAAATATGAGACTTAAAGAAGG - Intergenic
1159672575 18:71239844-71239866 TAAAATATGAAATTTAAAGAAGG + Intergenic
1163249685 19:16119107-16119129 CAAACTTTGAGACTTGAGGGAGG - Intronic
1164136159 19:22418257-22418279 CAAATTATGAAACTTGAGGGAGG - Intronic
1164224886 19:23235002-23235024 AAGAATATGATACTTAAAGATGG - Intronic
1164843369 19:31411506-31411528 CAAAATATGAGGCATGTGGATGG + Intergenic
1165014749 19:32872490-32872512 CAAAACAAGAGACTTGAAGAAGG + Intergenic
1165880174 19:39036914-39036936 CAAAGTATGAGATTCAAAGAAGG - Intergenic
1166057942 19:40304662-40304684 CAATATATGAGATTCAAAGAAGG - Intergenic
1168220618 19:54957699-54957721 AAAAATGTGAGACTGGAGGAAGG - Intronic
1168633103 19:57972528-57972550 AAAAAGAAGAGACTTTAAGATGG + Intronic
926114282 2:10202376-10202398 CCAAATGTAAGACTTGAAGAAGG + Intronic
926678303 2:15645251-15645273 AAAAAGATGAGGCTGGAAGATGG + Intergenic
926827499 2:16921714-16921736 CAAAATGAGAAACTAGAAGAAGG + Intergenic
927064285 2:19455030-19455052 CAAAATTTCAGACTTCCAGAAGG + Intergenic
927805837 2:26145753-26145775 CAAATAATAAGGCTTGAAGAGGG - Intergenic
929145340 2:38702516-38702538 GAAAGTATGACTCTTGAAGAAGG - Intronic
929770255 2:44885795-44885817 CAAAATGTGAGACTGAAAAATGG + Intergenic
929856407 2:45642049-45642071 CAAAAAAAGAAACTAGAAGAAGG + Intergenic
929862208 2:45688929-45688951 CAACATAAGAGACTTGATGTTGG + Intronic
929925579 2:46204636-46204658 AAAAAAATGAGACTGAAAGAAGG - Intergenic
930085747 2:47495878-47495900 CAAATTATCAAACATGAAGAGGG - Intronic
930420390 2:51145446-51145468 CACAATATGAGCATAGAAGAAGG - Intergenic
930521037 2:52467960-52467982 CAAAATGTAAGACTCAAAGAAGG + Intergenic
931025783 2:58112628-58112650 GAAAATATGAGACTCAAAGAAGG + Intronic
931180771 2:59898387-59898409 TAAAATATGACACCTGTAGATGG - Intergenic
931368140 2:61637280-61637302 CAAAATGTGAAACTAAAAGAAGG - Intergenic
931453367 2:62387331-62387353 CAAAATATAAGACTCAAAGGAGG - Intergenic
931565765 2:63614240-63614262 CAAAATATGAAACTCAAAGAAGG - Intronic
931728515 2:65132786-65132808 CAAAATAAGAGACTCCAAGAAGG + Intergenic
932080418 2:68709431-68709453 CAAAAGATGAGAACGGAAGAGGG - Intronic
933071517 2:77864434-77864456 CAAAATATAAGACTCAAAGAGGG - Intergenic
934325604 2:92011576-92011598 CAAAGTATAAGACTTGAAGATGG - Intergenic
934463959 2:94242206-94242228 CAAAGTATAAGACTTGAAGATGG - Intergenic
934697691 2:96411849-96411871 CAAAATATAAGACTCAAAGAAGG - Intergenic
936835972 2:116709929-116709951 CAAAGTGTGAGACTAGAGGAAGG + Intergenic
937152866 2:119697873-119697895 CAAAATATGAGGCTCAAAGAAGG + Intergenic
937665285 2:124480153-124480175 CAAACTATGAGTCATGAAGTGGG + Intronic
938146324 2:128837465-128837487 TAAAATATGAGACTTCATTAGGG + Intergenic
940549736 2:155138850-155138872 AAAAATATGTAACTTAAAGAAGG + Intergenic
940568779 2:155404284-155404306 CAAAATATGTCACTGGTAGAAGG - Intergenic
941201870 2:162521506-162521528 GAAAATTTGAGAATTTAAGAAGG + Intronic
941967080 2:171311317-171311339 TAAAATATGAGACTCAAGGAAGG + Intergenic
942741027 2:179178326-179178348 GAAAATAAAAGACTTGCAGAGGG + Intronic
942833903 2:180269369-180269391 CAAACTATAAGAATTGTAGAAGG - Intergenic
943046197 2:182865207-182865229 CAAAACATGAGAGTGGAATAAGG + Intronic
943371745 2:187024115-187024137 GAAAACATGACACTTAAAGAGGG + Intergenic
943435721 2:187864411-187864433 CAAAACATGAGATTCAAAGAAGG + Intergenic
943608626 2:190006046-190006068 CAAAGTATGATACTTAAAGGTGG + Intronic
944714026 2:202361146-202361168 CAAAATATGAAACTCAAAGAAGG - Intergenic
945022854 2:205591626-205591648 CAAAATATGAGACATCAGGGAGG - Intronic
945544762 2:211137250-211137272 CCAAATAGGAGAGTTGAACAGGG - Intergenic
945607214 2:211949832-211949854 GAAAATATGAGAATTGAAGCAGG - Intronic
946286425 2:218707067-218707089 CAAAATATGAGACTCAAAGAAGG + Intergenic
946905188 2:224408769-224408791 CAAAATATGAGGCTCAAAGAAGG + Intergenic
946955038 2:224920406-224920428 TAAAATAAGCAACTTGAAGAAGG - Intronic
947407050 2:229789351-229789373 TACAATATGAAACTTGAACATGG - Intronic
947471297 2:230403660-230403682 CGAAATATGAGACTCCAAGAAGG - Exonic
947547175 2:231018477-231018499 CAAACTATGAGACTAAAAGAGGG - Intronic
947677734 2:231999218-231999240 ACAAATATGAGCCTAGAAGAGGG - Intronic
947782231 2:232778685-232778707 CAAAACATGAGACTTGAGGAAGG + Intronic
947986975 2:234456632-234456654 CAAAATATGAGACTCAAAGAAGG + Intergenic
1168819766 20:765002-765024 AAAAATATGAGACTCAAAAAAGG - Intronic
1168821795 20:778453-778475 CAAAATATGAGACTCAAAGAAGG - Intergenic
1170232302 20:14063507-14063529 CAAAATATGAAACTTTTTGAGGG + Intronic
1170322214 20:15112448-15112470 TAAAATCTGAAACTTGAAAAAGG - Intronic
1170621417 20:17999622-17999644 CATAACATGATACTTGAAGGAGG + Intronic
1170657329 20:18300917-18300939 AAAAATAGAAGACTTGAACAAGG + Intronic
1170724987 20:18918361-18918383 GAAAATATGCTCCTTGAAGATGG + Intergenic
1171034035 20:21702480-21702502 CCAAGTATGAGACATGAAGTGGG + Intergenic
1171139167 20:22725948-22725970 CAACATATGAGTTTTGGAGAAGG + Intergenic
1171152581 20:22840560-22840582 CAAAATCTGAGGCTTGAAACAGG - Intergenic
1171850850 20:30306939-30306961 CAATAAATGAGACCTGGAGAGGG - Intergenic
1171993692 20:31716116-31716138 CAAAATATGAGGCTCAAAGAAGG - Intronic
1172894548 20:38291350-38291372 CAAGACAGGAGACTGGAAGAAGG + Intronic
1173615252 20:44399196-44399218 CACACTATGAGACTTGATAAGGG - Intronic
1174820654 20:53724070-53724092 TAAAATTTGAGTATTGAAGAAGG + Intergenic
1176595025 21:8685370-8685392 CAAAGTATAAGACTTGAAGATGG - Intergenic
1176872016 21:14091617-14091639 GAATATATGAGTCTTGAGGAAGG - Intergenic
1176878600 21:14164180-14164202 CCAAATTTGAGATTTGAATATGG + Intronic
1176985031 21:15425880-15425902 CAAAATATGAAACTCAAAGAAGG - Intergenic
1177013278 21:15753830-15753852 CAAAATAAGAGACTTGAAGAAGG + Intronic
1177968799 21:27762013-27762035 CAAAATATGAGACTTGAAAAGGG - Intergenic
1177991183 21:28038091-28038113 CCAAATAGGAGAGTTGAACAGGG + Intergenic
1178197002 21:30357260-30357282 CAAAATATAAAACTTTAAGCAGG - Intronic
1178353733 21:31893139-31893161 CAGAATATGAGACTCCAAGAAGG + Intronic
1178754762 21:35337994-35338016 CAAGAGATGAGACTTGAACCTGG + Intronic
1180277878 22:10662528-10662550 CAAAGTATAAGACTTGACAATGG - Intergenic
1180585111 22:16881361-16881383 CAAAGTATAAGACTTGAAGATGG - Intergenic
1182244333 22:28943491-28943513 TAAAATATGAGGTTTGGAGAGGG + Intronic
949463571 3:4320486-4320508 AAAAATATGAGACTCAAAGGAGG + Intronic
949491444 3:4593399-4593421 GGAAATATGAGACCTCAAGAAGG + Intronic
949677138 3:6468690-6468712 CAAAATATCAGAATAGAACAGGG + Intergenic
953058090 3:39404383-39404405 CGAAATATAAGACTCAAAGAAGG - Intergenic
953744781 3:45566066-45566088 CAAAGTTTAAGACTTGAAGAGGG + Intronic
954897374 3:53987611-53987633 CAAGAAATGTGACTTGATGAGGG - Intergenic
955702726 3:61697807-61697829 CAAAATATGAGACTCAAAGAAGG - Intronic
955763450 3:62314881-62314903 TAAAATATGAGGCTCAAAGAGGG - Intergenic
956242560 3:67146934-67146956 CAAAATACAAGACTTAAGGAAGG - Intergenic
956246914 3:67193936-67193958 CAAAATGTAAGACTTGTAAATGG + Intergenic
957826543 3:85453434-85453456 TAAAATATGTGAATTGAAGAGGG - Intronic
957877968 3:86174052-86174074 CAAAGTATGAGACTTTAAGAAGG + Intergenic
958004751 3:87796549-87796571 CAAAATATGGATATTGAAGAGGG + Intergenic
958449055 3:94250880-94250902 CAAAATATGAGACACAAAGAAGG + Intergenic
958673192 3:97231524-97231546 TAAAACATGAGACTTGTAGAAGG + Intronic
958853523 3:99357199-99357221 CTATAAATGAGTCTTGAAGAAGG + Intergenic
959062499 3:101628765-101628787 CAAATCATGAGACATAAAGAAGG + Intergenic
960421734 3:117454674-117454696 TAAAATATAACACTAGAAGATGG + Intergenic
960452621 3:117829171-117829193 CCAAATATAGGACTGGAAGAGGG - Intergenic
960766790 3:121139735-121139757 AAATGTATGAAACTTGAAGAGGG + Intronic
961108619 3:124264180-124264202 CAAAACTTGAAACTTTAAGAGGG - Intronic
961224083 3:125223472-125223494 AAAAATATGTGACTTGAACGAGG + Intergenic
962002033 3:131307988-131308010 AAATATGTGACACTTGAAGAAGG + Intronic
962402716 3:135075124-135075146 CAAAGTATGAGCCTTTAAGCAGG + Intronic
962972980 3:140422157-140422179 GAAAATATGAGAATATAAGAGGG - Intronic
963849909 3:150200871-150200893 CACAATATGAGACTCAAAGAAGG - Intergenic
963982939 3:151560414-151560436 AAAAATATGAGACTGTAAGAAGG - Intergenic
965183863 3:165438048-165438070 CAAAATACGAGAATCAAAGAAGG - Intergenic
965341610 3:167498361-167498383 CAAAATATGAGACTCAAAGAAGG + Intronic
965348330 3:167580255-167580277 CAAAATTAGAGAATTAAAGATGG - Intronic
965831227 3:172791463-172791485 CTAAATAAGATAATTGAAGAAGG - Intronic
966084498 3:176052786-176052808 CATCATAGGAGACTTGAGGAGGG - Intergenic
966163971 3:176996423-176996445 CACAATATTAGACTTTAAGGGGG + Intergenic
966737078 3:183195595-183195617 CAAATTATGTGACTTGATGAGGG + Intronic
967064598 3:185903593-185903615 CTAAATTTGAGAGTTGAATAAGG - Intergenic
968881999 4:3305756-3305778 CAAATCATGACACTTGAACAAGG - Intronic
970564779 4:17321265-17321287 AAAGACATGAGACTTAAAGAAGG - Intergenic
970697820 4:18698180-18698202 CAAAATATGAGGTTCAAAGAGGG + Intergenic
970903318 4:21185516-21185538 GAAAATAGGAGATTAGAAGAAGG - Intronic
971759967 4:30752954-30752976 AAAAATATTAGACTTCAACACGG + Intronic
972048012 4:34693589-34693611 CCAAATAGGAGATTTGAATAAGG + Intergenic
972364235 4:38359074-38359096 GAAGATGTGACACTTGAAGATGG - Intergenic
972364695 4:38363420-38363442 CAAAATATGAGTTTCAAAGAAGG - Intergenic
972942512 4:44214162-44214184 CAAAATAAGAGATTCAAAGAAGG - Intronic
973102816 4:46293837-46293859 CCAAATAGGAGACTTGAATGGGG - Intronic
973229953 4:47829498-47829520 CAAATTATCAAACCTGAAGAGGG + Intronic
974433827 4:61832157-61832179 CAATGTATGAGACTTGGAGAGGG + Intronic
974975231 4:68883197-68883219 CAATATATGAGAATTGAATGAGG - Intergenic
975208145 4:71667922-71667944 AAAAATATGAGACTTGAAGAAGG + Intergenic
975386838 4:73768432-73768454 CCAAATAGGAGAGTTGAACAGGG + Intergenic
976302064 4:83524713-83524735 CAAAATATGGAACTTGAAAAGGG - Intergenic
977349060 4:95857367-95857389 CAACATTTGAGACTCAAAGAAGG + Intergenic
977598404 4:98909727-98909749 AAAAAAATGAGAGCTGAAGATGG - Intronic
977673051 4:99717560-99717582 CAAAATATAAGACTCAAAGAAGG - Intergenic
977718883 4:100215400-100215422 CAAGATATGAGACAAGAATATGG + Intergenic
977759442 4:100714559-100714581 AAAAACATGAGACTTCAATAAGG - Intronic
977930523 4:102744731-102744753 TCAAATAGGAGACTTGAACAGGG + Intronic
979746366 4:124218454-124218476 CAAAATTTAAAACTTGAAGAAGG - Intergenic
979888666 4:126063081-126063103 CCAAATAGGAGAGTTGAACAGGG + Intergenic
980087939 4:128410554-128410576 CAAAATATAAAAGTAGAAGATGG - Intergenic
980270529 4:130578188-130578210 TAAAATATGAGACTTGTAAATGG - Intergenic
980687210 4:136243740-136243762 TTAAATATAAGACTTGAAGCTGG + Intergenic
980715631 4:136625001-136625023 GAAAATATGATACTTGAAATTGG + Intergenic
981252127 4:142615962-142615984 CAAAATATGAGACTTAAAGAGGG + Intronic
981662417 4:147183602-147183624 AAAAAAAAGAAACTTGAAGATGG + Intergenic
981867834 4:149446810-149446832 AAAACTATGAAACCTGAAGATGG + Intergenic
982094191 4:151906201-151906223 AAAAATATGAGGCTTAAAGATGG + Intergenic
982128218 4:152202912-152202934 CAAAATATGTGACTGGACCAGGG + Intergenic
982141388 4:152323045-152323067 AAAACTATGGGACTTGAAAACGG - Exonic
982451909 4:155563115-155563137 CGACATTTGACACTTGAAGAAGG + Intergenic
982459240 4:155647601-155647623 AAAAATAAGACACTTCAAGAAGG + Intergenic
982835419 4:160115710-160115732 CCAAATAGGAGAGTTGAACAGGG - Intergenic
983053674 4:163077736-163077758 CAAAGAATGAGACTCAAAGAGGG + Intergenic
983249635 4:165329166-165329188 AAAAATATGAGAATTGAAGCTGG - Intronic
983253164 4:165367919-165367941 GTAAATATGAGAGTAGAAGAAGG - Intronic
983392000 4:167143862-167143884 CAAAATAATAGACATGAACAAGG + Intronic
984256053 4:177391395-177391417 AAAAATATGAGACTGAAAGCAGG + Intergenic
984563224 4:181295932-181295954 CAAAGTATGAGACTGAAAGAAGG + Intergenic
984859421 4:184223807-184223829 AAAAATATGAGACCTGAAGAAGG + Intergenic
985200247 4:187477210-187477232 CAAAACATGATGCTTGAACAGGG + Intergenic
985265090 4:188149723-188149745 CAGAGTTTGAGACTTGCAGAGGG + Intergenic
986377244 5:7144663-7144685 CAAAAGCTGAGGCTTGAAGGTGG + Intergenic
987233654 5:15921073-15921095 TCAAATATAAGACTTGAAAAAGG - Intronic
987574175 5:19704486-19704508 CAACATATGATACGTGAAGAGGG + Intronic
988073982 5:26328034-26328056 CAAAATAGGAAATTTGAAGTGGG - Intergenic
988131409 5:27111417-27111439 CAAATTATGCCACTTGAAGAAGG + Intronic
988347189 5:30052964-30052986 CAAAATATGAGAAATTCAGATGG - Intergenic
988474359 5:31570199-31570221 CAAACTATGAGACTCAAAGAAGG - Intergenic
988556713 5:32242802-32242824 CAAATTATGAGACGTGTAGCAGG + Intronic
988562012 5:32289946-32289968 CCAAATAGGAGAGTTGAACAGGG - Intronic
988670936 5:33380969-33380991 CTAAAAATGACTCTTGAAGATGG - Intergenic
988829890 5:34977179-34977201 CAAATTATCAAACCTGAAGAGGG - Intergenic
990261052 5:54022708-54022730 CACAATATGAGACTCAAAAAAGG - Intronic
990925269 5:61014496-61014518 GAAATTATCAGACTTGAGGAGGG + Intronic
990980602 5:61599591-61599613 CAATTTGTGAGACTTGGAGATGG + Intergenic
991127114 5:63081681-63081703 CAAAGTAAGAGACTTGAAAAAGG - Intergenic
991303379 5:65150405-65150427 CAGGATGTGAAACTTGAAGATGG + Exonic
991550965 5:67835419-67835441 CAAACCATGTGACTTGAGGAGGG - Intergenic
992536356 5:77708267-77708289 GAAAAAATGAGAGCTGAAGACGG - Exonic
993003804 5:82409698-82409720 CAAAAAAAGAGACTTTTAGAAGG + Intergenic
993412686 5:87592743-87592765 CCAAATAGGAGAGTTGAACAGGG + Intergenic
993763842 5:91831130-91831152 CACAAAATGAGACTTGAATCTGG + Intergenic
993780583 5:92061462-92061484 CCAAATAGGAGAGTTGAACAGGG - Intergenic
994120857 5:96111124-96111146 CAAATTATCAGACTTGAGGAGGG - Intergenic
994204534 5:97019615-97019637 GGAAATCTGACACTTGAAGATGG - Intronic
994238892 5:97396909-97396931 CAAAATATGAGACACAAAGAAGG + Intergenic
995119541 5:108521074-108521096 CAAAATATGAGACTCAACGAAGG + Intergenic
996169035 5:120265509-120265531 AGAAATATGAGAATTGGAGAAGG - Intergenic
996507660 5:124286501-124286523 CAAAATATGAGACTCAAAGAAGG + Intergenic
997079450 5:130721588-130721610 TAAAATATGAGACTCAAAGAAGG + Intergenic
997202425 5:132019366-132019388 CAAAAAATCAGACTAGAAGAGGG + Intergenic
997985570 5:138498900-138498922 CAAATTATCAAACTTGAAGAGGG - Intergenic
999695075 5:154181556-154181578 CAAAATATGAAACTCAAAGAAGG - Intronic
999827159 5:155284707-155284729 CAAAATATGAGACTTGAAGAAGG - Intergenic
999909348 5:156180701-156180723 CAAATTATGAGACTTGAAGAGGG + Intronic
1000095191 5:157965550-157965572 CATAATATTAGACTTTAAGCAGG - Intergenic
1000169842 5:158691254-158691276 GCAAATATGAGACTCAAAGAAGG - Intergenic
1000229720 5:159304210-159304232 CAAAAGATGAGACTCAAAGAAGG + Intergenic
1000584020 5:163073077-163073099 GAAAATATGACATTTGAAGGAGG + Intergenic
1001294882 5:170492216-170492238 CAAATTATTAGACCTGAGGAAGG - Intronic
1001359568 5:171067992-171068014 CACATTATGAGAATTAAAGAAGG - Intronic
1001929209 5:175660813-175660835 CAAGATAAGAGACAAGAAGATGG - Intronic
1002558098 5:180060040-180060062 CAAAGTCAGAGACTTGAAGATGG + Intronic
1003470035 6:6420996-6421018 CCAAATAGGAGAGTTGAACAGGG + Intergenic
1004257827 6:14081167-14081189 CAAGGTATGAGACATGAAGAGGG + Intergenic
1004749782 6:18550002-18550024 CAAGATAAGAGATCTGAAGATGG + Intergenic
1004828751 6:19453734-19453756 TAAAATATGAGATATGGAGAAGG - Intergenic
1005507714 6:26484258-26484280 CAAAATATGAGACTCAAAGAAGG + Intergenic
1007849666 6:44791217-44791239 CAAAATATAAAAATTGAACAGGG + Intergenic
1008909283 6:56715944-56715966 TCAAATATGAGACTCAAAGAAGG - Intronic
1008975871 6:57426038-57426060 TCAAATATGATAATTGAAGATGG + Intronic
1009036589 6:58124516-58124538 TAAGATATGAGACTCAAAGAAGG + Intergenic
1009164399 6:60323161-60323183 TCAAATATGACAATTGAAGATGG + Intergenic
1009212400 6:60878140-60878162 TAAGATATGAGACTCAAAGAAGG + Intergenic
1009670416 6:66741407-66741429 CAAAATATGAGACATCGAGCAGG - Intergenic
1009770449 6:68137777-68137799 CCAAATAGGAGATTTGAACAGGG + Intergenic
1009772591 6:68161895-68161917 CAACATATGGGAATTCAAGATGG - Intergenic
1010938361 6:81887348-81887370 CCAAATAGGAGAATTGAACAGGG + Intergenic
1011039472 6:83014209-83014231 CCAAATAAGAGAGTTGAACAGGG + Intronic
1011355355 6:86467727-86467749 GAAAATATGATACTGGAAGAAGG + Intergenic
1011824945 6:91294947-91294969 CAAAATATGAGACTCAAGGAAGG + Intergenic
1012009270 6:93760273-93760295 CAAAATATATGACTAGAAAATGG + Intergenic
1012242388 6:96888371-96888393 CAAACTAAGATACTTGAAAAGGG - Intergenic
1013507847 6:110816937-110816959 CAAAATATGAGACTCAAAGAAGG - Intronic
1014209521 6:118693250-118693272 CAAAATATGAGGTTTGGAAATGG - Intronic
1014635693 6:123843673-123843695 CGAAATATGAGACTTAAGAAAGG + Intronic
1015065413 6:129020421-129020443 CAAAGTATGAGACTTAAAGAGGG + Intronic
1015595915 6:134866438-134866460 CAAAATATAATACCTGGAGATGG - Intergenic
1016175016 6:141070000-141070022 CCAAATAGGAGAGTTGAACAGGG + Intergenic
1016998994 6:149982627-149982649 CAAAAAATGTCACTTGAAAATGG - Intergenic
1017000388 6:149992467-149992489 CAAAAAATGTCACTTGAAAATGG + Intergenic
1017363595 6:153605446-153605468 CAATAGAGGAGACTAGAAGAAGG + Intergenic
1017630225 6:156389729-156389751 TAAAAAATGAAACTTGAAGGGGG + Intergenic
1018201863 6:161402651-161402673 CAGAATATGAGACTCCAAGAAGG + Intronic
1018215801 6:161526839-161526861 CAAAATATAAGGCTCAAAGAAGG + Intronic
1018239238 6:161755952-161755974 TAAAATGTGAGCCTTGAAAAAGG + Intronic
1018535132 6:164811399-164811421 CAAAATAGGAGAATTGAATGGGG + Intergenic
1018575176 6:165252243-165252265 CAAAAAATAAGATTTCAAGAAGG - Intergenic
1019790813 7:3012630-3012652 CAAAAAATGAGATGAGAAGATGG + Intronic
1019851063 7:3558012-3558034 CAAACTATGAGACAGGAACAGGG - Intronic
1020580051 7:9986088-9986110 CAATTTATGCAACTTGAAGATGG + Intergenic
1021390661 7:20088933-20088955 TAAAATTTTAAACTTGAAGATGG + Intergenic
1021417675 7:20406920-20406942 CAAAATATGTAACTTCAAAAGGG - Intronic
1021462956 7:20909775-20909797 CAAAAAAGGAGACTGGCAGATGG - Intergenic
1022484569 7:30768443-30768465 AAAAATCATAGACTTGAAGAGGG - Intronic
1022825674 7:34010436-34010458 CAAAATATAAGAATGGAAAATGG - Intronic
1023108275 7:36784887-36784909 CAAAATATGAGACTGAAAGATGG + Intergenic
1024411421 7:49047325-49047347 TAAATTAAGAGTCTTGAAGAGGG - Intergenic
1025774436 7:64547343-64547365 AAGAATATGATACTTGAGGATGG - Intronic
1027525857 7:79267765-79267787 CAAAATTTGAGACTCAAAGAGGG + Intronic
1027685687 7:81277071-81277093 CCAAATAGGAGAGTTGAACAGGG - Intergenic
1027715320 7:81662221-81662243 CCAAATTAGAAACTTGAAGATGG + Intergenic
1028095639 7:86756930-86756952 CAAAATAATAAACTTGAAAATGG - Intronic
1028280138 7:88914408-88914430 AAAAACATGTGACTTGAAGAGGG + Intronic
1028939174 7:96501388-96501410 CTAAATCAGAGAGTTGAAGAAGG - Intronic
1029328302 7:99829096-99829118 CAATATATGAGACTAAAATAAGG - Intronic
1029738998 7:102481353-102481375 TATAATAAGAGACTTGAAGCTGG - Intergenic
1029756999 7:102580530-102580552 TATAATAAGAGACTTGAAGCTGG - Exonic
1029774938 7:102679592-102679614 TATAATAAGAGACTTGAAGCTGG - Intergenic
1030276081 7:107723131-107723153 AAATATGGGAGACTTGAAGAGGG + Intergenic
1030560857 7:111084096-111084118 GAAAAGATGAGACTGGAAGCAGG + Intronic
1030653374 7:112139786-112139808 CAGAATAGGAGGTTTGAAGAGGG + Intronic
1030904082 7:115161449-115161471 AAAAATATGACATTTAAAGAAGG - Intergenic
1030998197 7:116384176-116384198 CATGAGATGGGACTTGAAGATGG - Intronic
1031136757 7:117892976-117892998 CAAAATATGAGGCTCAAAGAAGG - Intergenic
1031584037 7:123512589-123512611 AAAAATATGAGACTAAAATAAGG - Intronic
1032587724 7:133163134-133163156 CAGAATCTGTGAGTTGAAGAGGG + Intergenic
1032639361 7:133748804-133748826 CAAAATTTCAGACTTCCAGAAGG + Intronic
1033176063 7:139124777-139124799 CAAAATATGAGATTCAAAGAAGG - Intergenic
1033224530 7:139550135-139550157 CAAAGTAGGAAACTTGCAGATGG + Intergenic
1034927077 7:155131059-155131081 CAAATTATCAAACTTAAAGATGG - Intergenic
1035944527 8:3946699-3946721 CAAAATATGAAAAATGAAAAGGG - Intronic
1035957580 8:4099239-4099261 CAAAGAAAGACACTTGAAGAGGG - Intronic
1036047564 8:5160703-5160725 AAAAATAAGAGACTTGAGGAAGG - Intergenic
1036095028 8:5714277-5714299 CAAAATATAAAAATTGAAAATGG - Intergenic
1036615907 8:10387432-10387454 CAAACTATGAGACTCTAAGAAGG + Intronic
1037177005 8:15959397-15959419 CAAAATATGAAAATTGCAGGAGG - Intergenic
1037281938 8:17251075-17251097 CAAAGTATGGGCCTTGCAGAGGG - Intronic
1037736618 8:21572069-21572091 CAAATTATGAAACCTGAGGATGG + Intergenic
1038081668 8:24144261-24144283 CAAAATGTGAGAAATGATGAGGG + Intergenic
1038091932 8:24263789-24263811 CAGAAAATGAGGCTTGAAAAGGG - Intergenic
1038302295 8:26363842-26363864 CAAAATTTGGGACTTAAATATGG + Exonic
1038608865 8:29040240-29040262 CAAAATATGGGCCTTGATTATGG - Intronic
1039234988 8:35492635-35492657 CAAAATATGAGACTCAAAGAAGG + Intronic
1039553757 8:38461973-38461995 TAGAATATAAGACATGAAGATGG - Intronic
1039727066 8:40229792-40229814 TAAAATATGAGACTCAAAGAAGG - Intergenic
1039790287 8:40870337-40870359 CCAAATATGAGACTTGAGGAAGG - Intronic
1039909394 8:41812330-41812352 CAAAATATGAGACTCAAAGAAGG + Intronic
1039910250 8:41820791-41820813 CAAAATATGAGACTTGATGAAGG + Intronic
1040356746 8:46625784-46625806 CAAATTATCAAACATGAAGAGGG + Intergenic
1041422748 8:57687184-57687206 CAAGACTTGAGACATGAAGAAGG + Intergenic
1041437815 8:57861713-57861735 AAAAATATGAGACTTCAGGAAGG + Intergenic
1041911032 8:63088278-63088300 CAAAGTATGAGACTTAAAGAAGG + Intergenic
1042060752 8:64814600-64814622 CTAAATCTTAGACTTGAAAATGG - Intergenic
1042256289 8:66807288-66807310 GATAATATGAGACTTGAACTTGG + Intronic
1042427945 8:68670715-68670737 GCAAATATGAGACTCAAAGAAGG - Intronic
1042468385 8:69154816-69154838 CAAAATTTGAGACCTGGAAATGG + Intergenic
1042657751 8:71118951-71118973 AAAAATATAAAACTTGAAGAAGG - Intergenic
1043132082 8:76474200-76474222 CACAAAATGAGACTTGAAGAAGG + Intergenic
1043228677 8:77769607-77769629 CAACATTTCAGGCTTGAAGATGG + Intergenic
1043564639 8:81534489-81534511 CAGAATATGAGAGTTAAAGTTGG - Intergenic
1043815742 8:84799058-84799080 CAAAACATGGGACTAGAAGTTGG + Intronic
1043934361 8:86126724-86126746 AAAAATATGATACTAGAATATGG + Intronic
1044578708 8:93800443-93800465 CTGAATATGGGACTTGAATATGG + Intronic
1044616951 8:94152180-94152202 GAATATATGAGAGTTTAAGAAGG - Intronic
1045370809 8:101520912-101520934 CACAAATTGAGACTTGCAGAAGG - Intronic
1045400357 8:101810087-101810109 CAAAATGTGTGACTTTAAGCTGG - Intronic
1046290153 8:112148653-112148675 CAAAATATGAGAAGTGAGGTAGG + Intergenic
1047963306 8:130026711-130026733 CAAAACGTGAGTCTCGAAGAAGG - Intergenic
1048388972 8:133942418-133942440 CAACTTATGAACCTTGAAGATGG - Intergenic
1048538361 8:135318834-135318856 CTAAAAATGAGATGTGAAGAAGG - Intergenic
1050411817 9:5373954-5373976 ACAAATATGGGATTTGAAGAGGG - Intronic
1050500552 9:6293737-6293759 CAAATTATGGAACCTGAAGAGGG - Intergenic
1050629857 9:7547239-7547261 TAATATATGACACTTTAAGAGGG + Intergenic
1051854831 9:21552299-21552321 CAAAATGTGAGCCCTGAAAAGGG + Intergenic
1052552953 9:29974677-29974699 CCTAATATGAGATTTGAAAATGG - Intergenic
1052590311 9:30483983-30484005 CTAAATGTGAGACTTGAAACTGG - Intergenic
1052975990 9:34410508-34410530 CAAAAAATAAAACTTGTAGAGGG + Intronic
1053539752 9:38961490-38961512 ATAAATATGAGACTCAAAGAAGG + Intergenic
1053694050 9:40619004-40619026 CAAAGTATAAGACTTGAAGATGG - Intergenic
1053852209 9:42300600-42300622 AAAAATATGAGACTCAAAGAAGG + Intergenic
1053941041 9:43249423-43249445 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054270785 9:63021123-63021145 CAAAGTATAAGACTTGAAGACGG + Intergenic
1054305295 9:63418228-63418250 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054404042 9:64742217-64742239 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054437663 9:65227717-65227739 CAAAGTATAAGACTTGAAGATGG - Intergenic
1054492740 9:65794250-65794272 CAAAGTATAAGACTTGAAGACGG + Intergenic
1054626389 9:67402428-67402450 ATAAATATGAGACTCAAAGAAGG - Intergenic
1055064277 9:72102873-72102895 GATGATATGAGACTAGAAGAAGG + Intergenic
1055245352 9:74234873-74234895 GAAAATGTGAGGCTAGAAGAAGG - Intergenic
1055521196 9:77082561-77082583 CAAAGTTTGAGACTCAAAGAAGG - Intergenic
1055524032 9:77111775-77111797 CAAAATATGAGAATCAAAGAAGG - Intergenic
1055917540 9:81421083-81421105 CAAAATATAAAACTCAAAGAAGG - Intergenic
1055937191 9:81614215-81614237 CTAAAAAGGAGACTTGAAAAGGG - Intronic
1056018888 9:82421585-82421607 CAAACTCCCAGACTTGAAGATGG - Intergenic
1056314358 9:85373878-85373900 CCAAATAGGAGAGTTGAACAGGG + Intergenic
1056413965 9:86358670-86358692 CAAAGTATGAAACTCAAAGAAGG + Intergenic
1057766135 9:97921046-97921068 CAAAATATGAGACCTGTAATCGG + Intronic
1058833219 9:108837838-108837860 CAAATTATCAAACCTGAAGAAGG + Intergenic
1059830121 9:118085971-118085993 CAAGATATGACTCTTGAAGCTGG + Intergenic
1060150246 9:121283922-121283944 TAAAAAGTGAGACCTGAAGAGGG + Intronic
1060862220 9:126963928-126963950 CTACATATGAGACTGGGAGATGG + Intronic
1185718396 X:2362182-2362204 TGAAATATGAGTCTTGAAAATGG - Intronic
1186248493 X:7640406-7640428 CAAAATATGAGACTCAAAGAAGG + Intergenic
1186291358 X:8103324-8103346 TAAAATATAAGACTCAAAGAAGG - Intergenic
1186380434 X:9053055-9053077 CAAAATAAGATAGCTGAAGAAGG - Intronic
1186380590 X:9054699-9054721 CAAAATAAGATAGCTGAAGAAGG + Intronic
1186541989 X:10410227-10410249 CAAAATACCAGACTTCCAGAAGG - Intergenic
1186746843 X:12578153-12578175 CCAAATATGATATTTGGAGATGG - Intronic
1186801730 X:13099516-13099538 CAAAATATGATACTAAAAGAAGG + Intergenic
1186980181 X:14950274-14950296 CAAAATATGAAAGTCTAAGAAGG - Intergenic
1187937788 X:24352801-24352823 CAAATTGTCAGACTTGAAGGTGG + Intergenic
1188015831 X:25107140-25107162 GAAAAAATGGGACTTTAAGAAGG - Intergenic
1188330650 X:28867008-28867030 GACAATATGAGAGTTGAAGAAGG + Intronic
1188430550 X:30101991-30102013 CAAAGTATGATAGTTGAAGAAGG - Intergenic
1188472816 X:30559271-30559293 CATAATATTACACTTGATGAAGG - Exonic
1188615140 X:32149063-32149085 CAAAATATGAAAGTAGAAAAAGG + Intronic
1188683533 X:33041506-33041528 GAAAAAATGAGAGCTGAAGATGG + Intronic
1188907604 X:35806915-35806937 CAAAATATGAAATTCAAAGAAGG - Intergenic
1188911295 X:35851218-35851240 CAAAATATGAAACTCAAAGAAGG + Intergenic
1190417180 X:50191498-50191520 AAAAGTATGAGACTTGGAGTAGG + Intronic
1190504181 X:51109711-51109733 CAAAATGTGAGACTGCAAGAAGG - Intergenic
1190538251 X:51450265-51450287 CCAAATAGGAGAGTTGAATAGGG - Intergenic
1191161297 X:57331973-57331995 CAAAATATCAGAGTTGACCAAGG - Intronic
1191980129 X:66916404-66916426 CAAATTAGGAGAATTAAAGAAGG - Intergenic
1192103049 X:68286061-68286083 TAAAATATGACCCTTGAACAAGG - Intronic
1192323055 X:70107761-70107783 CAAACTATGAGACTTCAAGAAGG + Intergenic
1192324278 X:70119006-70119028 CAAATTATGAGACTTGTAGAAGG + Intergenic
1193596721 X:83455276-83455298 CAAAATATGAGAATGGTAAATGG - Intergenic
1193975073 X:88108286-88108308 AAAAATAGGAGAGATGAAGATGG + Intergenic
1194322285 X:92463724-92463746 AAAAAAATGAGACTTGAAGGTGG + Intronic
1196492604 X:116286169-116286191 CAAAATATGAGACTTACAGAGGG + Intergenic
1197793815 X:130280516-130280538 CAAAATATGTTACTGGTAGAGGG - Intergenic
1198520086 X:137443773-137443795 AAAAACATAAGACTTGAGGAAGG - Intergenic
1198853341 X:140989481-140989503 CAAAATATGGAACTTAAAGATGG - Intergenic
1199060296 X:143348077-143348099 CAAAATATGAGTATTGCTGAAGG + Intergenic
1199780911 X:151058530-151058552 AAAGATATGAGACTTCATGAAGG - Intergenic
1200630441 Y:5577201-5577223 AAAAAAATGAGACTTGAAGGTGG + Intronic
1201191821 Y:11450557-11450579 CAAAGTATAAGACTTGAAGATGG - Intergenic
1201767571 Y:17586843-17586865 GAAAGTATGAGTATTGAAGAAGG - Intergenic
1201833982 Y:18319142-18319164 GAAAGTATGAGTATTGAAGAAGG + Intergenic