ID: 1159045755

View in Genome Browser
Species Human (GRCh38)
Location 18:63367281-63367303
Sequence CGCCTGGGTGGCGCGCGCGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 135}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159045755_1159045766 -4 Left 1159045755 18:63367281-63367303 CCGGCGCGCGCGCCACCCAGGCG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1159045766 18:63367300-63367322 GGCGGGGCGGTGCTTCCAGGGGG 0: 1
1: 0
2: 2
3: 17
4: 238
1159045755_1159045765 -5 Left 1159045755 18:63367281-63367303 CCGGCGCGCGCGCCACCCAGGCG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1159045765 18:63367299-63367321 AGGCGGGGCGGTGCTTCCAGGGG 0: 1
1: 0
2: 2
3: 12
4: 126
1159045755_1159045763 -7 Left 1159045755 18:63367281-63367303 CCGGCGCGCGCGCCACCCAGGCG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1159045763 18:63367297-63367319 CCAGGCGGGGCGGTGCTTCCAGG 0: 1
1: 0
2: 1
3: 17
4: 200
1159045755_1159045767 4 Left 1159045755 18:63367281-63367303 CCGGCGCGCGCGCCACCCAGGCG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1159045767 18:63367308-63367330 GGTGCTTCCAGGGGGCGAGTAGG 0: 1
1: 0
2: 1
3: 11
4: 140
1159045755_1159045764 -6 Left 1159045755 18:63367281-63367303 CCGGCGCGCGCGCCACCCAGGCG 0: 1
1: 0
2: 1
3: 8
4: 135
Right 1159045764 18:63367298-63367320 CAGGCGGGGCGGTGCTTCCAGGG 0: 1
1: 0
2: 1
3: 12
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159045755 Original CRISPR CGCCTGGGTGGCGCGCGCGC CGG (reversed) Exonic
900214118 1:1472058-1472080 CGCCAAGGCGGCGCGCGAGCTGG + Exonic
900221668 1:1512442-1512464 CGCCAAGGCGGCGCGCGAGCTGG + Exonic
901526107 1:9824171-9824193 CGCCTGGAGCGCGCGCCCGCGGG + Exonic
902861853 1:19252203-19252225 AGCCAGGGTGGCGGGAGCGCAGG - Intronic
903301695 1:22383739-22383761 CGCCTGTGTGGCCCACGCCCAGG - Intergenic
905137057 1:35808128-35808150 CTCCCGGCGGGCGCGCGCGCTGG + Intergenic
906204333 1:43979171-43979193 GGCCGCGGGGGCGCGCGCGCGGG + Intronic
906532818 1:46533205-46533227 GGCCAGGGTGGCGGCCGCGCCGG - Intergenic
910759107 1:90718025-90718047 GGCCTCGGTGGCGGGGGCGCGGG - Intergenic
911188560 1:94926812-94926834 CGCCTGGCTCGGGCGGGCGCGGG - Intronic
912603428 1:110963492-110963514 CGCCTGGGTGGCGCACTCTGCGG + Intronic
921671113 1:217925072-217925094 CGCCTGGGCCGAGCGCGCCCAGG - Intergenic
922196481 1:223364206-223364228 CGCCTGGGGAGGGAGCGCGCGGG - Intergenic
922505273 1:226122288-226122310 CGCCTGGAAGGCGCGCGAGCCGG - Intergenic
922726301 1:227924575-227924597 CGCCTGGGTGTCCCAGGCGCAGG + Intronic
922775522 1:228212777-228212799 CTCCTGGGTGCGGGGCGCGCGGG + Intronic
924436752 1:244049089-244049111 CGGCTGGGCGGCGCGGGCGGAGG + Intronic
1063995183 10:11611836-11611858 CGCCTCGGGGACGCGCGCCCAGG + Intergenic
1072021823 10:91410240-91410262 CGCGGGGCTGGCGCGCGCGGGGG + Intergenic
1073446637 10:103584916-103584938 CGCTCGGGTGGCGCGCGGCCCGG + Exonic
1074977708 10:118594890-118594912 CGCCTGCGTGCCGCTCACGCTGG - Exonic
1075206960 10:120456856-120456878 CGCCAGGGCAGCGCGCTCGCTGG - Intergenic
1076657995 10:132036995-132037017 CCGCTGGGTGGGGCCCGCGCAGG + Intergenic
1076750094 10:132538072-132538094 TGCCCGGGCGGCGCGGGCGCTGG - Exonic
1083950978 11:65955993-65956015 CTCCTGGGTGCAGCGGGCGCAGG + Intronic
1084315713 11:68344081-68344103 CGCCTGGGTGCATCGCCCGCAGG + Intronic
1086361848 11:86068598-86068620 CGCGCGGGTCGCGCGGGCGCCGG + Intronic
1086450019 11:86906424-86906446 CGCCGGGGTGGCGCAGGGGCGGG - Intronic
1087795674 11:102452832-102452854 GGGCTGGGTGGCGCGGGGGCGGG + Exonic
1090270122 11:125380142-125380164 CGCCTGGGTGCCGGGAGGGCGGG - Intronic
1093958699 12:25250621-25250643 CGGGTGGGGGGCGCGGGCGCGGG - Intronic
1094317558 12:29149665-29149687 CGCCAAGGTGGGGCGCGCGGGGG + Intronic
1097850251 12:64404420-64404442 CGCGTCGGTGCCGCGCGGGCGGG - Exonic
1098595826 12:72272581-72272603 GGCCCGGGTGGCCCGCCCGCGGG + Intronic
1100611317 12:96194150-96194172 CCCCTGGGGGTCGAGCGCGCGGG - Intergenic
1102339215 12:112108606-112108628 CGCCTGCCCGGCCCGCGCGCCGG + Intronic
1102519810 12:113471266-113471288 CGCCCCAGTGGAGCGCGCGCAGG + Intronic
1103488189 12:121296734-121296756 CGCCCGGGCGGCGGGCGCGCGGG + Intronic
1103764649 12:123271620-123271642 CCCCCGGGCGGCGGGCGCGCCGG + Exonic
1106109039 13:26760816-26760838 GGCGGGGGCGGCGCGCGCGCGGG - Intergenic
1114649068 14:24271630-24271652 CGGCTCGGAGGCGCGTGCGCGGG + Intronic
1119326085 14:73760249-73760271 CGCCGCGGTGCCGCGCGCGCCGG - Exonic
1122975346 14:105168596-105168618 GGCCTGGGCGGCGGGCGTGCAGG + Exonic
1123499455 15:20866738-20866760 CGCGTGCGGGGCGCGCGTGCGGG + Intergenic
1123556707 15:21440468-21440490 CGCGTGCGGGGCGCGCGTGCGGG + Intergenic
1125527108 15:40383389-40383411 CGAATGGGTGGCGCGGGCACGGG + Intronic
1126649650 15:50908301-50908323 CGGGCGGGTGGCGCGCGCTCCGG + Intergenic
1129082291 15:73052125-73052147 CGGGTGCGGGGCGCGCGCGCCGG - Intronic
1131277416 15:90994082-90994104 CGCCTGGGTGGAGGCCGCCCCGG + Intronic
1202965049 15_KI270727v1_random:167657-167679 CGCGTGCGGGGCGCGCGTGCGGG + Intergenic
1132551763 16:556526-556548 CGCCTGAGTGGCAGGCGGGCTGG - Intergenic
1132735745 16:1384982-1385004 GGCCTGGGTGCCGCAGGCGCTGG - Intronic
1133032428 16:3017788-3017810 AGCCTGGGAGCCGCGCGCCCTGG + Intronic
1133242808 16:4425784-4425806 CGCATGCGTCGCGCACGCGCAGG - Exonic
1136719734 16:32310456-32310478 CGCCAGCTAGGCGCGCGCGCCGG + Intergenic
1136838109 16:33516736-33516758 CGCCAGCTAGGCGCGCGCGCCGG + Intergenic
1141116613 16:81315018-81315040 GGCCGGGCGGGCGCGCGCGCAGG + Exonic
1141931094 16:87203358-87203380 CCACTGGGTGGCGCACGCACAGG + Intronic
1203006697 16_KI270728v1_random:207313-207335 CGCCAGCTAGGCGCGCGCGCCGG - Intergenic
1143596192 17:7915740-7915762 GTGCTGGGTGGCGCGCGCTCCGG - Intergenic
1144952125 17:19000064-19000086 CGCCTGGGAGGGGCGAGCCCCGG - Intronic
1148079443 17:44959795-44959817 CTCCGGGGTGGCGCGCCCGGGGG - Exonic
1149994765 17:61400586-61400608 CGGCTGGAAGGCGCGCGGGCGGG + Intronic
1151601519 17:75109240-75109262 CGGGTGGATGGCGCGCGCCCGGG - Intergenic
1151769503 17:76150819-76150841 CACCTGGGAGGCGCTCGCGTGGG - Intronic
1152110107 17:78353184-78353206 CGCCGGGCTGGCGGGCGGGCAGG - Intergenic
1152352085 17:79789851-79789873 CGCCTTCGTGGCTCGAGCGCCGG + Intergenic
1152834253 17:82519470-82519492 CGCGGGGTTGGCGCGGGCGCGGG - Intergenic
1154457513 18:14543602-14543624 CGCGTGCGGGGCGCGCGTGCGGG + Intergenic
1157384169 18:47247865-47247887 GCCCTGGGGGGCGCGGGCGCAGG - Intronic
1159045755 18:63367281-63367303 CGCCTGGGTGGCGCGCGCGCCGG - Exonic
1160807874 19:1000589-1000611 GGCCAGGGCGGCGCGGGCGCGGG - Exonic
1161080623 19:2308235-2308257 CGCCTGGCGGGGGCGCGCGGGGG + Intronic
1161301803 19:3546362-3546384 CGCCTGGGTGGCGCTGGCGGAGG - Exonic
1161752835 19:6110259-6110281 CGTCCGGGTGGTGCGCCCGCGGG - Intronic
1162808969 19:13153031-13153053 GGCCTGGGTGGCGGGCGCCTGGG + Exonic
1163708630 19:18832390-18832412 GGCCCGGGCGGCGCGGGCGCGGG + Exonic
1165431389 19:35775488-35775510 CGCCCCCGTGGGGCGCGCGCCGG + Intronic
1166798983 19:45444332-45444354 CGCCCGGGAGGGGCGCGGGCCGG - Intronic
1167501516 19:49851243-49851265 CGACTGAGGGGCGCGGGCGCGGG - Exonic
1168076389 19:53982742-53982764 GGCGCGGGTGGCGCGGGCGCGGG - Exonic
1168638317 19:58013289-58013311 CGCCTTGGTGGCGCTCATGCTGG - Intergenic
931052306 2:58428496-58428518 AGCGGGGGTGGCGCGCGCGGCGG - Intergenic
932779080 2:74548961-74548983 CGCCTGGGTGTGTCCCGCGCAGG - Intronic
934670301 2:96208389-96208411 CGCCTGGCTGGCGGGGACGCGGG - Exonic
937203777 2:120223186-120223208 CGCTGGGGTGTGGCGCGCGCGGG + Exonic
937316975 2:120937881-120937903 GGCCTGGGTGGCCGGCGGGCTGG - Intronic
938407287 2:131039658-131039680 GGGATGGGTGGCGCGCCCGCTGG - Intronic
938500063 2:131827668-131827690 TGGCTGGGTGGCGTGGGCGCGGG + Intergenic
946250100 2:218406448-218406470 GGCCTGGGTGGGGCCGGCGCCGG + Intergenic
946690389 2:222304863-222304885 CGCGAGGATGGTGCGCGCGCAGG - Exonic
1169554604 20:6736009-6736031 TGCCTGGGTAGCGCGCCAGCTGG - Intergenic
1170924688 20:20712359-20712381 CTGCTGGGTGAGGCGCGCGCCGG - Exonic
1174531996 20:51221714-51221736 CGCCTGGGTGGCGGGAGCAGAGG + Intergenic
1174607107 20:51768700-51768722 CGCGTGGGGGGCGCGGGCGCGGG - Intergenic
1175975628 20:62709064-62709086 CGACTGGACGGCGCGCCCGCTGG + Exonic
1176125275 20:63472270-63472292 CGCGCGGGCGGCGCGGGCGCCGG - Exonic
1177834056 21:26170566-26170588 CGCCTGGACGGCTCGGGCGCTGG - Exonic
1180225365 21:46388845-46388867 TGCCTGGATGACGCGGGCGCAGG + Exonic
1182211335 22:28679766-28679788 CGCCAGCTAGGCGCGCGCGCCGG + Exonic
1183349117 22:37324912-37324934 CGCCCGGGTGGCGCGGGAGCGGG - Intergenic
1185342930 22:50299685-50299707 GGACTGGGTGGAGAGCGCGCGGG + Intronic
951017060 3:17742735-17742757 CGCCTGGGAAGCTCGTGCGCAGG + Intronic
954395795 3:50292628-50292650 CGCGGGGCTGGGGCGCGCGCAGG - Exonic
961340397 3:126213380-126213402 CGCCAGGGAGGCGCGCGGGCGGG - Intergenic
961755113 3:129122441-129122463 GGCCTGGGTGGGGGGCGAGCAGG - Intronic
968610997 4:1556895-1556917 GGCCTGGGTGCCGCCCGCCCCGG - Intergenic
969436542 4:7192431-7192453 CGCCTGGGCGGCGGGCCGGCCGG + Intergenic
985896287 5:2751551-2751573 AGCCTGGGCGGCCCGCGGGCCGG + Exonic
986042864 5:4010689-4010711 CGCCTGGGAGGGGCCCACGCAGG - Intergenic
994078322 5:95678581-95678603 TGCCTGGGTGGCGCGGGGGAGGG + Intronic
1002445020 5:179285367-179285389 CGCCTGGCTGGCCCCTGCGCTGG - Intronic
1003948181 6:11094079-11094101 CGCCGGGGTGGCCAGAGCGCGGG - Exonic
1013836834 6:114343316-114343338 CGCCTGGGTGGGACGCGCAGTGG - Intergenic
1015625902 6:135181083-135181105 GGCCCGGGAGGCGCGCGGGCAGG - Intergenic
1020796801 7:12686834-12686856 CGCCCGGGCGGCGCGCGGGCAGG + Intronic
1024579953 7:50793348-50793370 CCCCTGGGTGGCGGCAGCGCCGG - Intronic
1025904101 7:65770555-65770577 CGCCTGGTAGGCACGAGCGCAGG - Intergenic
1029483718 7:100827207-100827229 CGCGTCTGTGCCGCGCGCGCGGG + Exonic
1032947275 7:136869131-136869153 TGCGGGGCTGGCGCGCGCGCAGG - Intronic
1034435827 7:151062427-151062449 GGCCTGGGTGGCACGTGGGCAGG - Intronic
1035095104 7:156347915-156347937 CGGCTGGGTGGCTCTCGGGCTGG + Intergenic
1035095111 7:156347943-156347965 CGGCTGGGTGGCTCTCGGGCTGG + Intergenic
1035095133 7:156348055-156348077 CGGCTGGGTGGCTCTCGGGCTGG + Intergenic
1035095140 7:156348083-156348105 CGGCTGGGTGGCTCTCGGGCTGG + Intergenic
1040622200 8:49103094-49103116 GGCCTGGGTGGGGCGCGGGAAGG + Intergenic
1045583093 8:103500350-103500372 CGCCTGGGTGCCCCTCGGGCCGG + Intergenic
1049457330 8:142700385-142700407 CGGGTGGGAGGCGCGCGCCCCGG + Exonic
1049761447 8:144333714-144333736 GGCCGGGGCGGCACGCGCGCGGG - Exonic
1051774487 9:20620465-20620487 AGCCGAAGTGGCGCGCGCGCGGG + Intronic
1053434837 9:38068029-38068051 CCCCTGGGGGGCGCCTGCGCGGG - Exonic
1057245505 9:93451600-93451622 GGCCTGGGCGGCGTCCGCGCCGG + Intronic
1057922042 9:99105327-99105349 CGACTGCGGGGCGCGCGGGCCGG + Intronic
1061128241 9:128689831-128689853 GGCCTGGGTGGCCCGCGCCGCGG + Intronic
1061190772 9:129081350-129081372 CGCCTGCGCGGCGCGCGCGCCGG - Intronic
1062022683 9:134326731-134326753 CGCGTTGGCGGCGCGCGCGGGGG + Intronic
1062060422 9:134492561-134492583 CTCCTGGGTGGGGAGCTCGCAGG + Intergenic
1062362350 9:136193856-136193878 CGCCGGGGTGCAGCGCGGGCTGG - Intergenic
1062499653 9:136846911-136846933 TGGCTGCGTGGCGCGGGCGCGGG - Exonic
1062568770 9:137174908-137174930 CGCCTGGCGGGCGGGCGGGCGGG + Exonic
1186350075 X:8731750-8731772 AGGCTGGGAGGCGCGCGCCCCGG + Intronic
1189321977 X:40092264-40092286 CACTTGGGTGGGGCCCGCGCCGG - Intronic
1191252032 X:58264334-58264356 CGCGTGGGTGGCGTGGGCCCTGG + Intergenic
1195334075 X:103832261-103832283 CCCCTGGCGGGCGCGGGCGCGGG - Intergenic
1195716815 X:107826204-107826226 CCCCTGCGGGGCGCGCGGGCTGG + Exonic