ID: 1159045649

View in Genome Browser
Species Human (GRCh38)
Location 18:63366902-63366924
Sequence CCTTCCTGGGGACCGCGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159045639_1159045649 -4 Left 1159045639 18:63366883-63366905 CCTTCCCCATTTGGCCATGCCTT 0: 1
1: 0
2: 0
3: 23
4: 245
Right 1159045649 18:63366902-63366924 CCTTCCTGGGGACCGCGGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 188
1159045641_1159045649 -9 Left 1159045641 18:63366888-63366910 CCCATTTGGCCATGCCTTCCTGG 0: 1
1: 0
2: 1
3: 13
4: 191
Right 1159045649 18:63366902-63366924 CCTTCCTGGGGACCGCGGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 188
1159045640_1159045649 -8 Left 1159045640 18:63366887-63366909 CCCCATTTGGCCATGCCTTCCTG 0: 1
1: 0
2: 0
3: 25
4: 217
Right 1159045649 18:63366902-63366924 CCTTCCTGGGGACCGCGGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 188
1159045637_1159045649 19 Left 1159045637 18:63366860-63366882 CCGGGGTGGACGGCGGCAGGTGA 0: 1
1: 0
2: 1
3: 20
4: 195
Right 1159045649 18:63366902-63366924 CCTTCCTGGGGACCGCGGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 188
1159045643_1159045649 -10 Left 1159045643 18:63366889-63366911 CCATTTGGCCATGCCTTCCTGGG 0: 1
1: 1
2: 8
3: 22
4: 274
Right 1159045649 18:63366902-63366924 CCTTCCTGGGGACCGCGGCCTGG 0: 1
1: 0
2: 1
3: 21
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159045649 Original CRISPR CCTTCCTGGGGACCGCGGCC TGG Intronic