ID: 1159050270

View in Genome Browser
Species Human (GRCh38)
Location 18:63415314-63415336
Sequence GCACTTCCATAGTTTCTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159050266_1159050270 -4 Left 1159050266 18:63415295-63415317 CCATACAAAGGACATCCCCGCAC 0: 1
1: 0
2: 0
3: 5
4: 457
Right 1159050270 18:63415314-63415336 GCACTTCCATAGTTTCTTGATGG 0: 1
1: 0
2: 3
3: 17
4: 131
1159050263_1159050270 19 Left 1159050263 18:63415272-63415294 CCAGAAAGCTTTACCGGAGGGAT 0: 1
1: 0
2: 0
3: 4
4: 40
Right 1159050270 18:63415314-63415336 GCACTTCCATAGTTTCTTGATGG 0: 1
1: 0
2: 3
3: 17
4: 131
1159050265_1159050270 6 Left 1159050265 18:63415285-63415307 CCGGAGGGATCCATACAAAGGAC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 1159050270 18:63415314-63415336 GCACTTCCATAGTTTCTTGATGG 0: 1
1: 0
2: 3
3: 17
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159050270 Original CRISPR GCACTTCCATAGTTTCTTGA TGG Intronic
906115567 1:43354755-43354777 GCACTTGCACTGTTCCTTGATGG - Intergenic
906929278 1:50153072-50153094 TCACTTCCAGACTTTCATGAAGG - Intronic
907895181 1:58681845-58681867 GCAATTCCTGAGTTTTTTGAGGG - Exonic
910356954 1:86369209-86369231 GGACTTACAAAATTTCTTGAAGG + Intronic
912436384 1:109664713-109664735 GCACTACCTTAGGTACTTGAGGG + Intronic
916062942 1:161113971-161113993 ACACTTCCTCAGTTTCCTGAGGG + Intronic
916606509 1:166347824-166347846 GCAGTTCTATAGGTTCTGGAAGG + Intergenic
916618269 1:166467768-166467790 TCACTTCCACAGTGTCTTGAGGG - Intergenic
916644113 1:166765076-166765098 GCACTTCCTGAGTTTCTTTATGG - Intergenic
917184673 1:172340009-172340031 GACCTTTCATAGCTTCTTGATGG - Intronic
917623664 1:176823952-176823974 GCACTTCCTCAGTTTGGTGAGGG - Intronic
919723241 1:200863566-200863588 CCACTTCAAGAGTTCCTTGATGG - Intergenic
924834693 1:247636594-247636616 GCCCTTACATAGCTTCTAGATGG - Intergenic
1063175908 10:3550822-3550844 CCACTTGCATAGCTTCTTGGTGG - Intergenic
1064547359 10:16464129-16464151 GATCTTCCATAATCTCTTGAAGG + Intronic
1068630462 10:59292185-59292207 GAACTTCAATAGTTTCTCAATGG + Intronic
1070418414 10:76211761-76211783 GCAATTCCTTAGTTTGTTGTTGG + Intronic
1070737426 10:78873044-78873066 TAACTTCCAGAGTTTCTTTAGGG + Intergenic
1071096556 10:81981938-81981960 TCACATCCATAATTTCTTTATGG + Intronic
1073247674 10:102103004-102103026 GCAGCTCCCTAGTTTCATGATGG - Intergenic
1074848860 10:117422421-117422443 ACCCGTCCATAGTTTCTGGATGG - Intergenic
1080808671 11:35680737-35680759 GGACTTCCATATGTTGTTGATGG - Intronic
1087017352 11:93566894-93566916 TTACTTCAATAGTTTCTTGAGGG - Intergenic
1087411488 11:97795262-97795284 GAAATTCAATAGTTTCATGATGG - Intergenic
1087519584 11:99214637-99214659 GCACTTCCCTAGTAATTTGATGG + Intronic
1089960521 11:122613726-122613748 CCACTTGCTTAGTTTCTTGATGG + Intergenic
1091171537 11:133523954-133523976 CCCCTTCCATAGTTTCATGTCGG + Intronic
1091387958 12:106990-107012 GCCATTCCATGGTCTCTTGAGGG - Intronic
1091633294 12:2178324-2178346 GCACTTGCTGAGTTTCTTCAAGG + Intronic
1093876311 12:24353327-24353349 GCCCTTCCATAGTTTCTTTACGG - Intergenic
1094100922 12:26761260-26761282 GCCCGTCCAGAGATTCTTGATGG - Intronic
1095162783 12:38936721-38936743 GATCTTTCATAGTTCCTTGATGG + Intergenic
1095536114 12:43249906-43249928 TCATTTCCACAGTTTCTTGTGGG + Intergenic
1098208918 12:68141971-68141993 ACACTAACATAGTTTCTGGAAGG - Intergenic
1100849985 12:98699479-98699501 TCACTTCCATATCCTCTTGAGGG - Exonic
1101257338 12:102991346-102991368 GCAATTCCATAGTGTTTTGGGGG - Intergenic
1101562955 12:105877092-105877114 GCACTTTCAAAGTGTCTTGTTGG - Intergenic
1103094639 12:118122946-118122968 GCCGATCCTTAGTTTCTTGATGG + Intronic
1103585218 12:121948156-121948178 TCACTTCCATAGTTTCTGCAGGG + Intronic
1105663025 13:22520257-22520279 TGACTTCCATAGTTTCTTTAAGG - Intergenic
1107984670 13:45765338-45765360 GAACTTCCAGAGATTCCTGAAGG + Intergenic
1108902731 13:55432952-55432974 GCAATTCCTTACTGTCTTGAAGG - Intergenic
1109684747 13:65803368-65803390 GCCTTTCCTTATTTTCTTGAAGG - Intergenic
1114882305 14:26801491-26801513 GCATATCCATAGATTTTTGATGG - Intergenic
1116316428 14:43401108-43401130 GAACTTTCATAATTTGTTGAGGG - Intergenic
1120770791 14:88377730-88377752 GCACTTTCATTGTGTCTTGTAGG + Intergenic
1124040074 15:26093765-26093787 GCATTTCCATACTTTCTAGCTGG + Intergenic
1125786534 15:42323281-42323303 GCACTACCATAGCATCTTGAAGG - Intronic
1126232327 15:46341714-46341736 TTACTGCCTTAGTTTCTTGAAGG + Intergenic
1127750024 15:62028244-62028266 GCATTTCCATATTTTCTAAAAGG + Intronic
1128409511 15:67380247-67380269 GAACTTCCTTAATTTTTTGAAGG + Intronic
1130455983 15:84108739-84108761 GCACTTTCATATATTGTTGATGG + Intergenic
1131542319 15:93284877-93284899 ACACTTCCATTGGTCCTTGAAGG - Intergenic
1134635381 16:15787769-15787791 GCACTTACATCCTTTCTTGAAGG - Intronic
1135168461 16:20162188-20162210 GCATTTGCATAGCTTTTTGAAGG - Intergenic
1137972840 16:53002608-53002630 TCACTTCCATAGGTACATGATGG - Intergenic
1138457938 16:57132045-57132067 GCAGTGCCATTGTTTGTTGACGG + Intronic
1139906898 16:70372321-70372343 GCACATCTATCGTTTCTTCAGGG - Exonic
1140502551 16:75446624-75446646 GCACTTCTATAGTTTCTCAAGGG + Intronic
1150265833 17:63831947-63831969 TCACTTCCATAATTTCTTGATGG - Exonic
1150478177 17:65489493-65489515 GCAATTACATAGTGTGTTGAAGG - Intergenic
1153146151 18:2034836-2034858 GCACTGCCATATTTTCTTAGGGG - Intergenic
1158186157 18:54774079-54774101 TCAGTTGCATAGTTTCTTGAAGG - Intronic
1159050270 18:63415314-63415336 GCACTTCCATAGTTTCTTGATGG + Intronic
1160933215 19:1580530-1580552 GCACTTCCAGAGTTTCCTGCAGG + Intronic
1165619807 19:37236173-37236195 CCACTGGCCTAGTTTCTTGATGG - Intronic
926519237 2:13889520-13889542 GAACTTTCATACATTCTTGATGG + Intergenic
926644644 2:15276178-15276200 GCATTTCACTAGTTACTTGAAGG + Intronic
929953739 2:46438781-46438803 ACATTTCCATATTTCCTTGATGG + Intronic
936894068 2:117406760-117406782 GCATTTAGTTAGTTTCTTGAAGG + Intergenic
939203266 2:139066249-139066271 GCAGATCCATAGTTCTTTGATGG - Intergenic
939205049 2:139090906-139090928 GCACTTTCATTGGTTCTTGTTGG - Intergenic
939441082 2:142250603-142250625 GCAGTTTCATAGTGTCTTAAAGG - Intergenic
944121745 2:196247999-196248021 GCACTACAATAATTTCTGGAAGG + Intronic
1172374025 20:34421424-34421446 GATCTTCCAAAGTTTCTTGTGGG + Intronic
1181454137 22:23046446-23046468 TCACTGACATAGTTGCTTGAGGG - Intergenic
1183325810 22:37193056-37193078 ACACTTCCATACTTTCTAGGTGG + Intronic
1183796802 22:40125420-40125442 TCACTGCCATACTTTCTTGCAGG + Intronic
1184801686 22:46764575-46764597 TCACATCCATAGTTTCCAGATGG - Intronic
950664077 3:14484342-14484364 GGTCTTCCCTAGTTTCCTGAAGG - Intronic
952946384 3:38480355-38480377 GCTCATCCAGAGTTTCTTAAAGG - Intronic
955956447 3:64294613-64294635 GCGTTTCCATAGTTTCTGAATGG - Intronic
956541168 3:70341239-70341261 GCTCTTCCATGGTCTCTTGTGGG - Intergenic
959017505 3:101152436-101152458 GCTCTTCCACAGCTTCTGGAGGG - Intergenic
961914521 3:130358709-130358731 GGACTTCCATATGTTCCTGAGGG + Intronic
964547757 3:157853492-157853514 GCTCTTCCTCAGTTCCTTGAGGG + Intergenic
965204784 3:165707897-165707919 GCACTTTTATAGCATCTTGAGGG + Intergenic
965594278 3:170393541-170393563 GGAATTCCATAGTTTCAGGAGGG + Exonic
965681739 3:171258768-171258790 CCACTTCCAGAGTTTCTTAGAGG - Intronic
969475325 4:7419264-7419286 GCAGTTCCATAGGGTCCTGAGGG + Intronic
970539791 4:17065947-17065969 ACACTTGCATCTTTTCTTGAAGG + Intergenic
975383824 4:73732176-73732198 GCACTTCCTTCTTTTCTTGGGGG + Intergenic
976027106 4:80701728-80701750 GCACTGCAGTATTTTCTTGATGG + Intronic
976889075 4:90022933-90022955 TCACTTGCATATTTTCTTAATGG - Intergenic
976909691 4:90286469-90286491 CCACTTACACAGTTTATTGATGG + Intronic
978885675 4:113763030-113763052 GCAATTGCATAGTTTCATTAAGG - Intergenic
979608895 4:122669763-122669785 GCACCTCCATATTTTCTTACTGG + Intergenic
979885842 4:126026247-126026269 TCACTTCCAGAGTTTCTGAATGG + Intergenic
980131676 4:128822095-128822117 GCATATACATAGTTTATTGATGG + Intronic
980485095 4:133446416-133446438 GAACTTCCATATATTCTTGGTGG - Intergenic
981137826 4:141232649-141232671 TCACTTCCTTAGTATCTTAAGGG - Intronic
981198636 4:141950781-141950803 GTTCTTTCCTAGTTTCTTGAGGG - Intergenic
982380182 4:154741501-154741523 GAGTGTCCATAGTTTCTTGAAGG - Intronic
982866722 4:160522171-160522193 TGACTTCCAGACTTTCTTGATGG + Intergenic
983196557 4:164813165-164813187 GCAGTTGCAAAGTTTTTTGAGGG + Intergenic
985420702 4:189782556-189782578 AAACTTCTATAGTTTCTTGTGGG - Intergenic
985710192 5:1423572-1423594 GCAGTTCCACTGTTTTTTGAAGG + Intronic
988053251 5:26057489-26057511 GTTCTTCCATAGTATCTCGAAGG + Intergenic
989621031 5:43384542-43384564 GCAATTCCATAGTATTCTGATGG + Intronic
994600700 5:101900769-101900791 GTACTTGCATACTTTCTTAAGGG + Intergenic
997745844 5:136299542-136299564 TCACTTGCAAATTTTCTTGATGG - Intronic
1003631227 6:7789657-7789679 CCAGTTCCAAAGTGTCTTGACGG + Intronic
1004007886 6:11653634-11653656 GCACCTCCTTAGCTGCTTGAAGG + Intergenic
1005266799 6:24120637-24120659 TCACTTTCATAGTTGCTAGATGG - Intergenic
1009307606 6:62110205-62110227 GAACTTCCATACATTGTTGATGG + Intronic
1010495233 6:76526489-76526511 GAACTTCTATAGTTACGTGAAGG - Intergenic
1012374399 6:98543765-98543787 GCACTCACATAGTCTCTTAAGGG + Intergenic
1013783626 6:113755429-113755451 AGGCTCCCATAGTTTCTTGATGG - Intergenic
1014945129 6:127488211-127488233 CCACTTCCATAGTCTCTTCAGGG + Intronic
1016094547 6:140019956-140019978 GCACCCCCATAGTATCTTGCAGG - Intergenic
1016446721 6:144140600-144140622 GCACTTTCAAATTTTCTTCAGGG + Intergenic
1018645941 6:165948636-165948658 TCACCTCGATGGTTTCTTGATGG - Intronic
1022434811 7:30372721-30372743 TCAATTCCATAGTTTCTTGATGG - Intronic
1023612872 7:41988774-41988796 GCACTTTTATAGTTTCTAGAAGG - Intronic
1023673415 7:42604092-42604114 AGACTTCCAAAGTTTCTTGGTGG + Intergenic
1025834742 7:65083808-65083830 GCAATTTCAGAGTTACTTGAGGG + Intergenic
1026503487 7:70962722-70962744 GCACCTCCACAATTTCTTAAAGG + Intergenic
1028575099 7:92340237-92340259 GCTCTTCCTCAGTTTCCTGAGGG + Intronic
1032564940 7:132931999-132932021 GCACTTCCAATGTTACCTGAAGG - Intronic
1035491750 7:159285155-159285177 GCACTTCGATTGTCTCTTGGTGG - Intergenic
1036772484 8:11588652-11588674 GCACATCCAGAGTTTCAAGATGG + Intergenic
1038108763 8:24469025-24469047 GCATTTCCATATGTTCTTAATGG - Intronic
1039599822 8:38826595-38826617 TCATTTGGATAGTTTCTTGATGG + Intronic
1041906916 8:63043287-63043309 GCAAGTCCATAGTTTCTTTATGG + Intergenic
1041929506 8:63271550-63271572 TTGCTTCCTTAGTTTCTTGAGGG + Intergenic
1042216085 8:66430364-66430386 ACACTTACATACTTTCTTGACGG - Exonic
1042888485 8:73579412-73579434 GCAGGTTCATAGTTTCTTGAAGG - Intronic
1043473025 8:80579933-80579955 GCAGATCCAGAGCTTCTTGATGG - Intergenic
1044722972 8:95168555-95168577 GCACTTCCATTGTGCCTGGAGGG + Intergenic
1046000666 8:108417650-108417672 GCACTTCCGTGTTTTCTTCACGG - Intronic
1046250313 8:111622994-111623016 TCAGTTCCATAGTTTTTGGATGG + Intergenic
1047186330 8:122636695-122636717 GGACTTCCATAGTGTCCAGAAGG + Intergenic
1047799389 8:128293128-128293150 GCACTTTCAAATTTTCTTGTAGG - Intergenic
1057163300 9:92906584-92906606 TCATTTCCATACTTTCTAGATGG + Intergenic
1057355508 9:94328199-94328221 GCCCTTCCATAGTGTTTAGAGGG - Intronic
1057652247 9:96929423-96929445 GCCCTTCCATAGTGTTTAGAGGG + Intronic
1057915401 9:99051644-99051666 CCACTCCCATCTTTTCTTGATGG + Intronic
1058969921 9:110071705-110071727 GCACTACCATTGTTTCTTGTGGG + Intronic
1060247454 9:121958405-121958427 GCATTTCCATTTTTACTTGAAGG - Intronic
1186765883 X:12770235-12770257 CCCCATCCATAGTTTCTTGCAGG - Intergenic
1193261706 X:79415028-79415050 GCACTTCCATATGTTGCTGATGG - Intergenic
1201727486 Y:17169936-17169958 GTACTTCAATAGTTTATTTAGGG - Intergenic