ID: 1159040193

View in Genome Browser
Species Human (GRCh38)
Location 18:63318021-63318043
Sequence CAGGTCCGAGATGCGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159040193 Original CRISPR CAGGTCCGAGATGCGGGGGT TGG (reversed) Intronic
900311805 1:2037062-2037084 CAGGTCTGAGATGAGGGTGCCGG + Intergenic
902115499 1:14117595-14117617 CAGGTCTGAAATCAGGGGGTGGG + Intergenic
903818067 1:26079557-26079579 CAGGTTCAAGCTGTGGGGGTGGG - Intergenic
905477557 1:38239560-38239582 CAGGAGCCAGATGCAGGGGTCGG - Intergenic
905862691 1:41361665-41361687 CAGGTGCTAGAAGCGGGGCTGGG + Intergenic
905911457 1:41657826-41657848 CAGGTCCGGGACAAGGGGGTCGG + Intronic
906143184 1:43545725-43545747 CAGGTCTGAGGAGCTGGGGTGGG - Intronic
907719402 1:56957751-56957773 GAGGTCACAGATGCTGGGGTTGG + Intronic
910946815 1:92601689-92601711 CAGGGGCTAGATGCGGGGTTAGG + Intronic
915912934 1:159925422-159925444 CAGGTCGGGGGTACGGGGGTCGG - Intronic
922586172 1:226736596-226736618 CAGCTCCGAGTTCCCGGGGTAGG + Exonic
922725437 1:227920891-227920913 CAGGACCCAGAGGCGGGGGTTGG - Exonic
1064004009 10:11686080-11686102 CAAGTTAGAGAGGCGGGGGTTGG + Intergenic
1070331061 10:75417632-75417654 CAGGTTTGAAATGCAGGGGTGGG + Intergenic
1072284821 10:93904411-93904433 CAGGTCGGAGAAGTGGGAGTAGG - Intronic
1072591779 10:96833257-96833279 AAGGTCCGGGAGGCGGGGGGCGG - Intronic
1074801907 10:117008231-117008253 CAGGACCAAGGTGTGGGGGTTGG + Intronic
1076625168 10:131817288-131817310 CAGGTCAGAGATGCAGGGAGTGG + Intergenic
1076707247 10:132308479-132308501 CAGGCCCGGGATGCGGGCGGCGG + Intronic
1077046752 11:550085-550107 CAGGTCCGAGATGTTGTTGTAGG - Exonic
1077262821 11:1632124-1632146 GAAGTCTGAGATGCAGGGGTGGG - Intergenic
1077301688 11:1850197-1850219 GAAGTCCGAGATCCTGGGGTGGG + Intergenic
1078842539 11:15092086-15092108 CAGTTTGGGGATGCGGGGGTAGG + Intergenic
1085527635 11:77173514-77173536 CAGGTTAGAGATGCGGGACTGGG + Intronic
1088909740 11:114181845-114181867 GAGGTGGGAGATGCGGGGCTGGG - Intronic
1090900292 11:131025095-131025117 CAGGTCCCAGATGAGAGGGAAGG + Intergenic
1096475232 12:51905609-51905631 CAGGACAGAGATCCAGGGGTTGG + Intergenic
1096538160 12:52288421-52288443 CAGGTCTGACTTGCGGAGGTAGG + Exonic
1096540616 12:52304945-52304967 CAGGTCTGATTTGCGGAGGTAGG - Exonic
1096542826 12:52317741-52317763 CAGGTCTGACTTGCGGAGGTAGG + Exonic
1096876993 12:54637100-54637122 CAGGTGGGAGATGGGAGGGTGGG + Intergenic
1100632324 12:96400675-96400697 CCGCTCCGAAATGCGGGCGTCGG + Intergenic
1102470709 12:113158312-113158334 CAGGTGCCAGAGGCGGGAGTTGG - Exonic
1104660694 12:130609758-130609780 CAGGTCTGGGAAGTGGGGGTAGG + Intronic
1104929353 12:132329733-132329755 CAGGTCCGGGGGGCGGGGGACGG + Intergenic
1104970575 12:132528931-132528953 CAGGTCCGGGGGGCAGGGGTCGG - Intronic
1105015873 12:132786635-132786657 CAGGTGGGAGGTGCGGGGGCCGG - Intronic
1113743921 13:112729609-112729631 CAGGTCCGCAATGCCGAGGTGGG - Intronic
1119062071 14:71485284-71485306 CTGGTCCGTGGTCCGGGGGTTGG - Intronic
1122073239 14:99218971-99218993 CAGGTCCAAGATGGAGGGGTCGG - Intronic
1124374703 15:29122675-29122697 CAGGCCGGTGTTGCGGGGGTTGG - Exonic
1133708140 16:8375293-8375315 CAGCTCCGAGAGGTGGGAGTAGG + Intergenic
1138387091 16:56643298-56643320 CTGGTGCGGGGTGCGGGGGTGGG + Intronic
1139371444 16:66471839-66471861 CAGGTTGGTGATGCAGGGGTGGG - Intronic
1142051263 16:87959751-87959773 CAGGTCCCGGGTGAGGGGGTGGG + Intronic
1142215403 16:88827272-88827294 CAGCTCCGAGTGGCTGGGGTGGG + Intronic
1143166950 17:4901647-4901669 CAGGTCAGAGCTTCTGGGGTGGG - Exonic
1143513443 17:7407999-7408021 CAGGCCCGACCTGCGGGGGGTGG - Intronic
1144258196 17:13490726-13490748 CAGGTCCGTGGTGAGGGGTTGGG + Intergenic
1146857460 17:36265797-36265819 ACAGTCCGAGATGGGGGGGTGGG - Intronic
1146863159 17:36322578-36322600 ACAGTCCGAGATGGGGGGGTGGG + Intronic
1147076252 17:37990333-37990355 ACAGTCCGAGATGGGGGGGTGGG - Intronic
1147077551 17:38002726-38002748 ACAGTCCGAGATGGGGGGGTGGG + Intronic
1147087777 17:38069878-38069900 ACAGTCCGAGATGGGGGGGTGGG - Intergenic
1147093486 17:38126661-38126683 ACAGTCCGAGATGCGGGGGTGGG + Intergenic
1147103721 17:38193827-38193849 ACAGTCCGAGATGCGGGGGTGGG - Intergenic
1147316977 17:39625677-39625699 CAGGACCCAGATGCTGGGGCTGG + Intergenic
1147962731 17:44177735-44177757 CAGGGCCGAGATGGGGAGGAGGG + Intronic
1148463520 17:47851272-47851294 CAGGGCCGCGAGGAGGGGGTGGG + Intronic
1149848296 17:60020363-60020385 ACAGTCCGAGATGGGGGGGTGGG - Intergenic
1149861873 17:60126161-60126183 ACAGTCCGAGATGGGGGGGTGGG + Intergenic
1150654904 17:67033199-67033221 CAGGTCTGAGATGCAGCGGGAGG - Exonic
1151195636 17:72429599-72429621 CCCGTTCCAGATGCGGGGGTTGG - Intergenic
1152524435 17:80879436-80879458 CAGGCCCGGGATGTGGGAGTGGG - Intronic
1159040193 18:63318021-63318043 CAGGTCCGAGATGCGGGGGTTGG - Intronic
1161255280 19:3305369-3305391 GAGGTCGGAGATGCTGGGTTGGG + Intergenic
1161812523 19:6478917-6478939 CAGGTGCGGGATATGGGGGTTGG - Exonic
1162781768 19:13010376-13010398 CACGTCCGAGTTGCCGGGCTGGG - Intronic
1162782602 19:13014316-13014338 CAGGGCCCAGAGGCGGGGGAGGG - Intronic
1163315773 19:16539557-16539579 TAGGTTTGAGATGCGGGGGTGGG - Intronic
1166683791 19:44782972-44782994 CAGGGCTGAGGTGCAGGGGTAGG + Intronic
1167601928 19:50459521-50459543 GAGGTGAGAGATGGGGGGGTGGG + Intronic
933902444 2:86859730-86859752 CAGGGCAGAGATGCAGGAGTTGG + Intronic
940329632 2:152460566-152460588 CAGGTCCGTGGCCCGGGGGTTGG - Intronic
944413541 2:199463357-199463379 CAGCTCGGAGCTGCCGGGGTTGG + Intronic
948079171 2:235191552-235191574 CAGGGCCGAGTGGCGGGGTTTGG - Intergenic
1170162010 20:13322871-13322893 CAGGTCAGGGCAGCGGGGGTGGG - Intergenic
1175502629 20:59461199-59461221 CAGGTCTGAGATGAGGCAGTGGG + Intergenic
1181530870 22:23516634-23516656 CAGATCCCAGAGGCCGGGGTGGG + Intergenic
1182367689 22:29789807-29789829 TAGGGCCGGGATGCGGGAGTGGG + Intronic
1183487675 22:38098036-38098058 GAGGGCCGGGAAGCGGGGGTGGG - Intronic
1185258384 22:49848945-49848967 CAGAGCCGAGATGCCCGGGTGGG + Intergenic
950430639 3:12948994-12949016 CAGGTACAAGATGCCGTGGTGGG + Intronic
953398531 3:42591611-42591633 CAGGTCAGGGGCGCGGGGGTGGG - Intronic
953842442 3:46400103-46400125 CAGGCCCGGGAGGCTGGGGTGGG - Intergenic
961089146 3:124094564-124094586 GAGGTCGGAGATGCGTGGGAGGG - Intronic
967901805 3:194462333-194462355 CAGGTCCGTGACCCAGGGGTTGG - Intronic
968937860 4:3622558-3622580 CAAGTCTGAGATGTGGGGCTGGG - Intergenic
985532178 5:440381-440403 CAGGCCCGAGAAGCTGGTGTGGG - Intergenic
990579151 5:57151366-57151388 CAGGTTCCAGCTGCTGGGGTGGG + Intergenic
995068155 5:107885822-107885844 CAGGCACGAGATGTGGGGGTGGG + Intronic
995528273 5:113068091-113068113 CAGTTCCGAGCGGCGGGCGTGGG - Exonic
997282213 5:132656365-132656387 CCGGTCCGGGAGGCAGGGGTGGG - Intronic
999147245 5:149404756-149404778 CAGGTCAGAGATGGTGGGTTAGG - Intergenic
1000310413 5:160038030-160038052 CAGGGCAGGGTTGCGGGGGTGGG + Intronic
1001032607 5:168273632-168273654 CAGGTTGGTGGTGCGGGGGTGGG + Intergenic
1002081690 5:176741264-176741286 CAGATCCTAGCTGCGGGGGGTGG - Intergenic
1003952473 6:11128695-11128717 CAGGTTCCAGTTGCTGGGGTGGG + Intronic
1003958855 6:11190944-11190966 ACTGTCCGAGTTGCGGGGGTGGG + Exonic
1004284423 6:14307664-14307686 TAGGACCAAGGTGCGGGGGTGGG - Intergenic
1007159279 6:39775630-39775652 TAGGTCCTAAATGAGGGGGTGGG - Intergenic
1023042075 7:36180852-36180874 CAGGTGCATGATGAGGGGGTGGG - Intronic
1034441977 7:151090225-151090247 CAGTTCCCAGATGGGGGGGGGGG + Intronic
1039249078 8:35642063-35642085 CAGGTCAGAGAGGCAGGGGGAGG - Intronic
1044402361 8:91787753-91787775 CAGGCCAGAGATGCAGGGGATGG + Intergenic
1049194492 8:141308039-141308061 CAGGTGCGAGGTGCAGGGGGCGG + Intronic
1051359720 9:16271092-16271114 CAGGTCTGAGAAGGGGGTGTCGG - Intronic
1051665572 9:19464731-19464753 CAGTTGGGAGATGCGGGCGTGGG + Intergenic
1056660667 9:88540720-88540742 CAGGTCCGGACTGCCGGGGTGGG + Intronic
1057499276 9:95584160-95584182 CAGGACTGAGATGGGGGGATAGG - Intergenic
1060722510 9:125988511-125988533 CAGGACAGAGAGGTGGGGGTGGG - Intergenic
1061252469 9:129434636-129434658 CAGCTGGGAGATGCTGGGGTGGG - Intergenic
1062054217 9:134462596-134462618 CAGTGCAGAGATGTGGGGGTGGG + Intergenic
1062427469 9:136512573-136512595 CAGGTCCGGCTGGCGGGGGTGGG + Intronic
1191216292 X:57934778-57934800 CAGGGCGGAAATGCGGGGGTGGG + Intergenic
1192907618 X:75567984-75568006 CAGGTCTGAGGTGTGGGTGTGGG + Intergenic
1194931059 X:99887988-99888010 CAGCTCGGTGGTGCGGGGGTGGG + Intergenic
1195763783 X:108274973-108274995 CAGGTCATATAGGCGGGGGTGGG + Intronic
1197819854 X:130531590-130531612 CAGGGCTGAGAAGCGGGGGTGGG - Intergenic
1197821087 X:130541624-130541646 CAGGTCCGAATTGAGGGGTTGGG - Intergenic