ID: 1159051213

View in Genome Browser
Species Human (GRCh38)
Location 18:63422617-63422639
Sequence GCGGAAGTCGGGCTCGGCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 94}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159051203_1159051213 12 Left 1159051203 18:63422582-63422604 CCGGGAGAAGTAGCCTGGAAGCC 0: 1
1: 0
2: 0
3: 18
4: 172
Right 1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 94
1159051207_1159051213 -9 Left 1159051207 18:63422603-63422625 CCAATCGAGCCCTGGCGGAAGTC 0: 1
1: 0
2: 0
3: 3
4: 28
Right 1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 94
1159051199_1159051213 22 Left 1159051199 18:63422572-63422594 CCTCCCTGGGCCGGGAGAAGTAG 0: 1
1: 0
2: 1
3: 11
4: 183
Right 1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 94
1159051201_1159051213 18 Left 1159051201 18:63422576-63422598 CCTGGGCCGGGAGAAGTAGCCTG 0: 1
1: 0
2: 0
3: 13
4: 162
Right 1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 94
1159051204_1159051213 -1 Left 1159051204 18:63422595-63422617 CCTGGAAGCCAATCGAGCCCTGG 0: 1
1: 0
2: 1
3: 9
4: 109
Right 1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 94
1159051200_1159051213 19 Left 1159051200 18:63422575-63422597 CCCTGGGCCGGGAGAAGTAGCCT 0: 1
1: 0
2: 0
3: 10
4: 122
Right 1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 94
1159051198_1159051213 23 Left 1159051198 18:63422571-63422593 CCCTCCCTGGGCCGGGAGAAGTA 0: 1
1: 0
2: 1
3: 13
4: 151
Right 1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG 0: 1
1: 0
2: 2
3: 6
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159051213 Original CRISPR GCGGAAGTCGGGCTCGGCGC AGG Intergenic
900151307 1:1180394-1180416 GCGGAGGCCGGGCTGGGCCCCGG - Intronic
900283827 1:1890239-1890261 GCGGAAGCCGGGCGCGGCGTCGG - Intronic
903762903 1:25711692-25711714 GAGGAAGTGGGGCCCGGGGCAGG - Intronic
904751081 1:32741806-32741828 GCGGACGGCGGGAGCGGCGCGGG - Intergenic
923055788 1:230425557-230425579 GTGGATGTCGGGGGCGGCGCTGG - Intronic
923506553 1:234610019-234610041 GTGGAGCTCGGGCGCGGCGCGGG + Intergenic
923585208 1:235263697-235263719 GCAGAAGGAGGGCTGGGCGCGGG + Intronic
924957646 1:248944843-248944865 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1064147904 10:12840008-12840030 GAGGAAGTGGGGCTCTGCCCAGG - Intergenic
1064822155 10:19349248-19349270 GTGTAAGTTGGGCTGGGCGCAGG - Intronic
1070328568 10:75402965-75402987 GCGGAGTTCGGGCGCGGCTCCGG + Intergenic
1076963490 10:133786361-133786383 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1077524769 11:3057447-3057469 CCGGAAGACGGGCCCGGCGTGGG - Intronic
1078345105 11:10541012-10541034 GCGGAAGCCTGGCTCGGCAGCGG + Intronic
1084845916 11:71899780-71899802 ACGGGTGTCGGGCTCGGCGACGG - Intronic
1085474792 11:76783156-76783178 GTGGAACCCGGGCTCGGCTCAGG + Intronic
1087712180 11:101567047-101567069 GCTGAAGTCTGGCTCGGGGCGGG + Intronic
1098426101 12:70366663-70366685 GAGGCAGTCGGGCTCGGCGCCGG + Exonic
1103764502 12:123271184-123271206 GCGGGAGTCGGGAGCGGCCCGGG - Intronic
1104977782 12:132559992-132560014 GCGGACGTCGGGCGCGGCGCGGG - Intronic
1114193981 14:20461221-20461243 GCGGGAGTGGGGCTGGGCCCGGG - Exonic
1115689250 14:35826466-35826488 GCGGTGGCCGGGCTGGGCGCCGG + Exonic
1117372787 14:55094073-55094095 GCGGAAGTGGGGGTCGGTGAGGG + Intergenic
1119823981 14:77641934-77641956 GCGGGAGCCGGGGTCAGCGCGGG + Intergenic
1129299218 15:74615840-74615862 GCGGAAGAGGCGCTCGGAGCGGG + Exonic
1129539759 15:76340206-76340228 CCGGAGGTTGGGCTCGGGGCGGG + Intronic
1134134022 16:11668263-11668285 GCGGCGGGCGGGCTCGGCCCTGG - Intergenic
1134163890 16:11915327-11915349 GAGGAAGTCCGGCCGGGCGCCGG - Intronic
1140469243 16:75205382-75205404 GGGGAAGTCGTCGTCGGCGCTGG + Exonic
1140472541 16:75223557-75223579 GGGGAAGTCGTCGTCGGCGCTGG - Exonic
1140663993 16:77212437-77212459 GCGGCAGTCGGGGGCGGAGCGGG - Intronic
1142764065 17:2056068-2056090 GCGAAGGCCGGGCCCGGCGCGGG - Intronic
1147661885 17:42121195-42121217 GCTGAAGCCGGGCTGGGTGCAGG + Exonic
1148559505 17:48597820-48597842 GCGGAAGTCGGACTGCGCGCAGG - Exonic
1151718627 17:75843825-75843847 GCGGAAGTGAGGCTCGGCAGCGG + Intronic
1152697420 17:81804081-81804103 GCGGAGGGCGGGCTCGGGGGCGG - Intergenic
1153972324 18:10237865-10237887 GCGGAGGTGGGGCTGGGAGCTGG + Intergenic
1159051213 18:63422617-63422639 GCGGAAGTCGGGCTCGGCGCAGG + Intergenic
1160631029 18:80246772-80246794 GGGGACGCCGGGCTCGGAGCCGG + Intronic
1160653444 19:246643-246665 GCGGGAGTGAGGCGCGGCGCAGG + Intergenic
1161319168 19:3633125-3633147 GCAGAAGTGGAGCTCGGCTCTGG + Exonic
1161652363 19:5493090-5493112 GGGGAAGTCGGGCACTGGGCGGG + Intergenic
1162030880 19:7916769-7916791 GCGGCACCCGGGCTCGGCGGCGG - Exonic
1166043903 19:40218308-40218330 GCGGGAGGCGGGCGCGGCGGAGG + Exonic
1166852412 19:45767003-45767025 GAGGAAGCCGGGCAAGGCGCGGG + Exonic
1168728625 19:58606815-58606837 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
928511671 2:32009763-32009785 GGAGAAGCGGGGCTCGGCGCCGG + Intronic
929942510 2:46345489-46345511 GGGGAAGTCGGGCTTTGCACTGG - Intronic
934649594 2:96083395-96083417 GGGGAAGTCAGGCCTGGCGCCGG + Intergenic
934966807 2:98730955-98730977 GCGGGAGTTGGGGGCGGCGCCGG - Intronic
936569877 2:113603889-113603911 GCGGGAGTGAGGCGCGGCGCCGG + Intergenic
946019983 2:216634109-216634131 GCGGAAGTCAGGCCCGGGGAGGG + Intronic
946327668 2:218993142-218993164 GCGGGCGCCGGGCCCGGCGCGGG + Exonic
948806589 2:240455835-240455857 GCGGAGCTCCGGCCCGGCGCAGG - Intronic
949088886 2:242182452-242182474 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1168753032 20:297379-297401 GCGGAAGAGAGGCTCAGCGCAGG + Exonic
1172367963 20:34363916-34363938 GCGGACGTCGGGGAGGGCGCCGG - Intronic
1179786520 21:43733440-43733462 GCGGAGGCCGGGCTTGGCCCTGG + Intronic
1179882659 21:44300019-44300041 GCGGAAGGCGCGCGCGGGGCGGG + Intergenic
1180166353 21:46032695-46032717 GCAGAAGCTGGGCTCGGAGCTGG + Intergenic
1180264108 21:46698734-46698756 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
1180609374 22:17085537-17085559 GGGGAAGGAGGGCGCGGCGCTGG + Intronic
1182446521 22:30392828-30392850 GAGGAAGTGGGGCTCGGGGGAGG + Intronic
1182480479 22:30605657-30605679 GCGGAAGTTGGGCTCCCCACTGG + Intronic
1185430346 22:50807115-50807137 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
952287237 3:31981025-31981047 GCGGCGGCCGGGCTCGGCGGCGG - Exonic
962520786 3:136196005-136196027 GCGGCCGTCGTGCTCGGCGGAGG - Intronic
962575430 3:136751817-136751839 GCGGAGGGCGGGCTTGGCGGCGG + Intronic
968603280 4:1520395-1520417 GCGGAAGCCAGGCTCGGGGAGGG + Intergenic
970001364 4:11368928-11368950 GCGGAGGTCGCGCTCCCCGCTGG - Intergenic
985466715 4:190203659-190203681 GCGGGAGTGAGGCGCGGCGCAGG - Intergenic
985706146 5:1402419-1402441 GCCAAAGTTGGGCTCGGCCCTGG + Intronic
993901030 5:93584530-93584552 GCGGCAGCCGGGAGCGGCGCGGG - Exonic
995347763 5:111140230-111140252 GAGGAAGTCAGGCCAGGCGCAGG + Intergenic
996434902 5:123423331-123423353 GCGGAAGCTGGGCGCGGCGGCGG - Intronic
1003290451 6:4775636-4775658 GCGGGAGCCGGGCGCGGCGGAGG - Intronic
1006317618 6:33299487-33299509 GGGGATCTCGGTCTCGGCGCCGG - Intergenic
1010703343 6:79077900-79077922 GAGGAAGTAGAGCTCTGCGCGGG + Exonic
1014797914 6:125747869-125747891 GCGGATGGCTGGGTCGGCGCGGG - Intronic
1019233045 6:170584629-170584651 GCGGAAATCGGGCGCCGGGCCGG + Exonic
1020120531 7:5500748-5500770 GCGGATGGCGGGCTCGTTGCGGG + Exonic
1022975172 7:35549948-35549970 GGGGAGGTGGGGCTCGGCCCGGG - Intergenic
1024587453 7:50854289-50854311 GCGGAGGTCAGGTTCAGCGCAGG + Intergenic
1030598050 7:111562493-111562515 GCGGAGGGCGGGGTCTGCGCGGG - Intronic
1033366027 7:140673138-140673160 GCGGGTGTCGGGCGGGGCGCGGG + Exonic
1034455504 7:151167822-151167844 GCGGGAGCCGGGCGCGGCGGCGG - Intronic
1035512965 8:206377-206399 GCGGGAGTGAGGCGCGGCGCAGG + Intergenic
1036848352 8:12185047-12185069 GCGGCAGTCGGGGTCAGGGCTGG - Intronic
1036869714 8:12427328-12427350 GCGGCAGTCGGGGTCAGGGCTGG - Intronic
1039864623 8:41490396-41490418 GCGGAAGGCGGGGTCGGCCCTGG + Intronic
1040039062 8:42897538-42897560 GCGGAGGACGGGCCCGGCTCCGG + Intronic
1048009364 8:130443633-130443655 GCGGGAGCCGAGCGCGGCGCAGG + Exonic
1049364999 8:142232859-142232881 GCGGAAGTTGGGGTCGGGGAGGG - Intronic
1053462694 9:38282821-38282843 GCAGAAGTGGGGCTGGGGGCTGG + Intergenic
1055321746 9:75088820-75088842 TCGGAAGCCAGGCTCGGGGCCGG - Intronic
1056710916 9:88991378-88991400 GCGGGAGTCGGGGGCGGCGAGGG + Intronic
1059483686 9:114611447-114611469 GCGGGAGGCGTGCTGGGCGCGGG + Exonic
1062586965 9:137253852-137253874 GGGGAAGTGGGGCTGGGCCCTGG - Intergenic
1185736563 X:2500684-2500706 CCGGAAGTGGGGCTGGGCGGGGG - Intronic
1189021738 X:37349040-37349062 GAGAAAGCCTGGCTCGGCGCGGG - Intergenic
1190024721 X:46912729-46912751 GCGGAGGCCGGACCCGGCGCGGG + Intronic
1190726408 X:53193291-53193313 ACGGGAGTCGGGCTCGGGGCCGG - Exonic