ID: 1159037402

View in Genome Browser
Species Human (GRCh38)
Location 18:63290880-63290902
Sequence AGGGCCGAGTGGGATGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 397}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159037402_1159037412 22 Left 1159037402 18:63290880-63290902 CCACCCTCATCCCACTCGGCCCT 0: 1
1: 0
2: 1
3: 36
4: 397
Right 1159037412 18:63290925-63290947 TATTTCAAAAGCCTCCGAGATGG 0: 1
1: 0
2: 1
3: 14
4: 141

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159037402 Original CRISPR AGGGCCGAGTGGGATGAGGG TGG (reversed) Intronic
900318608 1:2071301-2071323 AGGGTCAAGTGGGAAGAGAGCGG + Intronic
900432212 1:2607737-2607759 AGGCCCGAGTGGGCTGAGTGGGG + Intronic
901124207 1:6917771-6917793 AGGGCAGAGTGGGGTGGGGGAGG + Intronic
901227545 1:7622826-7622848 AGGGCCGAGTTCCATGATGGCGG - Intronic
901414121 1:9105288-9105310 AAGGCAGAGTGGGATCAGTGTGG - Intronic
901877795 1:12176832-12176854 AGGGGCGAGAGGCTTGAGGGAGG + Intronic
902364831 1:15965907-15965929 TGGGCCGGGTGAGATCAGGGAGG + Intronic
903019995 1:20387044-20387066 AGGGCTGAGGGGGAGGAGGAAGG + Intergenic
903406335 1:23099924-23099946 AGGGACCAGAGGGAAGAGGGAGG - Intronic
903679790 1:25089223-25089245 AGGGCTGAGTGGGAGCAGGATGG + Intergenic
903953803 1:27011653-27011675 AGGGAAGAGTTGGAGGAGGGAGG + Intronic
904028857 1:27521534-27521556 AGGGGCGAGAAGGCTGAGGGTGG - Intergenic
904325932 1:29727421-29727443 AGGGAAGGGTGGGCTGAGGGAGG + Intergenic
904326032 1:29727673-29727695 AGGGAAGGGTGGGCTGAGGGAGG + Intergenic
904326084 1:29727813-29727835 AGGGAAGGGTGGGCTGAGGGAGG + Intergenic
904433445 1:30479532-30479554 AGGGAAGAGTGGGCTGGGGGAGG - Intergenic
904453948 1:30635785-30635807 AGGTCCCTGTGGGGTGAGGGAGG - Intergenic
905252760 1:36660069-36660091 GGAGCCTAGTGGGATGAAGGTGG - Intergenic
906207484 1:43994975-43994997 AGGGCAGTGTGGGCTGAGGAAGG + Intronic
906948159 1:50313314-50313336 GGAGCTGAGTGGGGTGAGGGTGG - Intergenic
907335443 1:53696602-53696624 ATGGCCGGGTGGGGTGAGGGTGG - Intronic
908766090 1:67555722-67555744 AGGGCCCAGCGTGAGGAGGGAGG + Intergenic
911116055 1:94247646-94247668 CGGGCCGTGGGGGATGGGGGCGG - Intronic
912481301 1:109984188-109984210 AGGGCTGATGGGTATGAGGGTGG - Intergenic
914776749 1:150742730-150742752 AGGGCTGGGTGGGTTGAGGGGGG + Intronic
915073272 1:153289508-153289530 AGAGATGAGGGGGATGAGGGAGG - Intergenic
915446930 1:155979187-155979209 AGGGCAGAGTGGGGTCAGGAAGG - Intronic
915580373 1:156809511-156809533 AGGGAGGAGTGGGGTGAGGGAGG + Intronic
915936037 1:160090918-160090940 AGGGCCTAGTGGGAGGAGTCAGG + Intergenic
915978422 1:160405629-160405651 AGGGGAGAGTGGGATGAAGCTGG + Intronic
917410980 1:174759888-174759910 AGGGCCGAGTGGGAGGTGTTTGG - Intronic
918118641 1:181518078-181518100 AGGGCAGAATGGGTAGAGGGAGG + Intronic
919802978 1:201364652-201364674 AGGGCAGGGTGGGATGGAGGTGG - Intronic
919979490 1:202633489-202633511 GGGGCTGAGTGGGATGAAGATGG - Intronic
919990746 1:202707627-202707649 AGGACAGAGTGGGAGGAGGTTGG - Intronic
920578930 1:207086243-207086265 AGGGAAGAGTGGGATTGGGGCGG + Intronic
922329937 1:224565615-224565637 AGTGCATAGTGGGCTGAGGGAGG - Intronic
922478597 1:225923667-225923689 CGGGCGGAGTGGGAAGCGGGTGG - Intronic
922596548 1:226817962-226817984 TGGGAGGAGTGGCATGAGGGAGG + Intergenic
923171681 1:231422340-231422362 AGGGCGGAGGGGGCGGAGGGAGG + Exonic
1064791009 10:18958124-18958146 AGGCCCCCGTGGGATGTGGGTGG + Intergenic
1064806233 10:19137194-19137216 AGGGATGAGTAGGAGGAGGGTGG + Intronic
1065338186 10:24676542-24676564 AGGGTGGAAAGGGATGAGGGTGG + Intronic
1066101697 10:32123285-32123307 AGGGCCTGGTGGGCTGAGGCAGG + Intergenic
1067161158 10:43826101-43826123 AGGGCCGCGGGTGGTGAGGGGGG - Intergenic
1067786527 10:49253496-49253518 AGGGCTGGGTGGGAGGAAGGAGG + Intergenic
1069761788 10:70816200-70816222 GGGGCCGGGTGGGCCGAGGGCGG + Intronic
1070592682 10:77811884-77811906 AGGGCCGTCTGGGCTGGGGGTGG - Intronic
1070711680 10:78687522-78687544 GGGGCCGAGAGGGCTGGGGGTGG - Intergenic
1070972563 10:80579584-80579606 AGGTGGGAGTGGGAGGAGGGAGG - Intronic
1072619944 10:97073310-97073332 AAGGCCGCGTGGGAGGAGGACGG - Intronic
1072697079 10:97611730-97611752 AGAGCACAGGGGGATGAGGGTGG + Exonic
1076096455 10:127737580-127737602 AGCGCCGAGTAGGAGTAGGGCGG - Exonic
1076438803 10:130465115-130465137 AGGGCAGCAAGGGATGAGGGTGG + Intergenic
1076522418 10:131089390-131089412 TGGGCCGAGTGAGATAACGGGGG + Intergenic
1076542230 10:131221380-131221402 AGTGCCCAGTGGGAGGTGGGTGG + Intronic
1076781199 10:132725579-132725601 AGGGCCCAGTGGGATGAGGCCGG - Intronic
1077017927 11:405090-405112 AGGGCCGAGAGGGGACAGGGTGG + Intergenic
1077078015 11:709941-709963 AGGGCAGAGTGGGGGGAGGTGGG - Intronic
1077411386 11:2405493-2405515 TGGGGAGCGTGGGATGAGGGTGG - Intronic
1077628928 11:3797695-3797717 AGGGGCGAGAGGGAAGAGGAGGG + Exonic
1077872208 11:6271515-6271537 AGGGCCCAGTGTGCTGATGGTGG - Exonic
1078334150 11:10450822-10450844 AGGGCCCCGCGGGAGGAGGGAGG - Exonic
1079366913 11:19817534-19817556 AGGTCCGAGTTGGGGGAGGGAGG + Intronic
1079394319 11:20048936-20048958 GGGGCCGAGTGGGCTGAGCTGGG - Exonic
1081665619 11:44915460-44915482 AGTGCAGAGTATGATGAGGGTGG - Intronic
1081741583 11:45444781-45444803 TGGGCCAAGCGGGATGGGGGAGG - Intergenic
1081754107 11:45532483-45532505 AGGGCTGAGTGGGCTTAGGAAGG - Intergenic
1083847856 11:65346464-65346486 AGGGGCGTGTGGCATGTGGGAGG - Intronic
1084180454 11:67443320-67443342 CGGGCTGAGGGGGCTGAGGGGGG - Intronic
1084849589 11:71928307-71928329 GTGGCCGAGAGGGAGGAGGGTGG - Intronic
1084969993 11:72766227-72766249 AGGGCAGGGTGAGATGTGGGAGG - Intronic
1085019999 11:73200580-73200602 AGGACTGAGTGGGAGCAGGGTGG + Intergenic
1085286353 11:75364254-75364276 AGGGCAGCGTGGGATGAGGTGGG - Intergenic
1085512479 11:77095397-77095419 AGGGCAAAGTGGGAGGTGGGGGG - Intronic
1085529704 11:77184083-77184105 TGGGCTGTGTGGGATGAGAGAGG + Intronic
1086329506 11:85739451-85739473 GGGGCAAACTGGGATGAGGGGGG + Intronic
1088372915 11:109111044-109111066 GGGGTGGGGTGGGATGAGGGGGG - Intergenic
1088890362 11:114039330-114039352 AGGGCCAGGTGGGGTGAGGGAGG - Intergenic
1089305603 11:117524473-117524495 AGGCTCCAGTGGGATGAGGAGGG - Intronic
1089452321 11:118607302-118607324 AGGGCAGGGTGGGAGGAGAGGGG + Intronic
1089926211 11:122260902-122260924 AGGGGCAAGAGAGATGAGGGAGG + Intergenic
1090174801 11:124638975-124638997 AGGGCAGGTTGGGAGGAGGGAGG + Intronic
1090425432 11:126603892-126603914 CGGGGCTAGTGGGAGGAGGGGGG - Intronic
1091994703 12:4984081-4984103 AGAGCAGTGTGGGATGATGGTGG + Intergenic
1092230034 12:6770995-6771017 AGGGTAGAGAGGGAGGAGGGTGG + Intergenic
1093465165 12:19440594-19440616 AGCGCCGAGGGGAAAGAGGGCGG - Intronic
1095274016 12:40257918-40257940 GGGGCAGGGTGGGATGAGGTGGG + Intronic
1096815612 12:54200073-54200095 AGGGCCTTGTGGGAAGAGGGAGG + Intergenic
1097261944 12:57725386-57725408 AGGGCTGGGTTGGCTGAGGGAGG + Intronic
1097861446 12:64522469-64522491 TGGGCTGAGTGGGAGGAGGAGGG - Intergenic
1101004822 12:100391380-100391402 AATGCCGAGTGGGGTGGGGGAGG - Intronic
1101135469 12:101739178-101739200 AGGGCCTAGTGGAAAGCGGGCGG - Intronic
1102453496 12:113057491-113057513 GGGGACGAGGGGGACGAGGGGGG - Intronic
1102568982 12:113815855-113815877 AGGGTAGAGTGGGATGATGGGGG - Intergenic
1102723246 12:115035782-115035804 AGGGCAGTGTGGGATGGAGGTGG - Intergenic
1102908455 12:116694908-116694930 AGGGCCGAGTGGGTTAAATGAGG + Intergenic
1103341094 12:120221562-120221584 AGGGAGGAGAAGGATGAGGGAGG + Intronic
1103560995 12:121793339-121793361 AGAGCCCAGCGGGGTGAGGGGGG - Intronic
1103763991 12:123269294-123269316 AGGGCTGAGAGGGAGGAGGAAGG + Intronic
1104140852 12:125984410-125984432 ACAGCCGACTGGGAGGAGGGAGG - Intergenic
1104316233 12:127704406-127704428 AGGGAGGAGGGGGAGGAGGGAGG + Intergenic
1104901679 12:132192764-132192786 AGGACAGAGGAGGATGAGGGAGG - Intergenic
1105779864 13:23696385-23696407 AGGGCAGGCTGGGCTGAGGGAGG - Intergenic
1105874691 13:24541412-24541434 AGGGCCGCGTGGGAAGAGTCAGG - Intergenic
1106682953 13:32027349-32027371 GTAGCAGAGTGGGATGAGGGTGG - Intergenic
1107438399 13:40402536-40402558 AGGGCCGAGAGGGGAGAGGAGGG + Intergenic
1107605142 13:42048989-42049011 AGGGCCGCGTGGAAAGCGGGAGG + Intronic
1108750094 13:53439819-53439841 AGGGGGGAGGGGGATGGGGGAGG - Intergenic
1110103202 13:71635306-71635328 AATGCAGAGTGGGTTGAGGGTGG - Intronic
1110332399 13:74287957-74287979 TGGGCCGGGTGGGAGGGGGGTGG - Intergenic
1112506920 13:99981120-99981142 AGGGGGGAGGGGGATGTGGGAGG - Intergenic
1113409282 13:110070229-110070251 AGGGCAGAGGGGGATTAGAGGGG - Intergenic
1113629729 13:111874107-111874129 GGGGCTGAGTGTTATGAGGGTGG + Intergenic
1114311102 14:21468043-21468065 AGGGATGAGGGGGATGGGGGAGG + Intronic
1114598258 14:23932914-23932936 AGGGCTCAGTGGACTGAGGGTGG - Intergenic
1115730284 14:36261141-36261163 AAGGCAGAGTGGGCTGAGGCAGG - Intergenic
1117024678 14:51607581-51607603 AGGAGCGAGTGGTATGGGGGAGG - Intronic
1118318232 14:64738304-64738326 AGGGCAGGGTGGGGTGAGGAGGG - Intronic
1119062676 14:71492131-71492153 AGGGCTGAGTGCAAAGAGGGTGG + Intronic
1120522380 14:85539108-85539130 AGGGCCCGGAGTGATGAGGGTGG - Intronic
1120583093 14:86278652-86278674 AGGGCCTGGTGGGATGAGATTGG + Intergenic
1121279597 14:92689133-92689155 AGGGCTGAGGGTGCTGAGGGTGG - Intergenic
1122275619 14:100589309-100589331 AGGGGCGGGTGGGGTGGGGGCGG + Intergenic
1122464046 14:101918451-101918473 AGGAGCGAGGGGGATGAAGGGGG - Intronic
1122464076 14:101918518-101918540 AGGAGCGAGGGGGATGAGGGGGG - Intronic
1122464107 14:101918586-101918608 AGGAGTGAGGGGGATGAGGGGGG - Intronic
1122784068 14:104155848-104155870 CGGGCCCTGTGGGAAGAGGGTGG + Intronic
1122833953 14:104421958-104421980 AGGAGCGAGGGGGATCAGGGAGG - Intergenic
1122919353 14:104873736-104873758 AGGGCTGAGGTGGCTGAGGGCGG - Intronic
1122930691 14:104931890-104931912 AGGTCTGAGTGGGAGGTGGGCGG + Intronic
1123067111 14:105624280-105624302 AGGCCTGAGTGGCATGAGGGAGG - Intergenic
1123071133 14:105643007-105643029 AGGCCTGAGTGGCATGAGGGAGG - Intergenic
1123076093 14:105668049-105668071 AGGCCTGAGTGGCATGAGGGAGG - Intergenic
1123090794 14:105741277-105741299 AGGCCTGAGTGGCATGAGGGAGG - Intergenic
1123096429 14:105769041-105769063 AGGCCTGAGTGGCATGAGGGAGG - Intergenic
1124495097 15:30181461-30181483 GGGGCTGAGTGGGATGAAGATGG - Intergenic
1124497500 15:30195633-30195655 AGGGGCGACGGGGATGGGGGCGG + Intergenic
1124748472 15:32357184-32357206 GGGGCTGAGTGGGATGAAGATGG + Intergenic
1124953652 15:34345815-34345837 AGGGAAAAGTGGGGTGAGGGTGG - Intronic
1125099823 15:35899468-35899490 AGGGCCATGCGGGATGTGGGGGG - Intergenic
1125884556 15:43218975-43218997 AAGGCAGAGAGGGAGGAGGGTGG - Intronic
1127383987 15:58452721-58452743 AGGGTGGAGTGGGATGGGGTGGG + Intronic
1127518293 15:59717395-59717417 TGGGCCGAGGGGGTTGGGGGGGG - Intergenic
1127620024 15:60724900-60724922 AGGGCCCAGTGTGAGGAGCGGGG - Intronic
1127975840 15:63996870-63996892 GGGGCAGAGGGGGATGGGGGTGG - Intronic
1128086731 15:64891800-64891822 AGGGCAGTGTGGGATGGTGGAGG + Intronic
1128797920 15:70478575-70478597 CAGGGCGAGTGGGAGGAGGGTGG - Intergenic
1129109241 15:73328114-73328136 AGTGCCGAGTGTGGTGAAGGAGG + Intronic
1129166185 15:73779383-73779405 AGGGCAGAGTGGGGTGGGGGAGG + Intergenic
1129467527 15:75732280-75732302 GGGGCCGAGAGGGATGGGGTGGG + Intergenic
1130006331 15:80102350-80102372 GAGGCCGAGTGGGAGGCGGGTGG - Intronic
1130646695 15:85734431-85734453 AGGGCCAGGTGGAATAAGGGAGG - Intronic
1130864939 15:87924898-87924920 AGGGAGGAATGGAATGAGGGGGG - Intronic
1131096135 15:89655344-89655366 AGGACCGGGTGGGTGGAGGGAGG - Intronic
1131153535 15:90061642-90061664 AGGGTCGGGTGGGATCAGGGTGG - Intronic
1131225947 15:90624476-90624498 AGGGCAGAGGGTGAGGAGGGAGG - Intronic
1132582947 16:693808-693830 AGGGCCCAGTGGGATTGAGGGGG - Exonic
1132989798 16:2786859-2786881 ATGGGGGAGGGGGATGAGGGAGG - Intronic
1133061957 16:3180658-3180680 TGGGCCGAGTGGCCTAAGGGTGG + Intergenic
1133095670 16:3443517-3443539 ATGGCGGAGAGGGCTGAGGGCGG - Exonic
1133392814 16:5422972-5422994 AGGGAGGAGTGGGGAGAGGGAGG + Intergenic
1133805901 16:9125850-9125872 GGAGCCGACTGGGATGGGGGTGG + Intergenic
1136109095 16:28053477-28053499 AGGGCAGAGTCAGATGAGGGAGG + Intronic
1136226465 16:28863730-28863752 GGCGCCGAGTGGGAGGATGGCGG + Exonic
1136428448 16:30184037-30184059 AGGGCAGGGTGGGGTGAGCGGGG + Intronic
1137351732 16:47719216-47719238 AGGGCCATGTGGAGTGAGGGAGG - Intergenic
1137529231 16:49266663-49266685 AGGGTGGAGTGGAATGTGGGAGG - Intergenic
1139424982 16:66873844-66873866 AGGGAGGAGGGGGAGGAGGGAGG - Intergenic
1139526947 16:67522698-67522720 AGAGGTGAGTGGGGTGAGGGCGG - Intronic
1139663490 16:68438693-68438715 AGGGGTGAGTGGGATGGGGAAGG - Intronic
1139866263 16:70065155-70065177 GGGGCGGAGTGGGAGGGGGGCGG + Intergenic
1139975474 16:70806657-70806679 AGGGCTGTGGGGGATGAGTGTGG + Intergenic
1140930203 16:79620479-79620501 AGGGGCTGGTGGGATGAGAGAGG - Intergenic
1141904290 16:87013322-87013344 CGGGCCGGGTGGGAAGTGGGTGG + Intergenic
1142287567 16:89177619-89177641 AGGGGAGAGGGAGATGAGGGAGG - Intronic
1142577539 17:919612-919634 AGGGCCGCGTGGGACGAATGCGG - Intronic
1143284806 17:5781140-5781162 AGGGAAGAGTGTGAAGAGGGAGG + Intronic
1143538448 17:7555795-7555817 AAGCAAGAGTGGGATGAGGGGGG + Intronic
1143704549 17:8687577-8687599 AGGGGAGAGTGGGAAGAGGAGGG - Intergenic
1144478587 17:15610562-15610584 AGGGCACAGAGGGATGTGGGGGG - Intronic
1144585465 17:16485020-16485042 AGGGCCGGGTGGGGGTAGGGAGG + Intronic
1144688680 17:17244336-17244358 AGGGCACAGTGGGAAGATGGGGG + Intergenic
1145976349 17:28986354-28986376 AGGGCCCAGCTGGGTGAGGGTGG + Intronic
1146910496 17:36645541-36645563 AGGAGAGAGTGGGAGGAGGGAGG - Intergenic
1146938370 17:36826453-36826475 AGGGCTGAGTGGGCTGGGTGGGG - Intergenic
1148191426 17:45681328-45681350 AGGGTGGAGCAGGATGAGGGTGG - Intergenic
1148593049 17:48831022-48831044 AGGGCAGAGTGGGACGGGGGCGG - Exonic
1148985033 17:51613491-51613513 GGGGCAGAGGGGGGTGAGGGAGG - Intergenic
1149172050 17:53823310-53823332 AGAGCCAAGGGGGATAAGGGCGG - Exonic
1149329627 17:55567670-55567692 AGGACGCAGTGGGCTGAGGGAGG - Intergenic
1151411446 17:73932979-73933001 AGGGGGGAGAGGGAAGAGGGAGG - Intergenic
1151447457 17:74176570-74176592 GGGGCCGGAGGGGATGAGGGTGG - Intergenic
1151835185 17:76578102-76578124 GGGGTGGAGTGGGATGAGGTTGG + Intronic
1152101499 17:78304418-78304440 AGGCACGAGTGGGAGGAGCGGGG + Intergenic
1152562324 17:81084757-81084779 AGCCCAGAGTGGGATGACGGTGG + Intronic
1152821028 17:82437767-82437789 AAGGCCAAGTGTGGTGAGGGAGG + Intronic
1154167184 18:12024719-12024741 AGGGCAGGGAGGGAGGAGGGAGG - Intronic
1155066560 18:22273831-22273853 AGGGAAGAGGGGGAGGAGGGAGG - Intergenic
1158482044 18:57830745-57830767 AGGGCCACGTGGGATGAGGTTGG + Intergenic
1159037402 18:63290880-63290902 AGGGCCGAGTGGGATGAGGGTGG - Intronic
1160535291 18:79588414-79588436 TGGGCAGAGTGGGACGTGGGCGG - Intergenic
1160830710 19:1103863-1103885 AGGCCGGAGTGGGAAGAAGGCGG - Intergenic
1160872201 19:1282545-1282567 AGGGAGGAGGGGGAGGAGGGTGG + Intergenic
1161039641 19:2103414-2103436 GGGGCCCAGTGGCAGGAGGGCGG - Intronic
1161241367 19:3225400-3225422 AGGAAAGAGTGGGGTGAGGGAGG - Intronic
1161919781 19:7257442-7257464 AAGGCGGGGTGGGAGGAGGGAGG + Intronic
1161924358 19:7289996-7290018 AGGGTAGAGTGGGGTGAGGTGGG + Intronic
1162032751 19:7924593-7924615 AGGGGCAAGTGGCAGGAGGGCGG + Exonic
1162376722 19:10309504-10309526 AGGGCCGGGTGAAATTAGGGAGG - Exonic
1162900938 19:13795355-13795377 AGGGCCGAGGAGGCCGAGGGGGG + Intergenic
1163279491 19:16306913-16306935 AGGACCCAGTGGGCTGGGGGTGG + Intergenic
1163325400 19:16600154-16600176 AGGGCCCGGGGGGATGAGGGGGG - Intronic
1163415595 19:17184685-17184707 TGGGCCCAGTGGAATGAGGTGGG - Intronic
1163460929 19:17437061-17437083 ATGCACGAGTGGGATGTGGGAGG - Intronic
1163715545 19:18870355-18870377 CGGGACCAGTGGGCTGAGGGCGG + Exonic
1164441875 19:28285049-28285071 AGGGCAGAGAGGAAGGAGGGTGG + Intergenic
1164526712 19:29018345-29018367 AGGGCAGAGAGGGGAGAGGGAGG + Intergenic
1164762702 19:30739827-30739849 AGGGCCTTTTGGGACGAGGGGGG + Intergenic
1165233122 19:34399859-34399881 AGGGAAGAGTGGTATGAGGAAGG - Intronic
1166217013 19:41342351-41342373 AGGGCAGAGTGGGGTGGGTGGGG - Intronic
1166220281 19:41359911-41359933 AGGCCAGAGGGTGATGAGGGAGG - Intronic
1166734493 19:45076122-45076144 CGGGCCGAGGGCGAGGAGGGCGG + Exonic
1166808445 19:45500579-45500601 AGGGTGGGGTGGAATGAGGGTGG + Intronic
1166909442 19:46141499-46141521 AGGGCCTTGTGGGATGAGCTGGG - Intergenic
1167001267 19:46746725-46746747 GGGGCGAAGTGGGAGGAGGGGGG - Exonic
1167604968 19:50476752-50476774 AGGGCTGAGAGGGAAGAGGTGGG + Intronic
1167852731 19:52214266-52214288 AGGGCAGGGTGGGATCAGAGAGG + Intronic
1168007682 19:53504452-53504474 AGGGCGGTGTGGGTGGAGGGGGG - Intergenic
1168100107 19:54137137-54137159 AGGGCCAAGTGGGAGGAGCTGGG - Intergenic
1168286842 19:55339500-55339522 AGGTCCAAGTGGAAAGAGGGCGG - Intergenic
1168488820 19:56790020-56790042 AGGACAGGGTGGCATGAGGGTGG - Intronic
1168654683 19:58118450-58118472 GGGGCCTAGTGCGACGAGGGCGG + Intergenic
924960749 2:32218-32240 GGGGCTGAGTGGGAGGCGGGCGG + Intergenic
925075272 2:1011213-1011235 AGGGCCAGGTGGGAGCAGGGCGG + Intronic
925162307 2:1694508-1694530 AGGGCCAGGTGGGCAGAGGGGGG - Intronic
925339377 2:3125739-3125761 AGGGCCCAGGGGGCTGAGGCAGG - Intergenic
926794595 2:16608473-16608495 ATGGCCAAGTGGAATGAGGACGG + Intronic
927085659 2:19672128-19672150 AGGCCACAGTGGGATGAGGAGGG + Intergenic
927510818 2:23642760-23642782 TGGGCCGAGTCGGTTGTGGGGGG - Exonic
929904765 2:46036217-46036239 AGGGGAAAGTGGGATGAGGTGGG + Intronic
931858234 2:66326608-66326630 AGGGGCTGGTGGGGTGAGGGAGG + Intergenic
932312103 2:70751280-70751302 AGGGCTGGTTGGGATGAGGTCGG + Intronic
932359777 2:71094461-71094483 AGGGCAGAATGGGAGAAGGGGGG + Intergenic
932780011 2:74554010-74554032 AGGGCTCAGGGGGATGTGGGAGG - Intronic
933258222 2:80104350-80104372 AAGGCAAAGTGGGATGAGAGAGG + Intronic
933689894 2:85171921-85171943 AGGGCAGTGTGGGGGGAGGGGGG - Intronic
936491452 2:112976228-112976250 AGGACCAAGTGGAATGAGGGCGG + Intronic
936537735 2:113324972-113324994 GGGGCCGAGGGGGCGGAGGGAGG - Intergenic
938090175 2:128426158-128426180 AGGGCTGGGTGGGATGAGTGAGG - Intergenic
940140567 2:150486956-150486978 AGAGCCGGGTGGGGTGAGTGGGG - Intronic
942601910 2:177650098-177650120 ATGGGGGAGTGGGAGGAGGGAGG - Intronic
946168486 2:217879630-217879652 AGAGAGAAGTGGGATGAGGGAGG - Intronic
946193873 2:218021967-218021989 AGGGCAGAGGGGGTTGAGGTGGG + Intergenic
947714296 2:232332105-232332127 AGGGTCGGGTGGGATGGGTGGGG - Intronic
947733504 2:232443484-232443506 AGGGTCGGGTGGGATGGGTGGGG - Intergenic
948091938 2:235302199-235302221 AGGGGGGAGGGGGATGAGGAGGG - Intergenic
948379362 2:237542037-237542059 AGGGGAGAGTGTGAGGAGGGTGG + Intronic
948787265 2:240359132-240359154 TGGGCCTGGTGGCATGAGGGCGG - Intergenic
948802089 2:240437548-240437570 AGAGCCCAGTGGGGTGAGGGGGG - Intronic
949047372 2:241878020-241878042 AGGGAGGAGAGGGATGGGGGTGG - Intergenic
1170555518 20:17511975-17511997 TGTGACGAGTGGGATGAGGGAGG - Exonic
1172100740 20:32483140-32483162 TGGGCCGAGTGGGCTGGGGCGGG - Intronic
1172116215 20:32574957-32574979 AGGTGGGAGTGGGGTGAGGGAGG - Intronic
1172778116 20:37419950-37419972 CTGGGCGAGTGGGCTGAGGGTGG - Intergenic
1173687414 20:44933198-44933220 AGGGCCAAGGGGAATGGGGGTGG + Intronic
1174429387 20:50456692-50456714 AGAGCTGAGTGGGAGGTGGGAGG - Intergenic
1174656589 20:52177025-52177047 AGGGTAGGGTGGGATGTGGGAGG - Intronic
1177557380 21:22709797-22709819 AGTGAAGAGTGGGAGGAGGGTGG + Intergenic
1178624609 21:34204431-34204453 AGGGCCTAGAAGCATGAGGGAGG + Intergenic
1178996750 21:37408943-37408965 AGGGCAGAGTGGGGTTAGGGTGG + Intronic
1179122438 21:38560371-38560393 AGGGCTGTCTGGGATGAGGCAGG - Intronic
1180067739 21:45421050-45421072 AGGGCTGGGTGGGGTGGGGGTGG - Intronic
1183211276 22:36452838-36452860 AGGGCTGAGTGGGGTAGGGGGGG + Intergenic
1183354071 22:37349258-37349280 AGAGGCCAATGGGATGAGGGTGG + Intergenic
1183674409 22:39291627-39291649 GGGGCCGGCTGGGATGAGGAGGG + Intergenic
1183708138 22:39487564-39487586 AGGGGCGAGTGGGAGTAGAGTGG - Exonic
1184255961 22:43287108-43287130 AGGGCTGAGTGGGAGGTAGGGGG + Intronic
1184467339 22:44676675-44676697 AGGGCAGAGTGGAGTGTGGGTGG + Intronic
1184670271 22:46008517-46008539 AGGGCTGAGAGGGGTGGGGGTGG + Intergenic
1184844250 22:47071423-47071445 AGGGCAGAGTGGGGAGAGAGGGG - Intronic
1185404674 22:50641154-50641176 ACGGCCAAGAGGGATGAGTGTGG - Intergenic
949507717 3:4742464-4742486 AGGAACCAGTGGGATGAGTGAGG - Intronic
953681023 3:45038179-45038201 AGGGACTAGTGAGATGAGTGAGG - Intergenic
953979610 3:47407053-47407075 AGGGCCGGGTGGGAGGCAGGAGG + Intronic
954390225 3:50264785-50264807 AGGGAGGAGTGGGAGGAGAGGGG - Intergenic
954445275 3:50542975-50542997 AGGGAAGAGTGGGATCTGGGAGG + Intergenic
955812354 3:62804407-62804429 AGGGCTGAGTTGGGTGAGAGGGG + Intronic
956814479 3:72895236-72895258 AGGGCGGAGTGGGGTCAGGTGGG + Intronic
959023613 3:101215556-101215578 AGGGCCTAGTGGGAGCTGGGAGG - Intergenic
960674355 3:120180319-120180341 AAGGAGGAGTGGGATGAGGGAGG + Intronic
961048010 3:123722525-123722547 GGGGCCTAGAGGGATGGGGGAGG + Intronic
961218850 3:125183886-125183908 AGGCCTGAGAGGGATGAAGGGGG + Intronic
961566057 3:127763975-127763997 AGAGCCGGGAGGGAGGAGGGTGG - Intronic
961647813 3:128401730-128401752 ATAGCCAGGTGGGATGAGGGAGG + Intronic
962622324 3:137192138-137192160 AGGGTTGAGTGGGAGGAGTGAGG + Intergenic
962944648 3:140156085-140156107 AGTGGACAGTGGGATGAGGGAGG - Intronic
963331267 3:143919035-143919057 AGGGCAGTGAGGGATGAGGTGGG + Intergenic
966883625 3:184362788-184362810 AGGGCCTGGGGGGAAGAGGGAGG + Intronic
967049068 3:185765477-185765499 AGGGCAGTGTGGGATCAAGGGGG - Intronic
967441526 3:189514514-189514536 AGGGCCTAGTGGGAGGTGAGTGG - Intergenic
967511470 3:190318511-190318533 AGGGCAGAGTGGGAGGAATGGGG - Intronic
967568784 3:191003014-191003036 AGGGCCTACTGGGGTGTGGGAGG - Intergenic
968515159 4:1012609-1012631 AGGGCCGGGCGGGAAGGGGGCGG - Intronic
968612309 4:1562865-1562887 AGGGCCGAGCAGAAGGAGGGTGG + Intergenic
968615053 4:1573949-1573971 AGGGAGGAGCTGGATGAGGGAGG - Intergenic
968712092 4:2126705-2126727 AGGGCCCACTTGGATGAGGTAGG + Intronic
968713731 4:2139179-2139201 AGGGCAGAGTGGGGAGAGGGAGG + Intronic
968908644 4:3465821-3465843 AGGGCCCCGGGGGAGGAGGGTGG + Intronic
969395432 4:6917574-6917596 AGGGCTGAGTGGGCTGGTGGTGG + Intronic
970980027 4:22085545-22085567 AATGCTGAGTAGGATGAGGGTGG + Intergenic
972260569 4:37404398-37404420 TGGGCATATTGGGATGAGGGTGG - Intronic
974929946 4:68350201-68350223 AGGTACCAGTGGGCTGAGGGCGG - Intergenic
975360227 4:73460956-73460978 AGGGGGGAGGGGGATGGGGGAGG - Intergenic
976297341 4:83485212-83485234 CGGGGCGAGGGGGCTGAGGGCGG + Intronic
976995405 4:91426040-91426062 GGGGCCTATTGGGATGTGGGGGG - Intronic
977176617 4:93827597-93827619 GGGGCGGAGTGGGGTGGGGGTGG + Intergenic
978024877 4:103860814-103860836 AGGGCCGAGTGGGAGGTGATGGG + Intergenic
981154491 4:141417667-141417689 AGGGCAGAGGGGGCTGAGGGAGG + Intergenic
982982971 4:162164374-162164396 AGGACCGAGTGGGAGGCGGGTGG + Intergenic
985113230 4:186567332-186567354 ATGGGCGGGAGGGATGAGGGTGG - Intergenic
985847283 5:2359826-2359848 AGGGCAGAGTGGGAGCAGAGTGG - Intergenic
985937597 5:3108704-3108726 AGAGACGGGTGGGATGGGGGAGG - Intergenic
985997093 5:3602964-3602986 TGGGCGGGGTGGGATGAGGCAGG + Intergenic
986367495 5:7047881-7047903 ATGGCCGAGGGGGCTCAGGGAGG - Intergenic
986369717 5:7068188-7068210 AGGGCAGGGTGGGATGAGCCTGG - Intergenic
987135930 5:14899412-14899434 AGGGCCTGTTGGGATGTGGGGGG - Intergenic
993779096 5:92043204-92043226 AGGGACAAGTGGAATGAAGGAGG - Intergenic
995022379 5:107381047-107381069 GGGGCGGGGTGGGGTGAGGGAGG + Exonic
999293237 5:150441344-150441366 TGGGCAGAGTGAGAGGAGGGCGG + Intergenic
999426781 5:151494458-151494480 AGGGCTGAGTGGTGTGAGGATGG - Intergenic
1000309662 5:160029895-160029917 AGGGCCGTATGGGATATGGGTGG + Intronic
1001246054 5:170106327-170106349 AGAGCCGAGTAGGAATAGGGTGG - Exonic
1001557611 5:172647236-172647258 AGAGCAGAGAGGGAAGAGGGAGG + Intronic
1001731627 5:173964540-173964562 AGGGTGGGGTGGGGTGAGGGTGG + Intergenic
1001731664 5:173964616-173964638 AGGGTGGGGTGGGGTGAGGGTGG + Intergenic
1002928681 6:1619457-1619479 AGGGGGGAGGGGGATGGGGGTGG - Intergenic
1003311340 6:4972116-4972138 AGGGAAGCGTGGAATGAGGGAGG + Intergenic
1003843437 6:10147030-10147052 AGGGGCGAGTGGGAGGAGATGGG - Intronic
1004017237 6:11743471-11743493 AAGGCCAAGGGGGCTGAGGGAGG - Intronic
1004046079 6:12024921-12024943 AAGGCCCAGTGGCAAGAGGGAGG + Intronic
1004208418 6:13614295-13614317 TGGGCAGAGTGGGATGGGGTAGG + Exonic
1005153240 6:22776355-22776377 GGGCCAGAGTGTGATGAGGGAGG + Intergenic
1005900908 6:30215400-30215422 AGGGAGAAGTGGCATGAGGGAGG - Intergenic
1006432797 6:34008107-34008129 AGGGCGGAGTGAAGTGAGGGTGG - Intergenic
1007072536 6:39048130-39048152 AGGGCAGGGAGGGATGAGGCTGG - Intergenic
1007386712 6:41524951-41524973 AGGGGGGAAGGGGATGAGGGGGG + Intergenic
1007636598 6:43303537-43303559 AGGGGTGAATGGGATGGGGGTGG - Intronic
1008496304 6:52137467-52137489 AAGGCAGAGGGGGAGGAGGGTGG + Intergenic
1010192295 6:73206942-73206964 AGGTCTGAGTGGGATGGGAGTGG - Intergenic
1010834113 6:80565854-80565876 AGAACCGAGTGAGATGAGGAAGG + Intergenic
1011044050 6:83062457-83062479 AGGGCCTAGTGGGAGGTGCGTGG - Intronic
1011732334 6:90278264-90278286 AGGGTAGAGTGGGAAGAAGGAGG - Intronic
1015842985 6:137493271-137493293 CGGGCCGGGAGGGAAGAGGGAGG - Exonic
1017136816 6:151154332-151154354 TGGGGCAAGAGGGATGAGGGAGG + Intergenic
1017466576 6:154699455-154699477 AGGGCAGGGTGGGGTGAGGCAGG + Intergenic
1019320711 7:414220-414242 AGGGAGGAGGGGGAGGAGGGAGG - Intergenic
1019320719 7:414236-414258 AGGGAGGAGGGGGAGGAGGGAGG - Intergenic
1019320751 7:414314-414336 AGGGAGGAGGGGGAGGAGGGAGG - Intergenic
1019320764 7:414346-414368 AGGGAGGAGGGGGAGGAGGGAGG - Intergenic
1019331888 7:464406-464428 AGGGCAGGGTGGGGTGAAGGTGG - Intergenic
1019508413 7:1404946-1404968 AGGGAGGAGAGGGAAGAGGGAGG + Intergenic
1019623144 7:2002338-2002360 AAGACCGAGTGGGCTGCGGGAGG + Intronic
1019918943 7:4150693-4150715 AGGGCAGAGTGGGGCCAGGGTGG - Intronic
1019928658 7:4209276-4209298 AGGGCAGAGAGGGAGGAGGGTGG + Intronic
1020017236 7:4838209-4838231 AGTGGCGGGTGGGATGAGGTAGG - Intronic
1020080237 7:5282846-5282868 AGGAGCGAGAGGGAAGAGGGAGG + Intronic
1021653564 7:22854069-22854091 GGGGCCGTGTGGGGTGGGGGGGG + Intergenic
1021954187 7:25807313-25807335 AGGGAGGAGTGGGGGGAGGGAGG + Intergenic
1021954193 7:25807329-25807351 AGGGAGGAGTGGGGAGAGGGAGG + Intergenic
1022474314 7:30700096-30700118 AGGGCCGGGTGGGGTGGGGCTGG - Exonic
1022514058 7:30964295-30964317 TGGGCAGAGGGAGATGAGGGAGG - Intronic
1023907102 7:44530894-44530916 AGGGCTGAGTGGGGTGCGGCTGG - Intronic
1023965642 7:44961977-44961999 AGGGCTGAGGGGGCTGAGGGAGG + Intergenic
1023990433 7:45125381-45125403 AGGACAGAGGTGGATGAGGGTGG + Intergenic
1024389141 7:48787049-48787071 AGGGCAGAGTGGGAAGTGGCAGG + Intergenic
1025198678 7:56949348-56949370 AGGAGCGAGAGGGTTGAGGGAGG - Intergenic
1025230959 7:57203178-57203200 AGGGCCGAGGCGGAGGAGGCGGG - Intergenic
1025245290 7:57312499-57312521 AAGGACGAGTGGGAGGTGGGAGG + Intergenic
1025673270 7:63627583-63627605 AGGAGCGAGAGGGTTGAGGGAGG + Intergenic
1029012881 7:97281296-97281318 AGGGGCGAGTGGGTGGAGGGTGG - Intergenic
1029517054 7:101031134-101031156 AGGGCTGTGTGGGATGGAGGAGG + Exonic
1029730405 7:102434491-102434513 AGGGCAGTGAGGGCTGAGGGTGG - Intronic
1030093308 7:105876609-105876631 AGGGCGGGATGGGAGGAGGGCGG + Intergenic
1031146634 7:118004112-118004134 AGGGCAGAGTGGGAGTTGGGGGG - Intergenic
1032201365 7:129825325-129825347 GGGGCAGGGTGGGAAGAGGGTGG - Intergenic
1032810003 7:135404002-135404024 AGGGTGGGGTGGGATGAGTGTGG - Intronic
1032834735 7:135662430-135662452 CGGGCTGAGTGGGAGGAGCGGGG + Intergenic
1033566910 7:142587590-142587612 AGGGCCAGATGGGATGAGGTAGG + Intergenic
1034487447 7:151374824-151374846 GGGGCCGAGAGGGCAGAGGGTGG - Intronic
1035679646 8:1478609-1478631 AGGGCCTTGTGGGGTGGGGGTGG - Intergenic
1037606128 8:20438647-20438669 AGGGCAGGATGGGAAGAGGGAGG + Intergenic
1038340575 8:26682046-26682068 AGGCAGGAGTGGGAAGAGGGTGG - Intergenic
1039721502 8:40169315-40169337 AGGGGAAAGTGGGAGGAGGGAGG + Intergenic
1040758037 8:50804686-50804708 AGGCCTGAGAGTGATGAGGGTGG - Intergenic
1041632513 8:60103962-60103984 AGGGCAGAGTGGATTGAGTGAGG - Intergenic
1042844795 8:73159056-73159078 AGGTCCGAGGTGGGTGAGGGAGG + Intergenic
1044871596 8:96625514-96625536 AGGGCTGAGTGGGGTGAGACGGG - Intergenic
1045479323 8:102579752-102579774 AGTGAGGAGTGGGGTGAGGGGGG - Intergenic
1045922928 8:107553811-107553833 AGGGCTAAGTGGGAAGTGGGGGG - Intergenic
1047031830 8:120890372-120890394 AGGACCGAGAGAGAAGAGGGAGG - Intergenic
1048296854 8:133220850-133220872 GGGCCCGAGTGGGCTGGGGGTGG + Intronic
1048866661 8:138766382-138766404 AGGGGCGAGAGGAATGAGAGAGG + Intronic
1049261111 8:141639692-141639714 AGCGCCCTGTGGGAGGAGGGGGG + Intergenic
1049274313 8:141712039-141712061 AGGGCAGTGTGGGAGGAAGGAGG + Intergenic
1049362396 8:142218514-142218536 AGTGGTGAGTGGGATGAGAGGGG - Intronic
1049508929 8:143018272-143018294 AGGGCCGGGTGGAAGGAGGCCGG + Intronic
1049597701 8:143492335-143492357 AGGCCCTGGTGGGAGGAGGGAGG - Intronic
1050068972 9:1790726-1790748 GGGGCCTAGTGGGATGTGGTGGG + Intergenic
1053010278 9:34628968-34628990 AGGGCCGCCTGGGAGGCGGGCGG - Intergenic
1053142425 9:35690097-35690119 AGGGAAGAGGGGGATGGGGGCGG - Exonic
1058136559 9:101314192-101314214 AGGGCAGAATAGGAGGAGGGAGG - Intronic
1058388314 9:104464309-104464331 GAGGCAGAGTGAGATGAGGGAGG + Intergenic
1059102797 9:111485788-111485810 GGGCATGAGTGGGATGAGGGGGG - Intergenic
1060124009 9:121024253-121024275 AGGGGGGAGTGGGAGGGGGGAGG + Intronic
1060810747 9:126610422-126610444 AGGGCTGGGTGGGGTGGGGGAGG + Intergenic
1061433032 9:130543222-130543244 AGGGCAGAGGTGGATGAGGATGG + Intergenic
1061664971 9:132155288-132155310 AGGAATGGGTGGGATGAGGGTGG + Intergenic
1061986040 9:134130947-134130969 AGGGCCGGGTGGGAGGAGTGTGG - Intergenic
1062149575 9:135010698-135010720 AGGGTGTAGTGGGGTGAGGGTGG + Intergenic
1062154774 9:135040922-135040944 AGGGAAGAGAGGGATGAAGGAGG - Intergenic
1062524339 9:136972214-136972236 GGGGCCCCGTGGGAAGAGGGAGG + Intergenic
1062588690 9:137263389-137263411 AGGGCGGAGGGGGAGGAGGGAGG - Intronic
1062625039 9:137438744-137438766 AGGGCCCTGTGGGAGGGGGGCGG + Intronic
1185567973 X:1110103-1110125 AGGACCGAGGGGGGTGATGGTGG + Intergenic
1185603674 X:1355191-1355213 AGGGTGGAGGGGGAGGAGGGTGG + Intronic
1185603682 X:1355207-1355229 AGGGTGGAGGGGGAGGAGGGTGG + Intronic
1186293241 X:8121873-8121895 ATGGCTGAGGGGGATGGGGGAGG - Intergenic
1186443240 X:9604111-9604133 AGGGTGGAGTGGGATGGGGTGGG - Intronic
1187037577 X:15558074-15558096 AGGACAGAGTGGGATGAGAGAGG - Intergenic
1187542143 X:20207252-20207274 AGGTCAGAGTGGGATAGGGGAGG + Intronic
1190499840 X:51063431-51063453 AGGACCGAGAGAGAGGAGGGAGG - Intergenic
1195870227 X:109477997-109478019 AGGGGTGTGTGGGATGGGGGAGG + Intronic
1195879202 X:109575128-109575150 TGGGCAGACTGGTATGAGGGGGG - Intergenic
1197770543 X:130086536-130086558 AGGGCCGGGGAGGAGGAGGGAGG + Intronic