ID: 1159036909

View in Genome Browser
Species Human (GRCh38)
Location 18:63286286-63286308
Sequence CCTTTTACACAGTTGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159036903_1159036909 -5 Left 1159036903 18:63286268-63286290 CCAAATATGAATTGAGCACCTTT 0: 1
1: 0
2: 3
3: 25
4: 244
Right 1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159036909 Original CRISPR CCTTTTACACAGTTGGGGGC AGG Intronic
900777632 1:4596536-4596558 CCTTTTACACAGTGATGAGCAGG + Intergenic
901068177 1:6504464-6504486 CCTCCTCCACAGTGGGGGGCTGG + Intronic
901687286 1:10949899-10949921 CCTTTTCCACAGGTGGGGAACGG + Intronic
901756747 1:11446028-11446050 CCTTTTGCACAGGTGGGCACAGG + Intergenic
903035060 1:20487420-20487442 CCTTTTACACCGTTTGGAGAGGG - Intergenic
904349458 1:29895555-29895577 CCTGATGCATAGTTGGGGGCTGG + Intergenic
905534612 1:38710844-38710866 CCTCTTCCCCAGTTGGGGGAGGG - Intergenic
905620018 1:39437029-39437051 CCATTTACACAGCTGGTGGAGGG + Intronic
906593527 1:47051265-47051287 ACTTTTACACTGTTGGTGGCAGG + Intergenic
906593715 1:47053524-47053546 ACTTTTACACTGTTGGTGGGAGG - Intergenic
907384697 1:54118430-54118452 CCTGTTACAGAGTGGGAGGCAGG - Intergenic
908283798 1:62571436-62571458 ACTTTTACACTGTTGGTGGGAGG + Intronic
908778471 1:67665781-67665803 ACTTTTACACTGTTGGTGGGAGG - Intergenic
909343495 1:74557954-74557976 CCTTTTACACTGTTGGTGGGAGG + Intergenic
909557028 1:76965218-76965240 GCTTTTACACTGTTGGTGGGGGG - Intronic
912007352 1:104920730-104920752 ACTTTTACACTGTTGGTGGGAGG + Intergenic
915685542 1:157628909-157628931 TATTTTTCACAGTTGGAGGCTGG + Intergenic
917199536 1:172500199-172500221 TATTTTACAAAGTTGGGGGGTGG + Intergenic
917884907 1:179374359-179374381 GCTTTTACACTGTTGGTGGGAGG + Intronic
919452886 1:197791115-197791137 CCTTGTACACTATTGGGGGAGGG - Intergenic
922047169 1:221957262-221957284 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1068360534 10:55971822-55971844 CTTTTTAATCAGTTGGGTGCAGG - Intergenic
1068441550 10:57061930-57061952 ACTTTTACACTGTTGGTGGGAGG + Intergenic
1068765933 10:60763482-60763504 ACTTTTACCTTGTTGGGGGCCGG - Intergenic
1068959220 10:62849879-62849901 ATTTTTCCACAGATGGGGGCTGG - Intronic
1070661636 10:78310728-78310750 CCTTTGACACAGAGGGTGGCTGG + Intergenic
1071727911 10:88218374-88218396 CCTTTTCCACAATGGTGGGCGGG + Intergenic
1074934535 10:118164629-118164651 CCTTTTACACATGAGGAGGCAGG + Intergenic
1075590972 10:123691479-123691501 CCTTTTACATGCTTGGGTGCAGG + Exonic
1078322109 11:10345546-10345568 ACTTTTACACTGTTGGTGGGAGG + Intronic
1079304605 11:19311272-19311294 CCTTTTACCCATTTGGGTGGGGG - Intergenic
1080723651 11:34873285-34873307 ATTTTTCCACAGATGGGGGCAGG - Intronic
1081493030 11:43581662-43581684 TCTGTTAAAAAGTTGGGGGCGGG - Intronic
1081550731 11:44109539-44109561 CCTGTCACACTTTTGGGGGCTGG - Intronic
1082841384 11:57692950-57692972 CTTTTTCCACAGATGGGGGCTGG + Intronic
1084491480 11:69480984-69481006 CCTGTTACACAGTTGCTAGCGGG - Intergenic
1086055656 11:82643109-82643131 ACTTTTTCAGTGTTGGGGGCGGG - Intergenic
1086789365 11:91016282-91016304 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1087627268 11:100609531-100609553 ACTTTTACACTGTTGGTGGGAGG + Intergenic
1089211500 11:116806846-116806868 CCTTTTACAGAGTTTGAGGCTGG - Intergenic
1089934732 11:122352426-122352448 ACTTTTACACTGTTGGTGGGAGG + Intergenic
1091838275 12:3601349-3601371 TCCACTACACAGTTGGGGGCGGG - Intergenic
1092304752 12:7287929-7287951 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1093504222 12:19845925-19845947 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1094115143 12:26903341-26903363 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1095090323 12:38098644-38098666 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1095176780 12:39101603-39101625 ACTTTTACACATTTGTGGGAAGG + Intergenic
1097367869 12:58740136-58740158 GCTTTTACACTGTTGGTGGGTGG - Intronic
1098927239 12:76364035-76364057 ACTTTTACACTGTTGGTGGGAGG + Intronic
1099123219 12:78718938-78718960 CCTTTTACAAAGATGGGAGGGGG - Intergenic
1102803205 12:115755611-115755633 ACATTTACAGAGTTGTGGGCAGG + Intergenic
1102837528 12:116079392-116079414 CCTTTTGCAGAGATGGGGGAGGG + Intronic
1103127732 12:118438748-118438770 TAGTTTTCACAGTTGGGGGCAGG - Intergenic
1104260529 12:127177916-127177938 ACTTTTTCACAGTTGTGGGTAGG + Intergenic
1108847909 13:54697941-54697963 CCTTGTACAAAGTTGTGGTCAGG - Intergenic
1109988001 13:70016298-70016320 CTTTTAACTCAGTAGGGGGCAGG - Intronic
1111867153 13:93783437-93783459 GCTTTTACACTGTTGGTGGGAGG - Intronic
1113454659 13:110439576-110439598 CCCTTTACAAAGTTGTGGGGAGG - Intronic
1113782980 13:112987077-112987099 CCTTTTACACAGATGGCACCCGG + Intronic
1114133034 14:19815278-19815300 GCTTTTACACTGTTGGTGGAAGG - Intronic
1114971563 14:28036237-28036259 CATTTTACACTGTTGGTGGGAGG + Intergenic
1115059004 14:29168323-29168345 CCTTTAACCCGGTAGGGGGCAGG - Intergenic
1115720605 14:36157020-36157042 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1117582417 14:57165471-57165493 TCTTTCACACAGTTGGTGGAAGG + Intergenic
1118540533 14:66818709-66818731 ACTTTTACACTGTTGGTGGGAGG - Intronic
1119536549 14:75407681-75407703 GCTTTTATACTGTTGGTGGCAGG - Intergenic
1120559141 14:85969640-85969662 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1120717852 14:87859543-87859565 GCTTTTACACTGTTGGTGGGAGG + Intronic
1123223424 14:106877858-106877880 CCTTTTACACAGTCAGTGGCTGG - Intergenic
1123576123 15:21671090-21671112 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1123612744 15:22113564-22113586 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1125329505 15:38568222-38568244 ACTTTTACACTGTTGGTGGGAGG - Intergenic
1128055887 15:64699929-64699951 CCTTTTAGAAAGTTAGGGGCAGG + Intronic
1128121048 15:65146818-65146840 CCTTTTAAATTGTTGGGGGCAGG - Intergenic
1130153595 15:81331182-81331204 CCTTTTAAGCAGTCGGTGGCCGG + Intergenic
1131361945 15:91800691-91800713 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1131534290 15:93221690-93221712 CCTTTTAAGCAGTCGGTGGCTGG + Intergenic
1132254470 15:100363850-100363872 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1202984991 15_KI270727v1_random:405335-405357 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1132957155 16:2600419-2600441 TCTGGGACACAGTTGGGGGCTGG + Exonic
1132969498 16:2678831-2678853 TCTGGGACACAGTTGGGGGCTGG + Intergenic
1137489042 16:48915496-48915518 CCTTTTACACTGTTGGTGAGAGG - Intergenic
1141154440 16:81587424-81587446 CCTGTGACCCAGTGGGGGGCCGG + Intronic
1143423793 17:6816838-6816860 GCTTTTACACTGTTGGTGGGAGG - Intronic
1144790782 17:17857708-17857730 GCTGTTACACAGGTAGGGGCTGG + Intronic
1146526745 17:33573220-33573242 CCTTTAACACAGGTTGGAGCAGG - Intronic
1146608335 17:34282559-34282581 ACTTTTACACTGTTGGTGGGAGG + Intergenic
1146910781 17:36647063-36647085 CCATTTACAGGGTTGGGGTCTGG + Intergenic
1147195672 17:38765113-38765135 CGTTCTACACAGCTGGAGGCGGG + Intergenic
1149721265 17:58846876-58846898 ACTTTTACACTGTTGGTGGGAGG - Intronic
1151323460 17:73365209-73365231 GCTTTTGCAAAGTGGGGGGCTGG + Intronic
1151410476 17:73924001-73924023 TCTTTTAAACTGATGGGGGCAGG - Intergenic
1153002617 18:469670-469692 CCAGTAAAACAGTTGGGGGCGGG - Intronic
1154459057 18:14561169-14561191 CCTTTTACACTATTGGCGGAGGG - Intergenic
1155927387 18:31671353-31671375 ACTTTTACACTGTTGGTGGGAGG - Intronic
1156560765 18:38122984-38123006 ACTTTTACATTGTTGGGGGTAGG + Intergenic
1159036909 18:63286286-63286308 CCTTTTACACAGTTGGGGGCAGG + Intronic
1159572978 18:70141616-70141638 CCTGTCACAGAGTTGGGGGTTGG + Intronic
1163214475 19:15865560-15865582 CCTTATACACTGTTGGTGGGGGG + Intergenic
1164808844 19:31140084-31140106 CCTGTTCCTGAGTTGGGGGCTGG - Intergenic
925420949 2:3711174-3711196 ACTTTTACACTGTTGGTGGGAGG + Intronic
925859487 2:8161068-8161090 TCATTCACACAGGTGGGGGCTGG - Intergenic
927330298 2:21854831-21854853 CCTTTTACACAAAAGGGGGAAGG + Intergenic
929454585 2:42056852-42056874 CATTTTAGACAGTTGGAGCCAGG - Intronic
929530156 2:42745553-42745575 ATTTTTACAGAGATGGGGGCAGG + Intronic
929740575 2:44595186-44595208 ACTTTTACACTGTTGGTGGGAGG + Intronic
932868234 2:75369495-75369517 GCTTTTACACTGTTGGTGGGAGG - Intergenic
935360853 2:102245325-102245347 CCTCTTCCTCAGGTGGGGGCTGG - Intergenic
935632133 2:105220765-105220787 CCTTTGCCAAATTTGGGGGCTGG - Intergenic
939235568 2:139487840-139487862 ACTTATACACTGTTGGGGGGTGG - Intergenic
941845956 2:170133439-170133461 GCTTTTACACTGTTGGTGGGAGG + Intergenic
942988844 2:182175290-182175312 GCTTTTACACTGTTGGTGGGAGG - Intronic
943086889 2:183322888-183322910 GCTTTTACACTGTTGGTGACAGG - Intergenic
944113419 2:196160334-196160356 CCTTTGCCTCAGTTGGGGGAGGG + Intronic
944764621 2:202851617-202851639 ACTTTTACACTGTTGGTGGGAGG - Intronic
944950824 2:204746587-204746609 ACTTTTACACCGTTGGTGGGAGG - Intronic
946335015 2:219030519-219030541 CCTTCTCCTCAGCTGGGGGCTGG - Intronic
1169482208 20:5994373-5994395 CCTTTTACATAGTTTGAAGCTGG - Exonic
1169896948 20:10514216-10514238 CATTTTAAAAAGTTGGGGCCAGG - Intronic
1172575508 20:36005221-36005243 ATTTTTTCACAGATGGGGGCAGG + Intronic
1172926227 20:38538448-38538470 CCTATTACACAGTTGGGGCTGGG - Intronic
1173296338 20:41761898-41761920 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1173311954 20:41904650-41904672 CCATTTGCAAAGGTGGGGGCAGG - Intergenic
1173926016 20:46781818-46781840 GTTTTTCCACAGATGGGGGCAGG + Intergenic
1174746333 20:53066910-53066932 TCTTTTACAGAGTGGGGTGCAGG + Intronic
1176331496 21:5552858-5552880 GCTTTTACACTGCTGGGGGCGGG + Intergenic
1176396261 21:6268093-6268115 GCTTTTACACTGCTGGGGGCGGG - Intergenic
1176440896 21:6721011-6721033 GCTTTTACACTGCTGGGGGCGGG + Intergenic
1176465158 21:7048080-7048102 GCTTTTACACTGCTGGGGGCGGG + Intergenic
1176488719 21:7429858-7429880 GCTTTTACACTGCTGGGGGCGGG + Intergenic
1176815082 21:13592169-13592191 CCTTTTACACTGTTGGTGGGAGG + Intergenic
1179174296 21:38996156-38996178 ACTATTACAAAGCTGGGGGCAGG - Intergenic
1179898073 21:44374380-44374402 GTTTTTCCACAGATGGGGGCGGG + Intronic
1181048103 22:20226203-20226225 CCTTTCCCAGAGCTGGGGGCTGG - Intergenic
1184988050 22:48148845-48148867 CCTGTTGCAGAGTGGGGGGCAGG - Intergenic
949186940 3:1203246-1203268 CTTTTCTCACAGATGGGGGCAGG - Intronic
951479485 3:23144405-23144427 GCTTTTACACTGTTGGTGGGAGG + Intergenic
952511450 3:34060874-34060896 GCTTTTACACTGTTGGTGGGAGG + Intergenic
952610536 3:35203568-35203590 CCTTTCACACTTCTGGGGGCTGG - Intergenic
953126663 3:40096988-40097010 CCTTTTACTGAGTTGTTGGCAGG - Intronic
953154531 3:40357054-40357076 CTCTTTACACAGATGTGGGCAGG - Intergenic
953573482 3:44093013-44093035 CCTTCTACACAGCTGGGGAAGGG + Intergenic
953931863 3:47009564-47009586 CTTTTTGCACAGTCTGGGGCGGG + Exonic
954353464 3:50065087-50065109 CCTTCTTCACAGTAGGAGGCAGG - Exonic
955576026 3:60364061-60364083 CTGTTTACAAAGTTGTGGGCTGG - Intronic
957671766 3:83314249-83314271 CCTTTTACTAATTTGGGGGAGGG + Intergenic
957851479 3:85813156-85813178 GCTTTTACACTGTTGGTGGGAGG - Intronic
960943198 3:122947843-122947865 TCTGTTACACAGTTTGGGGGGGG - Intronic
962157289 3:132961418-132961440 CCTTTTACACTGTTGGTGGGAGG + Intergenic
964831747 3:160891531-160891553 GCTTTTACACTGTTGGTGGGAGG + Intronic
964945762 3:162221678-162221700 TATTTTACAAAGTTGGGGGTGGG - Intergenic
969319709 4:6404290-6404312 CCTTGTACACAGCAAGGGGCAGG + Intronic
970274711 4:14385955-14385977 CCTTTTCCAGAGTTAGGGGCAGG - Intergenic
970975198 4:22035456-22035478 ACTTTTACACTGTTGGTGGGAGG - Intergenic
971235966 4:24842707-24842729 CCCTTGGCAGAGTTGGGGGCAGG - Intronic
972187760 4:36552034-36552056 CCTTTTTCTTAGTTGGGGACAGG + Intergenic
972403887 4:38729008-38729030 CCTTTGAGAGAGGTGGGGGCAGG + Intergenic
972429067 4:38963323-38963345 TCTTTTATAAACTTGGGGGCAGG - Intergenic
974825001 4:67116980-67117002 CCTTTTATACTGTTGGTGGGGGG + Intergenic
978479701 4:109175074-109175096 ACTTTTACACAGATGGGAGTGGG - Intronic
978694485 4:111560541-111560563 GCTTTTACACTGTTGGTGGGAGG + Intergenic
980468166 4:133213930-133213952 TCTTTTACAAAGTTGGGTCCAGG + Intergenic
982197385 4:152930049-152930071 TGTTTCACACAGTTGGGGGCAGG - Intergenic
982796713 4:159654757-159654779 GCTTTTACACTGTTGGCGGAAGG - Intergenic
984869365 4:184312960-184312982 CCCCTTACTCAGATGGGGGCAGG + Intergenic
985824242 5:2180957-2180979 CCCTTTCTACAGTTGGGGACCGG + Intergenic
986550951 5:8954997-8955019 CTTTTTCCACTGTAGGGGGCAGG + Intergenic
988675643 5:33430153-33430175 GCTTTTACACTGTTGGTGGGTGG + Intergenic
989472487 5:41836558-41836580 CTTTTTCCACAGATGGGGGTTGG + Intronic
989725725 5:44584325-44584347 ACTTTTACACTGTTGGTGGGAGG + Intergenic
990031225 5:51261879-51261901 ACTGATACAAAGTTGGGGGCAGG - Intergenic
990974853 5:61550604-61550626 CCTTTTACATAGAGGGGGTCTGG - Intergenic
991102407 5:62807415-62807437 GCTTTTACACTGTTGGTGGGAGG - Intergenic
993954809 5:94219071-94219093 ATTTTTCCACAGATGGGGGCGGG + Intronic
994093989 5:95832415-95832437 CCTTTATCAAAGTTGGGGACTGG - Intergenic
995112565 5:108444025-108444047 ACTTTTACACTGTTGGTGGGAGG + Intergenic
995113747 5:108455744-108455766 ACTTTTACACTGTTGGTGGGAGG - Intergenic
995252072 5:110005273-110005295 GCTTTTACACTGTTGGTGGGAGG - Intergenic
995539355 5:113169376-113169398 GCTTTGACACATTTGGGTGCAGG - Intronic
996444833 5:123535333-123535355 ATTTTTACATAGTTGGGGGTGGG - Intronic
997830335 5:137144199-137144221 CCTTTGACTCAGTTGGGGGATGG - Intronic
998718269 5:144911082-144911104 GCTTTTACACTGTTGGTGGGAGG + Intergenic
998726975 5:145028698-145028720 CCATTTAAAAATTTGGGGGCTGG - Intergenic
998934510 5:147219867-147219889 GCTTTTACACTGTTGGTGGGAGG + Intergenic
999269653 5:150289446-150289468 CCTTGTACACAGATGAAGGCAGG - Intronic
999871681 5:155757952-155757974 CCTATTACACGGATGGTGGCAGG - Intergenic
1000640250 5:163693779-163693801 CTTTTTACACTGTTGGTGGGAGG + Intergenic
1000774844 5:165406774-165406796 ACTTTTACACTGTTGGTGGGAGG - Intergenic
1003530882 6:6936511-6936533 CTCTTTACAAAGATGGGGGCAGG - Intergenic
1003967446 6:11266457-11266479 CTTTTTCCAGAGTTTGGGGCAGG - Intronic
1006037974 6:31228984-31229006 CCTTCTACACAGGTGCCGGCAGG - Intergenic
1009454112 6:63834587-63834609 GCTTTTACACTGTTGGTGGGAGG + Intronic
1009459266 6:63893111-63893133 ACTTTTACACTGTTGGTGGGAGG + Intronic
1009825651 6:68862525-68862547 TATTTTACAGAGTTGGGGTCAGG + Intronic
1010689268 6:78889804-78889826 ACTTTTACACTGTTGGTGGGAGG + Intronic
1012423601 6:99091162-99091184 TCTTTTACACCTTTGGGGGTTGG - Intergenic
1012946066 6:105466996-105467018 ACTTTTAAAAAGTTGGGGGAGGG + Intergenic
1013716648 6:112970321-112970343 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1013824287 6:114192972-114192994 ACTTTTAAAAAGGTGGGGGCAGG - Intronic
1015294589 6:131576141-131576163 CCCTTAACACTGTTGGGGACAGG - Intronic
1015465584 6:133544779-133544801 ATTTTTCCACAGATGGGGGCGGG - Intergenic
1016691162 6:146939577-146939599 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1016972705 6:149779339-149779361 CCTTTTAAGCAGTTTGTGGCAGG - Intronic
1018330018 6:162717278-162717300 CCTTTTAGTCACTTTGGGGCTGG + Intronic
1019357362 7:587641-587663 CCCCTTCCACAGTTGGGGGTGGG + Intronic
1019756666 7:2775886-2775908 CCTTTTCCACAGTACGGGTCTGG - Intronic
1020011083 7:4806046-4806068 TCTTTCACACCGTTGGAGGCAGG - Intronic
1021870060 7:24996872-24996894 GCTTTTACACAGTTGGTGGGAGG - Intergenic
1023144905 7:37140916-37140938 ACTTTTACACTGTTGGTGGAAGG + Intronic
1026544498 7:71310052-71310074 CGTCTTACACAGATGGCGGCAGG - Intronic
1028337730 7:89678382-89678404 GCTTATACACTGTTGGGGGGGGG + Intergenic
1028348672 7:89816428-89816450 ATTTTTCCACAGATGGGGGCAGG + Intergenic
1028469028 7:91184832-91184854 CCCTGTATGCAGTTGGGGGCAGG + Intronic
1031100845 7:117478816-117478838 GCTTTTACACAGTAGGGTTCAGG + Intronic
1031297905 7:120027104-120027126 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1031447818 7:121875692-121875714 CCTTTTACACAGTTGCCAACAGG + Intronic
1031877098 7:127154174-127154196 CCTTTTGCAAAGTTGGAAGCTGG - Intronic
1035167358 7:156999835-156999857 CGGTTTACCCAGCTGGGGGCAGG - Intronic
1035826264 8:2647236-2647258 CCTTTTTCAGAGATGTGGGCTGG + Intergenic
1037960823 8:23096758-23096780 CCTTTTAAGCAGTTTGTGGCAGG + Intronic
1040683180 8:49838190-49838212 GCTTTTAGACAGATGGGGGAGGG + Intergenic
1040790965 8:51230158-51230180 GCTTTGACAGAGTTGTGGGCTGG - Intergenic
1042577943 8:70241756-70241778 CCTGTTTCACAGTTGGGAGATGG - Intronic
1042687388 8:71457295-71457317 ACTTTTACACTGTTGGTGGGAGG + Intronic
1043270331 8:78325205-78325227 CAGTTCACACAGCTGGGGGCTGG - Intergenic
1044064953 8:87687945-87687967 CCTTTTCCACAGATGGGGGTTGG + Intergenic
1046120288 8:109837887-109837909 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1046987345 8:120403032-120403054 ACTTTTACACTGTTGGTGGGAGG + Intronic
1050865496 9:10492319-10492341 ACTTTTACACTGTTGGTGGGGGG - Intronic
1051638545 9:19203318-19203340 CCTGTTAAAGAGCTGGGGGCTGG + Intergenic
1052506000 9:29355382-29355404 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1052596090 9:30560047-30560069 CATCTTACACAGTATGGGGCTGG + Intergenic
1055007501 9:71525384-71525406 GCTTCTCCACAGTTGAGGGCAGG + Intergenic
1055823545 9:80297355-80297377 GCTTTTACACAGTTTGTGGGAGG + Intergenic
1056062348 9:82896894-82896916 TATTTTACAAAGTTGTGGGCAGG + Intergenic
1056149141 9:83766842-83766864 CCTTTTAAACACCTGGTGGCTGG + Intronic
1056232025 9:84556873-84556895 ACTTTTACTCAGATGGTGGCTGG + Intergenic
1057913134 9:99035535-99035557 CCTATTGCACAGTTGGGGGCTGG - Intronic
1058140737 9:101354857-101354879 CCTTCTAAACACTTGGGGGGTGG + Intergenic
1058262485 9:102852985-102853007 GCTTTTACACTGTTGGTGGGAGG - Intergenic
1058593087 9:106586185-106586207 TCTTTCAGAAAGTTGGGGGCAGG - Intergenic
1058781283 9:108337952-108337974 CCTTACACACAGTCTGGGGCTGG - Intergenic
1059593455 9:115690311-115690333 CCTTTTACATAGTTGAGGTCAGG + Intergenic
1061993926 9:134174641-134174663 CCCTTTAGAGAGCTGGGGGCAGG + Intergenic
1203430603 Un_GL000195v1:87476-87498 GCTTTTACACTGCTGGGGGCGGG - Intergenic
1203532277 Un_GL000213v1:157261-157283 CCTTTTACACTGTTGGTGGGAGG - Intergenic
1185874459 X:3691135-3691157 CCTTTTAAGCAGTTTGTGGCGGG + Intronic
1186959528 X:14720828-14720850 CCTTAAAAACTGTTGGGGGCAGG + Intronic
1191221656 X:57995298-57995320 CTTTTTACACTGTTGGTGGGAGG - Intergenic
1192872705 X:75199848-75199870 GCTTTTACACTGTTGGTGACGGG - Intergenic
1193110726 X:77727214-77727236 ACTTTTACACTGTTGGTGGGAGG + Intronic
1194608696 X:96013564-96013586 GCTTTTACACTGTTGGTGGGAGG + Intergenic
1199663218 X:150073648-150073670 GATTTTACACAGTTGGGTGGTGG - Intergenic
1200149265 X:153943343-153943365 GCCTTTTCCCAGTTGGGGGCAGG + Intronic
1200152818 X:153959626-153959648 CCATTTCCACAGGTGGGGCCAGG + Intronic
1200364557 X:155647911-155647933 ACTTTTACACTGTTGGTGGGAGG - Intronic
1201914042 Y:19163521-19163543 CCTTTTACACATTTGATGGTAGG + Intergenic
1202136829 Y:21675141-21675163 CGTCTTACACAGTTGGCAGCAGG + Intergenic