ID: 1159042780

View in Genome Browser
Species Human (GRCh38)
Location 18:63340899-63340921
Sequence CTGTGTTGTGGGAGGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 513}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159042780_1159042787 29 Left 1159042780 18:63340899-63340921 CCTGCTTGCCTCCCACAACACAG 0: 1
1: 0
2: 3
3: 38
4: 513
Right 1159042787 18:63340951-63340973 AGAAGACATGATTCCTCAGTAGG 0: 1
1: 0
2: 0
3: 22
4: 168
1159042780_1159042788 30 Left 1159042780 18:63340899-63340921 CCTGCTTGCCTCCCACAACACAG 0: 1
1: 0
2: 3
3: 38
4: 513
Right 1159042788 18:63340952-63340974 GAAGACATGATTCCTCAGTAGGG 0: 1
1: 0
2: 0
3: 18
4: 263
1159042780_1159042784 2 Left 1159042780 18:63340899-63340921 CCTGCTTGCCTCCCACAACACAG 0: 1
1: 0
2: 3
3: 38
4: 513
Right 1159042784 18:63340924-63340946 AGCAAGTCTTACTCTCCCAAAGG 0: 1
1: 0
2: 0
3: 5
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159042780 Original CRISPR CTGTGTTGTGGGAGGCAAGC AGG (reversed) Intronic
900358695 1:2277347-2277369 ATGTGTTGTGGGAGGGACCCAGG + Intronic
901767544 1:11513025-11513047 ATGTGTTGTGGGAGGGACCCAGG - Intronic
902634785 1:17728169-17728191 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
902659122 1:17889236-17889258 ATGTGTTGTGGGAGGGACGAGGG - Intergenic
902819195 1:18933236-18933258 CTGCCTTGTGCCAGGCAAGCAGG + Intronic
903928441 1:26848594-26848616 CTGTGTTGTCTGAGGGAAGGAGG - Exonic
904255258 1:29250652-29250674 CTGTGTTGATGGAGTCAAGAAGG + Intronic
905632839 1:39528357-39528379 CTGGGCTGTGGGAGGCAACCAGG - Intergenic
905803331 1:40859719-40859741 CTGAGATGTGGGAGAAAAGCTGG - Intergenic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
907392408 1:54166876-54166898 ATGTGTTGTGGGAGGAACCCAGG - Intronic
907941029 1:59087563-59087585 ATGTGTTGTGGGAGGGATGCAGG - Intergenic
908624930 1:66029308-66029330 ATGTGTTGTGGGAGGGACTCAGG - Intronic
909512808 1:76474103-76474125 ATGTGTTGACTGAGGCAAGCTGG - Intronic
909681395 1:78295371-78295393 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
910085471 1:83396632-83396654 TTGTGTTGTGGGAGGGACCCCGG - Intergenic
910746804 1:90583124-90583146 CCATGTTGTGGGAGGGAACCAGG + Intergenic
910774405 1:90861125-90861147 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
910792220 1:91063446-91063468 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
910818045 1:91312831-91312853 ATGTGTTGTGGGAGGGACCCAGG + Intronic
911295948 1:96115000-96115022 CTGTGTTGTGTGGTGGAAGCAGG + Intergenic
911841510 1:102688057-102688079 CTGTGAGGTGGGAAGCAAGATGG - Intergenic
912476794 1:109943209-109943231 CTGTGTGGTGGGTGGTAGGCAGG - Intergenic
912698889 1:111861556-111861578 CTGTGTTTACGGAGGGAAGCGGG + Intronic
912702412 1:111888135-111888157 CTGTGGGGTGGGAGGGAAGAGGG + Intronic
912776834 1:112510721-112510743 CAGTGTTGGGGAAGGCAAGGAGG + Intronic
913301009 1:117368244-117368266 CTGTGATGTGGGAAGGAAGGCGG - Exonic
913389647 1:118296202-118296224 GTGTGTTGTGGGAGGGAAGGTGG - Intergenic
914342702 1:146773899-146773921 CAGTGTGATGGGAGGGAAGCAGG - Intergenic
914877927 1:151526118-151526140 CAGTGCTTTGGGAGGCAAGGTGG - Intronic
915101779 1:153506285-153506307 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
915271760 1:154758627-154758649 CTGTGCAGTGGGGGGCAAGCAGG + Intronic
916533544 1:165681095-165681117 ATGTGTTGTGGGAGGGACCCAGG - Intronic
916734675 1:167597419-167597441 CCATGTTGTGGGAGGGAACCAGG - Intergenic
916786653 1:168091536-168091558 CTGGGTGGTGGGATGCAGGCAGG - Intronic
917998880 1:180471710-180471732 ATGTGTTGTGGGAGGGACCCAGG - Intronic
918058917 1:181045631-181045653 CAGTGTTATGGGATCCAAGCTGG - Intronic
919200543 1:194349704-194349726 ATGTGTTGTGGGAGGGACACAGG + Intergenic
919288765 1:195601202-195601224 ATGTGTTGTAGGAGGCACTCAGG - Intergenic
919664764 1:200281488-200281510 ACGTGTTGTGGGAGGGAACCAGG - Intergenic
919894818 1:202002983-202003005 CTGTGTTGTCAGAGCCAAGTTGG - Intronic
920857201 1:209672962-209672984 CTGTGTTGTGTCATGCATGCAGG - Intergenic
921033431 1:211353884-211353906 CTGTGTTGAGGGAGGATACCAGG + Intronic
921792848 1:219309526-219309548 ATGTGTTGTGGGAGGAACCCGGG + Intergenic
922905115 1:229168433-229168455 CTGTGTGGGGGGAGGCAAGGGGG - Intergenic
923919522 1:238547524-238547546 ATGTGTTGTGGGAGGGACACAGG - Intergenic
1062808274 10:441492-441514 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1063584343 10:7337918-7337940 CTGTGTTTTGGGGGCCAGGCTGG - Intronic
1063910014 10:10819975-10819997 GTGTGTTGTGGGAGGGACCCAGG + Intergenic
1065347602 10:24764194-24764216 CTGTGTTATGGGAGGGACCCAGG - Intergenic
1065671293 10:28121059-28121081 CAGTGTTTTGGGAGGCAAGGTGG + Intronic
1066494342 10:35927667-35927689 CTGTGTTCTGGGAGGCTAAGAGG + Intergenic
1067089715 10:43260390-43260412 CTGTCTTATGTGAGGCAACCGGG - Intronic
1067548947 10:47219772-47219794 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
1067565535 10:47333614-47333636 CTGTGTTGTTTGAGGCAAAGAGG - Intergenic
1067735302 10:48845883-48845905 CTGTGGAGTGGTAGGCAAGAGGG + Intronic
1067824228 10:49558323-49558345 CTGTGTGGAGTGAGGTAAGCTGG + Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1069219871 10:65869779-65869801 TTGTGTTGTGTGAGGCCAGAGGG - Intergenic
1069776152 10:70928467-70928489 CTGTGTTTGGGGAGGGGAGCAGG + Intergenic
1070780588 10:79135424-79135446 CTCTGTTGGGGGAGGCCAGGAGG + Intronic
1070923244 10:80202187-80202209 CTGTTCTGTGGGGGGGAAGCGGG + Intronic
1073855739 10:107671211-107671233 ACGTGTTGTGGGAGGGACGCAGG - Intergenic
1073890555 10:108096438-108096460 CTGTGCTGTGGGCAGCAAGAAGG - Intergenic
1074291237 10:112139383-112139405 GTGTGTTGTGGGGTGCCAGCTGG - Intergenic
1074321469 10:112407154-112407176 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1074744128 10:116514642-116514664 CTGTGATGGGGGAGGGAAGTGGG + Intergenic
1074967374 10:118503308-118503330 CTCTGTTATGGGAGTCAAGAAGG - Intergenic
1075147297 10:119892968-119892990 GTGTGTGGTGGGAGGCGGGCGGG + Intronic
1075509144 10:123055398-123055420 ATGTGTTGTGGGAGGGACCCGGG - Exonic
1075543538 10:123336534-123336556 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1075723972 10:124602466-124602488 CTGGGTTGTGGGCAGCAGGCAGG + Intronic
1075776933 10:124995220-124995242 CTGTGTTCTGGGCGGGAGGCAGG + Intronic
1075786460 10:125053420-125053442 CTGTGTTGGGGGATGCCAGGAGG - Intronic
1075875861 10:125805011-125805033 CTGTGATGTGGGAAGCAATATGG + Intronic
1076014578 10:127017700-127017722 CTGAGTGGGGGGAAGCAAGCAGG + Intronic
1076705106 10:132297203-132297225 GTGTGGGGTGGGAGCCAAGCAGG - Intronic
1076760244 10:132600906-132600928 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1076887799 10:133270581-133270603 CCGTGTTGTGGGAGGGAGGTGGG - Intronic
1077022858 11:426939-426961 CTATGTGCTGGGAGGCCAGCTGG - Intronic
1077048715 11:557187-557209 CTGGGTACTGGGAGGCAAGAGGG - Intronic
1079248745 11:18772198-18772220 CTGTGTAGCAAGAGGCAAGCAGG - Intronic
1082126268 11:48434736-48434758 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1082559854 11:54605564-54605586 CTGTGTTGTGGGTGGGGAGGGGG - Intergenic
1083712651 11:64558731-64558753 CTGTGAGGTGGCAGGCAAGGTGG - Intronic
1083713106 11:64560650-64560672 CTGTGATGAGGGAAGCAAGGAGG - Intronic
1083715898 11:64576844-64576866 CTGGGTTGGGGGAGGCAAGCAGG - Intergenic
1084322298 11:68380347-68380369 CTGTGTTGACTGAGGCAGGCTGG + Intronic
1084861914 11:72024531-72024553 CTGTGTGGTGGGTGGGAAGAGGG + Intronic
1086231567 11:84576958-84576980 GTGTGTTGTGGGAGGGACTCGGG + Intronic
1087045929 11:93843981-93844003 CTGTGCTGTGGGAGCCTAGTGGG - Intronic
1088033491 11:105281256-105281278 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1088733309 11:112703294-112703316 ATGTGTTGAGGGAGGCAGGTTGG + Intergenic
1089104642 11:115992271-115992293 CTGCGAGGTGGGAGGCATGCAGG - Intergenic
1091065553 11:132508572-132508594 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1091291855 11:134444949-134444971 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1091441898 12:517474-517496 GTGTCTTGTGGGAGGCGAGGGGG + Intronic
1091878656 12:3958757-3958779 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1092093480 12:5823036-5823058 ATGTGTTGTGGGAGGGACACAGG - Intronic
1092799679 12:12152065-12152087 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1093962738 12:25293020-25293042 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1094297711 12:28926714-28926736 CTGTGTTGTGGGAGGGACCCAGG + Intergenic
1097187347 12:57202903-57202925 CTGTGTTTGGGGAGGGGAGCGGG - Intronic
1097707733 12:62885188-62885210 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1097778932 12:63681485-63681507 CTGTGATGTGTTAGACAAGCTGG + Intergenic
1099445237 12:82744023-82744045 CTGTGCTCTGGGAGGCCAGGCGG + Intronic
1099846317 12:88032300-88032322 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1101548269 12:105737261-105737283 GTGTGTGGTGGGAAGCAAACTGG + Intergenic
1102148849 12:110674556-110674578 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1102211586 12:111131328-111131350 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1102249158 12:111374256-111374278 ATGTGTTGTGGGAGGGACCCTGG - Intergenic
1102261076 12:111443707-111443729 TAGTGTAGTGGGAGCCAAGCAGG + Intronic
1104036458 12:125100779-125100801 GAGTGTTGTGGGAGGGAGGCTGG - Intronic
1105063192 12:133172777-133172799 CTGGGATGTGAGAGGGAAGCAGG + Intronic
1105530102 13:21211386-21211408 GTGTGTTGTGGGAGGGACCCAGG + Intergenic
1105759931 13:23504249-23504271 GTGTGTTGTGGGATGCCAGCAGG - Intergenic
1105793732 13:23830420-23830442 CTTTCCTCTGGGAGGCAAGCGGG + Intronic
1106088333 13:26562741-26562763 GGGTGTTGAGGGAGGGAAGCTGG + Intronic
1106917475 13:34530508-34530530 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1108175620 13:47790010-47790032 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1109143753 13:58750619-58750641 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1109482590 13:62974991-62975013 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1109901033 13:68770471-68770493 ATGTGTTGTGGGAGGAAACCAGG + Intergenic
1110453139 13:75659642-75659664 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1110713731 13:78677965-78677987 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1111658879 13:91184539-91184561 CTGTGTTGTGGCAGGGATGGAGG + Intergenic
1112968162 13:105224959-105224981 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1113109108 13:106802862-106802884 CGGGGTTGCGGGAGGCAGGCTGG + Intergenic
1115021400 14:28684984-28685006 ATGTGTTGTGGGAGGCATCCAGG + Intergenic
1115566866 14:34631697-34631719 CTGTGTTTTAGGAGGAAAACTGG - Intergenic
1115903427 14:38180093-38180115 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1116400466 14:44500271-44500293 ACGTGTTGTGGGAGGGATGCAGG - Intergenic
1116564770 14:46431686-46431708 ACGTGTTGTGGGAGGCACCCAGG - Intergenic
1117352048 14:54890899-54890921 CTGTGTAGTCAGAGGGAAGCTGG - Intronic
1118401098 14:65380325-65380347 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
1118418550 14:65573217-65573239 CTTTGTTGTGGGTGGGGAGCAGG - Intronic
1118718390 14:68576390-68576412 CTGGGTTGGGGGTGGCAGGCAGG - Intronic
1119716870 14:76865886-76865908 CTCTTTTGTGGGAGGGAAGGGGG + Intronic
1120366870 14:83582444-83582466 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1120546102 14:85813299-85813321 CTGTCTTGTGGGAAGCATGGAGG - Intergenic
1120753740 14:88222254-88222276 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1120760397 14:88279800-88279822 ATGTGTTGTGGGAGGAACCCAGG + Intronic
1121265126 14:92596857-92596879 CTGTGTTTTTGGTGGCATGCTGG + Intronic
1121314419 14:92952669-92952691 GGGTGTTGTGGGAGGCAGGCGGG - Intronic
1121881747 14:97507092-97507114 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1122297150 14:100712086-100712108 CTGGGTTGTGGGAGGGGAGCAGG + Intergenic
1122822914 14:104356081-104356103 CTGGGTTGTGGGAGGCATTTGGG + Intergenic
1122863471 14:104593129-104593151 CAGGGTTGGGGGAGACAAGCTGG + Exonic
1123046256 14:105517661-105517683 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1202895094 14_GL000194v1_random:2204-2226 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1124390126 15:29247680-29247702 CAGGGTTGGGGGAGGGAAGCTGG - Intronic
1126348777 15:47723039-47723061 CTGTGTTCTTGGAAGCAATCCGG - Intronic
1127145146 15:56015816-56015838 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1127843161 15:62847492-62847514 CAGTGTGGTGGGAGGCCAGCAGG + Intergenic
1128688706 15:69706962-69706984 ATGTGTTGTGGGAGTCACCCAGG - Intergenic
1130241817 15:82200603-82200625 CTGTGTTCTGGGAGGCTCCCAGG - Intronic
1130458611 15:84140559-84140581 CTGTGTTCTGGGAGGCTCCCAGG + Intergenic
1130551741 15:84893785-84893807 CCGTGTGGTGCGTGGCAAGCAGG - Intronic
1130835356 15:87644803-87644825 CTGTGTTAAGGGATGCAGGCAGG - Intergenic
1131344577 15:91634114-91634136 CTGGGGTGTGGGAGACATGCAGG + Intergenic
1132589471 16:720439-720461 GAGTGTGGTGGGAGGAAAGCCGG - Intronic
1132955718 16:2592296-2592318 CTGTTTTGAGGGAGCCAAGATGG + Intronic
1133344348 16:5060076-5060098 CTGTGGCATGGGAGGCCAGCGGG + Intronic
1133939575 16:10297135-10297157 CTGTGTTTTGGGAGACACGGAGG + Intergenic
1133952960 16:10413231-10413253 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1134206090 16:12238937-12238959 CTGTGTTGTAGGTAGCAAACAGG + Intronic
1134768417 16:16782768-16782790 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1135673187 16:24392151-24392173 CTGTGTTGTGGAAGAAGAGCTGG - Intergenic
1137443879 16:48520193-48520215 CTGAGTGCTGGGAGGCAAGAAGG - Intergenic
1139827775 16:69770996-69771018 CTGTGTTGTGAGAGTATAGCAGG + Intronic
1139991282 16:70941429-70941451 CAGTGTGATGGGAGGGAAGCAGG + Intronic
1140204519 16:72922550-72922572 CTGGGTTGAGGGTGACAAGCAGG - Intronic
1140347862 16:74232391-74232413 CAGTGCTTTGGGAGGCAAGGTGG - Intergenic
1140910466 16:79446662-79446684 CAGTGCTTTGGGAGGCAAGGTGG + Intergenic
1142155686 16:88531979-88532001 CTGTGGGGTGGGAAGCAGGCGGG - Intronic
1142271397 16:89091463-89091485 ATGTGGTGTGGGAGGGAAGCAGG + Intronic
1143182040 17:4989388-4989410 CTGGGTTCTGGGAGTCATGCAGG - Intronic
1143857251 17:9861069-9861091 CGCTGTGGTGGGAGGCAAGCAGG + Intronic
1144579543 17:16450666-16450688 CTGTGTGGAGGGAAGCAAGGCGG + Intronic
1144787675 17:17840807-17840829 CACTGCTGTGGGAGCCAAGCTGG + Intergenic
1146376478 17:32298191-32298213 CGGTGTTGTGGCAGGTAGGCAGG + Exonic
1147546754 17:41407919-41407941 ATGGGTAGTGGGAGCCAAGCTGG + Intergenic
1149064519 17:52464614-52464636 ATGTGTTGTGGGAGGAACCCAGG + Intergenic
1150729170 17:67677025-67677047 TTGTGTTTTGTGAGGCAGGCAGG + Intronic
1150941617 17:69699482-69699504 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1150976343 17:70091401-70091423 CTGTGTTGGAGGAGGGTAGCTGG - Intronic
1151172653 17:72260312-72260334 TTGCTTTGTCGGAGGCAAGCTGG + Intergenic
1151215634 17:72574899-72574921 CTGTGCTGTGGCAGGCGAGAAGG - Intergenic
1152502357 17:80720903-80720925 GTGTGGTGTGAGAGGCAAGCAGG + Intronic
1152695426 17:81741585-81741607 CTGGCTTGTGGGAAGCAGGCTGG - Intergenic
1153012137 18:548795-548817 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1155156618 18:23163080-23163102 CTGTGTTGTGGGGTGCAGGGTGG + Intronic
1155381845 18:25231320-25231342 CTGTGTTGGAGGAGGACAGCTGG + Intronic
1155933585 18:31731359-31731381 CTGGGTGGTAGGAGGCAAGTGGG - Intergenic
1156559864 18:38111513-38111535 CCGTGTTGTGGGAGGGACCCTGG + Intergenic
1156895327 18:42239729-42239751 CTGGGTAGAGAGAGGCAAGCGGG - Intergenic
1157377962 18:47183204-47183226 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1157452362 18:47798537-47798559 CTGTGTTGTGGGACACACACGGG + Intergenic
1157738835 18:50074281-50074303 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1158550810 18:58434288-58434310 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1159042780 18:63340899-63340921 CTGTGTTGTGGGAGGCAAGCAGG - Intronic
1160432665 18:78822640-78822662 CTGTCCTGTGGGAGACACGCTGG + Intergenic
1160601804 18:80019440-80019462 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1161047036 19:2140586-2140608 CAGTGCTTTGGGAGGCTAGCGGG - Intronic
1162337338 19:10070149-10070171 CTGTGTTGTGAGTGGCAAAGGGG + Intergenic
1162935550 19:13979877-13979899 CTGTGCTGTGGCGGGCATGCGGG + Intronic
1163519220 19:17781857-17781879 CTGTGTTGGGGGAGTCCAGCAGG + Intronic
1163721735 19:18901123-18901145 CTGGGTTTTGGGAGGCACTCAGG - Intronic
1164494950 19:28751235-28751257 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1164841288 19:31394333-31394355 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1165468892 19:35991858-35991880 CTGTGTTGGAGGAAGCAAACTGG - Intergenic
1166231337 19:41427218-41427240 GGGTGTTGCGGGAGGCAGGCTGG - Intronic
1167087808 19:47322374-47322396 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1167403322 19:49287485-49287507 ATGTGTTGTGGGAGGAACCCAGG + Intergenic
1167498093 19:49830847-49830869 CTGTGCCGTGGGAGCCAGGCCGG - Exonic
1168251275 19:55143648-55143670 CAGAGGGGTGGGAGGCAAGCCGG - Intronic
925176537 2:1788487-1788509 CTGTGTTCTGGGAGACAGGCAGG + Intergenic
925257269 2:2500713-2500735 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
925598889 2:5588086-5588108 CTGTGCTTTGGGATGAAAGCAGG + Intergenic
925805771 2:7646249-7646271 ATGTGTTATGGGAGGGAACCAGG - Intergenic
926119269 2:10232738-10232760 CTGTGTTGTGGGAGAGAAGGTGG + Intergenic
926274762 2:11395499-11395521 ATGTGTTGTGTGGGGAAAGCTGG + Intergenic
926349717 2:11983825-11983847 CTGTCCTGAGGGAGGCAAGGAGG - Intergenic
927288426 2:21380373-21380395 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
928122588 2:28593778-28593800 CTCTGTTGTGGGGGGAACGCTGG - Intronic
928894397 2:36243996-36244018 CTGTGGCGTGGTAGGCAAGATGG - Intergenic
929057912 2:37894454-37894476 CTGTCTTGATGGAGGAAAGCTGG - Intergenic
929134466 2:38609769-38609791 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
929688571 2:44055870-44055892 CTGAGGTGTGGGAGCCAAGACGG - Intergenic
930019654 2:46993872-46993894 CTGTGTTGGGGCAGGCAAGCAGG - Intronic
931202832 2:60116773-60116795 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
931288191 2:60850081-60850103 CTGTGGTGTGGGAGGGATCCAGG - Intergenic
932814343 2:74849779-74849801 CTGTTTTGTGGCAAGGAAGCTGG + Intronic
932904275 2:75733094-75733116 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
932976324 2:76603543-76603565 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
933397725 2:81753808-81753830 ATGTGTTGTGGGAGGCACCCGGG - Intergenic
933902205 2:86858166-86858188 CTGTGTTTCGGGATGCAAGCCGG - Exonic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
935608490 2:104995460-104995482 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
935778339 2:106491102-106491124 CTGTGTTTCGGGATGCAAGCCGG + Intergenic
936115650 2:109700897-109700919 AGGTGATGTGGGAGGAAAGCGGG + Intergenic
937306904 2:120877195-120877217 ATGTGGTGTGATAGGCAAGCTGG - Intronic
937953079 2:127403185-127403207 CTTTGCTGTGGGTGGCAATCAGG + Intergenic
938868721 2:135452271-135452293 ATGTGTTGTGGGAGGGACCCAGG - Intronic
939272745 2:139960727-139960749 ATGTGTTGTGGGAGGGACCCGGG + Intergenic
939287573 2:140153472-140153494 ATGTGTTGTGGGAGGGACTCAGG - Intergenic
940462128 2:153978469-153978491 ATGTGTTGTGGGAGGGACCCTGG + Intronic
941477383 2:165966661-165966683 CTGTGTTGTGAGAGGGACCCAGG + Intergenic
942118045 2:172748558-172748580 TTGTGTTGTGGGAGGGGACCCGG - Intronic
942223864 2:173797903-173797925 CTTTTTTGTGAGCGGCAAGCTGG + Intergenic
943072057 2:183153161-183153183 ATGTGTTGTGGGAGGAACCCAGG - Intronic
944828153 2:203505447-203505469 CTGTGTTGTGGGAGGGACCCGGG - Intronic
945001638 2:205357175-205357197 GTGTGTTGTGGGAGGAGAGAAGG + Intronic
945333929 2:208569750-208569772 CTGAGGTGTGAGAGGAAAGCAGG + Intronic
945527989 2:210912697-210912719 CTGTGTTGTCGGAGGGACCCAGG + Intergenic
947093792 2:226543475-226543497 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
947764015 2:232624302-232624324 CTGTGGTCTGGGGGGCAAGCTGG - Intronic
949031511 2:241799441-241799463 CTCTGTTGTGGGGAGCAAGAAGG - Intronic
1169130237 20:3163065-3163087 CTGAGTTTTGGGGGGCAAGGTGG - Exonic
1169464558 20:5826047-5826069 ATGAGTGGTGGGAGGCCAGCTGG + Intronic
1169955179 20:11094395-11094417 CTTTGTTGTTGGAGGCAAATTGG - Intergenic
1170106780 20:12759900-12759922 ACGTGTTGTGGGAGGGAACCAGG - Intergenic
1170395751 20:15923423-15923445 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1170593362 20:17787620-17787642 GGGTGTGGAGGGAGGCAAGCAGG - Intergenic
1170612478 20:17925939-17925961 CTGCCTCGTGGCAGGCAAGCAGG + Intergenic
1171170548 20:23011696-23011718 CTGGGTTGTGGGAGGGAGGTGGG + Intergenic
1172065973 20:32220811-32220833 CTGTCATCTGGGAGCCAAGCTGG + Intronic
1173290724 20:41712685-41712707 CTGTGTTTAGGGAAGCAGGCTGG - Intergenic
1173545649 20:43895825-43895847 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1174130536 20:48340828-48340850 CTGGGCTGCGGGAGGCAAGCTGG - Intergenic
1174394497 20:50238288-50238310 CTGTGTGATGGAATGCAAGCCGG + Intergenic
1175195235 20:57238918-57238940 ATGTGTTGTGGGAGGGACTCGGG - Intronic
1175195529 20:57240846-57240868 ACGTGTTGTGGGAGGCACCCAGG - Intronic
1175202577 20:57288236-57288258 AGGTCTTGGGGGAGGCAAGCAGG - Intergenic
1175304609 20:57967220-57967242 CCCTGTTGTGTGAGGCAGGCTGG - Intergenic
1176414436 21:6466885-6466907 CTGAGCTGTAGGATGCAAGCGGG - Intergenic
1176614796 21:9018191-9018213 CTGTGGGCTGGGAGGCCAGCTGG + Intergenic
1176927453 21:14767162-14767184 CTGAGTAGGGGGAGACAAGCTGG + Intergenic
1177017771 21:15813964-15813986 GTGTGTTGTGGGAGGGACCCAGG + Intronic
1177063388 21:16400140-16400162 CTGTGTTGTGAGAGTATAGCAGG - Intergenic
1177118035 21:17109294-17109316 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1177118297 21:17111211-17111233 ATGTGTTGTAGGAGGCATACAGG - Intergenic
1177433186 21:21016866-21016888 CTGTGTAGTGGGAGGCACCCAGG - Intronic
1177485158 21:21746829-21746851 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1178207723 21:30488815-30488837 ATGTGTTGTGGGAGGGATCCAGG - Intronic
1178469172 21:32876327-32876349 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1179390237 21:40982343-40982365 CTGTGTTTTGAGAGTAAAGCAGG - Intergenic
1179689934 21:43075207-43075229 CTGAGCTGTAGGATGCAAGCGGG - Intronic
1180007454 21:45029423-45029445 CTGGGGTGCTGGAGGCAAGCGGG + Intergenic
1181956262 22:26589877-26589899 CTGGGATCTGGGAGGCAGGCAGG - Intronic
1182142708 22:27975573-27975595 CTGTCGTGCGGGAGGCAAGGCGG - Intergenic
1182152991 22:28043589-28043611 CTGGGCTGTGGGAGGCAGTCTGG - Intronic
1182541893 22:31047772-31047794 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1182566935 22:31207035-31207057 CTGTGTTGTGGAGGGCGAGTGGG + Intergenic
1182889027 22:33800984-33801006 ATGTGTTGTGGGAGGGACCCGGG + Intronic
1183187752 22:36301783-36301805 CTGTGGTGGGGGCTGCAAGCAGG + Intronic
1183307638 22:37091264-37091286 CTGGGATGTGGGAGGCAGCCTGG + Intronic
1183360163 22:37379232-37379254 CTGGGCTGCGGGAGGGAAGCAGG - Intronic
1184666049 22:45989721-45989743 CTGTGTGGTGTGGGGGAAGCAGG - Intergenic
1184717602 22:46290790-46290812 CTAAGTGGAGGGAGGCAAGCTGG - Intronic
949720027 3:6978211-6978233 ATGTGTAGAGGGAGGCAAGATGG + Intronic
950031881 3:9859051-9859073 ATGTGTTGTGGGAGGGACTCAGG + Intergenic
950953225 3:17023401-17023423 CCGTGTTGTGGGAGGGACCCAGG + Intronic
950965642 3:17143993-17144015 CTGGGGTGTGTGAGGAAAGCTGG + Intergenic
952029600 3:29125434-29125456 ATGTGTTGTGGGAGGGATCCAGG + Intergenic
952867750 3:37865930-37865952 CTTTGCTGTGGGAGGCAGGAGGG + Intronic
952879200 3:37972698-37972720 CTGTGCTGTGTGGGGCAGGCAGG + Intronic
954360777 3:50121709-50121731 CTGTGTTGTTGGTGGCCACCAGG + Intergenic
954859355 3:53674757-53674779 CCGGGTTGTGGGGGGCAGGCAGG + Intronic
954899315 3:54005544-54005566 CTGGGATGTGGGTGGCAAACAGG + Intergenic
956712211 3:72048638-72048660 CTCTGCTGTGTGAGGGAAGCAGG + Intergenic
957762048 3:84571905-84571927 CTGTGTTGTGGGATGGACCCAGG - Intergenic
957762310 3:84573843-84573865 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
957988320 3:87598395-87598417 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
959013194 3:101102735-101102757 CTGTATTGAGACAGGCAAGCAGG + Intergenic
959367243 3:105476877-105476899 ATGTGTTGTGGGAGGGAGTCAGG + Intronic
960263926 3:115598742-115598764 ATGTGTTGTGGGAGGCACCCAGG + Intergenic
960841242 3:121961979-121962001 ATGTGTTGTGGGAGGAACCCAGG + Intergenic
960996767 3:123345311-123345333 CTGTGTTGGCCGAGGCAGGCTGG + Intronic
961512163 3:127409681-127409703 CTGTGGGCTGGGAGGCCAGCAGG - Intergenic
961580371 3:127875815-127875837 CTATTTTGTGGCAGGCAAGCTGG + Intergenic
961683018 3:128611531-128611553 GTGTGTGGTGGGAGGCAGCCTGG - Intergenic
962170661 3:133098344-133098366 ATGTGTTGTGGGAGGGACCCCGG - Intronic
962492522 3:135908306-135908328 TTGTCTTGCGGGAGGCAAGCAGG - Intergenic
962960265 3:140304757-140304779 GTGTGTAGTGGAAAGCAAGCTGG + Intronic
963095638 3:141536369-141536391 ATGTGTTGTGGGAGGAACCCGGG - Intronic
963350904 3:144149897-144149919 GTGTGTTGTGGGGGGCAGGGGGG - Intergenic
963379169 3:144506701-144506723 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
964427532 3:156569072-156569094 ATGTGTTGTGGGAGGGACCCGGG + Intergenic
964588983 3:158340104-158340126 ATGTGTTGTGGGAGGGATCCAGG + Intronic
964654410 3:159050996-159051018 ATGTGTTGTGGGAGGGACCCAGG + Intronic
964654682 3:159052875-159052897 ATGTGTTGTGGGAGGGACCCAGG + Intronic
965300017 3:166997268-166997290 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
965500151 3:169446251-169446273 ACGTGTTGTGGGAGGGAACCAGG + Intronic
966733495 3:183169743-183169765 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
967417903 3:189239368-189239390 ATGTGTTGTGGGAGGGAACCAGG - Intronic
967551421 3:190800260-190800282 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
967962601 3:194938048-194938070 CAGAGTTCTGGGAGACAAGCAGG + Intergenic
968359443 3:198137046-198137068 CTGGGCTGTGGGTGCCAAGCTGG + Intergenic
969680004 4:8637599-8637621 CTGTGTGGTGGGCGGGGAGCTGG + Intergenic
970218208 4:13780886-13780908 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
970357996 4:15276995-15277017 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
970426717 4:15952797-15952819 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
971299321 4:25428824-25428846 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
972328788 4:38043961-38043983 CTGTGTTGTGAGACTCAAACAGG - Intronic
972856999 4:43119676-43119698 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
973635569 4:52859162-52859184 CTGGGTTGTGGCAGTCAAGGAGG - Intergenic
973718297 4:53699633-53699655 ATGTGTTGTGGGAGGGACCCAGG - Intronic
974104866 4:57458390-57458412 ATGTGTTGTGGGAGGTACCCAGG - Intergenic
974453922 4:62101613-62101635 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
974853292 4:67429318-67429340 CTTTGTTCTGGGAAGCAAGTTGG - Intergenic
974861952 4:67533138-67533160 CTGTGTTGTGGAAGGCGCCCAGG + Intronic
975183827 4:71378092-71378114 ATGTGTTGTGGGAGGTACCCAGG - Intronic
975312149 4:72914417-72914439 ATGTGCTGTGGGAGGCACCCAGG + Intergenic
975919829 4:79371683-79371705 ATGTGTTGTGGGAGGGACTCGGG - Intergenic
976405433 4:84657021-84657043 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
977005156 4:91558794-91558816 ATGTGTTGTGGGAGGGACCCAGG - Intronic
977026224 4:91822075-91822097 ATGTGTTATGGGAGGGAACCAGG - Intergenic
978100936 4:104840607-104840629 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
978284356 4:107058063-107058085 ATGTGTTGTGGGAGGGACCCAGG - Intronic
978934286 4:114356088-114356110 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
980432755 4:132725960-132725982 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
981393429 4:144218191-144218213 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
981677750 4:147359519-147359541 ATGTGTTGGGGGAGGTAACCCGG - Intergenic
982193080 4:152877711-152877733 ATGTGTTGTGGGAGGGACCCAGG + Intronic
982482833 4:155933151-155933173 ATGTGTTGTGGGAGGAACCCAGG + Intronic
982849392 4:160293521-160293543 ATGTGTTGTGGGAGACACCCAGG - Intergenic
982949041 4:161665008-161665030 ATGTGTTGTGGGAGGGACCCAGG - Intronic
984836694 4:184028927-184028949 CTGTGGTGCGGCAGGCAAGGGGG + Intergenic
985043808 4:185919351-185919373 CTGTGCTGTGGGATGAAACCAGG + Intronic
985352571 4:189081536-189081558 ATGTGTTGTGGGAGGGATCCTGG - Intergenic
985970398 5:3373603-3373625 ATGTGTTGTGGGATGGAGGCTGG + Intergenic
986114080 5:4751766-4751788 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
986650889 5:9962347-9962369 ATGTGTTGAGGGAGGAAAGGAGG - Intergenic
987333228 5:16875089-16875111 ATGTGTTGTGGGAGGGACCCAGG - Intronic
987471933 5:18341854-18341876 CTGTGTTGTGCCATGCCAGCAGG - Intergenic
987806485 5:22775834-22775856 GTGTGTTGTGGGAGGGACCCAGG + Intronic
988128985 5:27079123-27079145 ATGTGTTGTGGGAGGGACCCTGG - Intronic
988204542 5:28116553-28116575 ATCTGTTGTGGGAGGGAACCAGG - Intergenic
989532403 5:42523777-42523799 ATGTGTTATGGGAGGCACCCAGG + Intronic
989637253 5:43549363-43549385 ATGTGTTGTGGGAGGGACCCAGG + Intronic
989807274 5:45624779-45624801 TTGTGTTTATGGAGGCAAGCAGG + Intronic
990126069 5:52518822-52518844 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
991925828 5:71704157-71704179 GTGTGTGGTGGGAGGTCAGCAGG - Intergenic
991969574 5:72126116-72126138 CTGTGTTGAGGGAAGCAGGGAGG + Intronic
993098123 5:83505050-83505072 ATGTGTTGTGGGAGGGACCCAGG - Intronic
994590630 5:101768221-101768243 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
994920259 5:106033504-106033526 AAGTGTTGTGGGAGGGAAACAGG - Intergenic
995797541 5:115957742-115957764 CTGTGAAGTAGGAGGCAAGGGGG + Intergenic
996196187 5:120610498-120610520 CCGTGTTGTGGGAGGGACCCAGG + Intronic
996222666 5:120952659-120952681 ATGTGTTGTGGGAGGGATCCAGG + Intergenic
996670437 5:126112087-126112109 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
997506443 5:134421389-134421411 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
997652079 5:135529674-135529696 ATGTGTTGTGGGAGGGACGTGGG + Intergenic
997978447 5:138454088-138454110 CTGTGTTGCACGGGGCAAGCGGG - Intergenic
998059488 5:139108529-139108551 CAGGGCTGTGGGAGGCAGGCTGG + Intronic
998144382 5:139718285-139718307 ATGTGTTGTGGGAGGGATCCAGG + Intergenic
998148642 5:139744803-139744825 CTGTGGTCTGGGAGCCAAGTGGG - Intergenic
998576513 5:143323480-143323502 ATGTGTTGTGGGAGGGACCCGGG - Intronic
998576812 5:143325406-143325428 ATGTGTTGTGGGAGGGACCCAGG - Intronic
998722836 5:144974387-144974409 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
998889196 5:146728636-146728658 ATGTGTTGTGGGAGGGACCCAGG + Intronic
999669243 5:153944441-153944463 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
1001061205 5:168490516-168490538 CTGTATTGTGGGAGGCATATTGG + Intronic
1001077555 5:168641833-168641855 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1001352405 5:170981456-170981478 ACGTGTTGTGGGAGGGAAGCAGG + Intronic
1001930098 5:175666676-175666698 CAGTGCTTTGGGAGGCAAGGCGG - Intronic
1002704099 5:181148734-181148756 GTGTGCTGTGGGAGCCAAGATGG + Intergenic
1003401904 6:5797502-5797524 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1003570562 6:7253815-7253837 CTGTGTTGCTGGGGACAAGCTGG + Intergenic
1003856506 6:10281359-10281381 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1004192023 6:13472174-13472196 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1004991256 6:21141043-21141065 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1005507810 6:26485143-26485165 CTGTGCTGTGGTAGTCAAGATGG - Intergenic
1005905152 6:30255973-30255995 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1006046873 6:31306257-31306279 CTATGGTGTGGGGGGCAACCAGG + Intronic
1006055364 6:31379928-31379950 ATGTGCTGTGGGAGGAGAGCAGG - Intergenic
1007550054 6:42722351-42722373 CTGTGCTGTGGGAAGCAACCCGG - Exonic
1007971593 6:46057213-46057235 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1008386490 6:50897346-50897368 CAGTGTGGTGGGAGGGGAGCTGG - Intergenic
1008500023 6:52171254-52171276 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1008755981 6:54796167-54796189 CAGTGTTGTGGGAGGTACCCAGG + Intergenic
1009980631 6:70721902-70721924 ATGTGTTGTGGGAGGGATCCGGG - Intronic
1011559436 6:88599798-88599820 CTGGGAGGTGGGAGGCAGGCTGG + Intergenic
1012365715 6:98437167-98437189 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1014022100 6:116603117-116603139 TTGTGTTGTGGGAGGGACCCAGG - Intergenic
1014488753 6:122035898-122035920 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1014770953 6:125457822-125457844 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1014771233 6:125459618-125459640 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1015214676 6:130735905-130735927 CTGCATTGTGGGAGTCAAGGAGG - Intergenic
1015978803 6:138818413-138818435 CTGTGATCTGTGAGGCAATCTGG + Intronic
1016341210 6:143062986-143063008 CTGTGTTGTGGGAGCAAGGCAGG + Intronic
1016411033 6:143784911-143784933 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1016450809 6:144180421-144180443 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1017036318 6:150270332-150270354 CTGTGTAAGGGGAGGCATGCTGG + Intergenic
1017121460 6:151028100-151028122 CTGGGTTGAGGCAGGGAAGCAGG + Intronic
1017791055 6:157799810-157799832 CAGTGTTGTGGGAGGGACCCAGG - Intronic
1017885568 6:158596889-158596911 ATGTGTTGTGGGAGGGACCCGGG - Intronic
1018433592 6:163742545-163742567 CAGGGTGGTGGGAGGCATGCAGG - Intergenic
1018867060 6:167754463-167754485 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1018924079 6:168194517-168194539 CTGTGTTCTTGGAGGCTAGAGGG + Intergenic
1019115402 6:169757107-169757129 CCATGTTGTGGGAGGGACGCAGG - Intronic
1019441510 7:1049904-1049926 CTGGCTGGTGGGAGGCAATCAGG - Intronic
1019631941 7:2054086-2054108 CTGTGTTGGGGGAGGTGGGCTGG - Intronic
1021180575 7:17500841-17500863 CTGTGAGGTGGGAAGCCAGCTGG - Intergenic
1021292715 7:18865608-18865630 CTGTGTTGTGTGAGGCACTGGGG + Intronic
1021819261 7:24480080-24480102 CTGTGGGATGGGAGGCAAGGTGG - Intergenic
1022678239 7:32520873-32520895 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1022937854 7:35199101-35199123 CTGTGATGTGTTAGACAAGCTGG + Intergenic
1023082063 7:36535192-36535214 GTGTGTTGTGGGGAGCCAGCGGG + Intronic
1023606609 7:41937105-41937127 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1024252643 7:47518125-47518147 TGGTGCTGTGGGAGGCAGGCTGG - Intronic
1024289650 7:47793341-47793363 CTGTGTTGTGGGAGGGACCTGGG + Intronic
1025300256 7:57814331-57814353 ATGTGTTCAGGGAGGGAAGCAGG - Intergenic
1026204679 7:68246509-68246531 TGGTGTTGTGGGAGGAAGGCAGG + Intergenic
1027302344 7:76853093-76853115 TTGTGTTGTGGGAGGGACCCCGG - Intergenic
1027488628 7:78793425-78793447 CTCTGTTGTGGGAGGCTGTCTGG - Intronic
1027798208 7:82719873-82719895 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1028011070 7:85645184-85645206 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1028038758 7:86020145-86020167 AGGTGTTGTGGGAGGCTACCGGG - Intergenic
1028259490 7:88643959-88643981 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1028795393 7:94896175-94896197 ATGTGTTGTGGGAGGGACCCGGG - Intergenic
1029033407 7:97492546-97492568 CTGTGTTGTGGGAGGGACCCAGG - Intergenic
1029548024 7:101221566-101221588 CTGTGTTGAGGGAGTCACTCTGG + Intronic
1030094062 7:105882273-105882295 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1030094406 7:105885259-105885281 CTGGGTGGTGGGAGAGAAGCAGG + Intronic
1030106128 7:105989082-105989104 CTGTGTTGTGGTGGGCATGCAGG + Intronic
1030583535 7:111388794-111388816 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1031145858 7:117995922-117995944 ATGTGTTGTGGGAGGAACCCAGG + Intergenic
1031175177 7:118339952-118339974 ATGTGTTGTGGGAGGGATTCAGG + Intergenic
1031217928 7:118921494-118921516 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
1031955016 7:127934166-127934188 CTGTGTTGGGGGAGGGGAGTAGG + Intronic
1032362923 7:131272850-131272872 ATGTGTTGTGGGAGGGACCCGGG - Intronic
1033419875 7:141195980-141196002 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1033580169 7:142725920-142725942 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1034286607 7:149887768-149887790 CTGTGTTGTGGGAGGGACCAGGG + Intergenic
1034320387 7:150174428-150174450 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1034687675 7:152987518-152987540 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1034772355 7:153792793-153792815 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1035825288 8:2638461-2638483 ATGTGTTGTGGGAGGGACACAGG - Intergenic
1036663699 8:10725635-10725657 CTGAGCGGTGGGAGGAAAGCTGG + Exonic
1036676019 8:10833777-10833799 CTGGGCTGCGGGAGGCAAGAGGG + Intronic
1037149312 8:15616670-15616692 CTGTGCTGTGGGTGGCAGGAAGG + Intronic
1038138886 8:24821463-24821485 TTGTGTTGTGGGAGGGACCCAGG + Intergenic
1038139164 8:24823360-24823382 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1038368982 8:26969171-26969193 TTGTGTAGTGAGAGGCAAGGAGG + Intergenic
1039071846 8:33656083-33656105 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1039373097 8:37006786-37006808 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1041079843 8:54205996-54206018 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1042291636 8:67174989-67175011 CTGTGTTCTGGGTGGCATCCTGG + Intronic
1042432672 8:68726854-68726876 GTGTGTTGTGGGAGGGACCCGGG - Intronic
1044718412 8:95122745-95122767 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1044992258 8:97806621-97806643 CTGTATTGTGGGAGGGACCCAGG + Intronic
1045884024 8:107074881-107074903 CTTTTTTGTGGTAGGCAAGATGG - Intergenic
1047195617 8:122718572-122718594 ATGTGCTGTGGGAGGGAACCAGG + Intergenic
1047628184 8:126678038-126678060 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1048164909 8:132053897-132053919 CTGTGTTGAGGGAGCCAACATGG + Intronic
1048415537 8:134224111-134224133 AAGTGCTGTGGGAGGCTAGCTGG - Intergenic
1048923215 8:139249169-139249191 ATGTGTTGTGGGAGGGACTCAGG + Intergenic
1048987676 8:139743739-139743761 CTGTGGGGTGGGGGGCAGGCAGG + Intronic
1051312185 9:15788141-15788163 CTCTCTTGTGGGAGGCAACATGG + Intronic
1051493471 9:17692996-17693018 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1055372948 9:75619888-75619910 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1056433581 9:86553184-86553206 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1056638539 9:88350734-88350756 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1056829097 9:89899916-89899938 ATGTGTTGTGGGAGGAACCCAGG + Intergenic
1056900063 9:90590514-90590536 CTGTGTTGTGGGGGGCAATGGGG - Intergenic
1057317946 9:93982701-93982723 ATGTGTTGTGGGAGGAACCCAGG + Intergenic
1057617246 9:96602665-96602687 ATGTGTAGTGGGAGGGACGCTGG - Intronic
1057888378 9:98848740-98848762 CGGTCCTGTGAGAGGCAAGCGGG + Intronic
1058174657 9:101723047-101723069 ATGTGTTGTGGGAGGCACGCAGG + Intronic
1058283834 9:103151188-103151210 CTGTGTTGTGAGAGGGATGCAGG + Intergenic
1059677974 9:116558189-116558211 CTGTGATGTTGCAGACAAGCTGG + Intronic
1059716484 9:116917926-116917948 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1059940467 9:119354403-119354425 CTCTGATGTGGGTGGCAAGGTGG + Intronic
1060308305 9:122435848-122435870 ACGTGTTGTGGGAGGGAACCAGG + Intergenic
1061211448 9:129195752-129195774 CGGTGCTGTGGGAGGCAGTCAGG + Intergenic
1062126875 9:134868688-134868710 CTGCGGTGAGGGAGGCACGCTGG - Intergenic
1062368206 9:136222217-136222239 CAGTGTTGTGGGGGGCGCGCTGG - Intronic
1062372795 9:136248852-136248874 CTGGGTTCTGGGAGGCACGTGGG - Intergenic
1062521111 9:136958395-136958417 CTGCCTTGGGGGAGGGAAGCTGG - Intergenic
1062602653 9:137325323-137325345 CTGTGGTGTGGGAGCCCTGCTGG - Intronic
1062744131 9:138200760-138200782 CTGGGCTGTGGGTGCCAAGCTGG + Intergenic
1185561561 X:1063937-1063959 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1186324136 X:8460129-8460151 CTGTGTTGTGGGAAGGAACTAGG - Intergenic
1186924835 X:14322191-14322213 CTGTGTTCTTTGAGGCAACCTGG - Intergenic
1187388604 X:18871259-18871281 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1187420257 X:19127812-19127834 CTGTCTCGTGGGAGGCAAAAAGG + Intergenic
1187871375 X:23767450-23767472 CTGTAGTGTGGGAGGCACGGTGG - Intergenic
1188529645 X:31125533-31125555 CAGTGTTCTGGGAGACAGGCTGG - Intronic
1188588092 X:31801366-31801388 ATGTGTTGTGGGAGGGACCCAGG - Intronic
1188765158 X:34081546-34081568 ATGTGTTGTGGGAGGGACCCAGG - Intergenic
1189378296 X:40482989-40483011 ATGTGTTGTGGGAGGGATCCAGG - Intergenic
1190580932 X:51892974-51892996 GTGTGTTGGGGGAGGAAAGGAGG - Intronic
1190744327 X:53312543-53312565 CTGTGCTGTGGGAGGACAGGAGG - Intronic
1190765472 X:53472650-53472672 CTGTGTTGGGTGGGGGAAGCAGG + Intergenic
1193028779 X:76875213-76875235 CTGTGCTGTGGGTCCCAAGCTGG - Intergenic
1193279006 X:79625820-79625842 CTGTGTTGTGGGAGGAGCCCAGG - Intergenic
1193797363 X:85892360-85892382 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1194501338 X:94685207-94685229 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1194598700 X:95892569-95892591 GTGTGTTGGGGGAGGAAGGCGGG + Intergenic
1195863567 X:109406674-109406696 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1196048087 X:111276930-111276952 CTGTGTTGCGGGAGGGAGGTGGG + Intergenic
1197160438 X:123317198-123317220 CTGTGTTGTGGGAGGGGCCCAGG - Intronic
1197547210 X:127839507-127839529 ATGTGTTGTGGGAGGGACTCAGG - Intergenic
1197931240 X:131698622-131698644 CTGTGATGTGAGTGGCAGGCTGG - Intergenic
1198626262 X:138579005-138579027 ATGTGTTGTGGGAGGGACTCAGG + Intergenic
1198734462 X:139771114-139771136 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1198734747 X:139773034-139773056 ATGTGTTGTGGGAGGGACCCAGG + Intronic
1198790698 X:140342465-140342487 CTGTGGTGGGGGAAGAAAGCAGG + Intergenic
1199208681 X:145180391-145180413 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1199629268 X:149764885-149764907 ATGTGTTGTGGGAGGGACCCAGG + Intergenic
1199808904 X:151329552-151329574 CAGTGTTCTGGGAGCCAAGAGGG + Intergenic
1202091244 Y:21193266-21193288 ATGTGTTGTGGGAGGGACTCAGG + Intergenic
1202097061 Y:21262996-21263018 CAGTGTTGTGGGAGGCAGGGAGG + Intergenic